The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	114	17879	5349582	transposase,integrase,protease	Enterobacteria_phage(51.72%)	33	9029:9041	18451:18463
WP_001097230.1|114_804_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.5	2.4e-59
WP_032160865.1|818_941_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1279_2239_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028842.1|2450_3116_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.8	8.8e-128
WP_001108038.1|3112_3724_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|3716_3887_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|3883_4066_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153263.1|4062_4590_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_000736898.1|4586_5027_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145931.1|5100_5391_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788866.1|5387_6089_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_000185509.1|6085_6985_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	2.5e-170
WP_000251073.1|7017_7311_-	lambda phage CII family protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_162830753.1|7435_8648_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
WP_001194218.1|8743_8959_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
9029:9041	attL	TGTGAAGATTGGG	NA	NA	NA	NA
WP_000028394.1|9062_9695_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_000618038.1|9691_10096_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000332935.1|10315_10771_+	antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_001299183.1|10779_11649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065374.1|11837_12206_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_024244115.1|12278_12443_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	1.5e-25
WP_001371715.1|12411_12576_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	7.1e-23
WP_073519243.1|12629_12908_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.7e-45
WP_000100844.1|12932_13718_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186784.1|13714_14395_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000149544.1|14391_14574_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|14546_14738_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|14814_15030_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763378.1|15128_15350_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_000120063.1|15560_16163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|16405_16573_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|16612_16831_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|16808_17879_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
18451:18463	attR	TGTGAAGATTGGG	NA	NA	NA	NA
>prophage 2
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	234303	305501	5349582	tRNA,transposase,tail,portal,terminase,protease,head,integrase,capsid,lysis	Enterobacteria_phage(54.9%)	67	242784:242830	295295:295341
WP_000394594.1|234303_235440_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383901.1|235708_237946_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|237932_240905_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|240905_241796_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|241978_242740_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
242784:242830	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|243252_244206_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|244392_245877_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239874.1|246422_247091_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|247456_247570_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|247638_247872_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|248190_248781_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|248878_249454_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_001230450.1|252432_253032_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_073519249.1|253099_256495_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.0	0.0e+00
WP_001309913.1|256555_257203_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|257100_257844_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|257849_258548_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_134793426.1|258871_260059_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.7	1.7e-158
WP_000459457.1|267380_267815_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|267796_268219_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|268234_268975_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|268982_269378_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|269374_269953_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|269964_270318_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|270329_270728_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|270769_271795_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|271850_272183_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123314.1|272192_273512_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001297098.1|273492_275094_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_073519252.1|275090_275297_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	3.8e-29
WP_001027292.1|275293_277219_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|277193_277739_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|278127_278322_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|278486_278693_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|278978_279389_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|279679_279973_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|280063_280246_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|280462_280960_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|280959_281175_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|281763_282861_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|283050_283434_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001360050.1|283451_284441_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|284448_285258_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|285277_285667_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|285663_285990_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|285986_286640_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|286639_287134_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_001250269.1|288061_288241_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|288416_288968_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|288960_289221_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|289318_290011_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|290330_290846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|291316_291679_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|291744_292569_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|292696_293233_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|293223_293586_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|293585_293891_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001298992.1|294117_295281_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|295615_296248_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
295295:295341	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|296250_296766_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|296776_297784_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|300435_301128_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|301347_301890_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|302370_303237_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|303238_303451_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|303558_304080_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|304115_305501_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 3
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	1085353	1142936	5349582	tRNA,transposase,integrase,protease	Vibrio_phage(15.38%)	55	1110734:1110748	1142238:1142252
WP_000811566.1|1085353_1085629_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299244.1|1085745_1087371_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|1087454_1088618_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101648.1|1088620_1089259_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1089268_1089667_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1089684_1090344_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1090394_1091093_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1091111_1091513_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1091639_1092371_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076326.1|1092550_1094992_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|1095030_1095456_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1095660_1096959_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1097062_1097260_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1097341_1098346_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|1098348_1099608_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1099693_1100974_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1101049_1101358_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1101443_1102394_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|1102386_1104234_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|1104243_1105581_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|1105599_1106061_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_073519262.1|1106032_1107580_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|1107578_1108718_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|1108700_1108754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|1109496_1110042_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|1110136_1111189_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
1110734:1110748	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934935.1|1111285_1112254_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|1112275_1115599_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|1115749_1117252_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|1117470_1118448_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|1118772_1120581_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|1120573_1121308_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|1121318_1121714_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|1121724_1122084_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|1122146_1123280_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|1123368_1123902_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|1123898_1124216_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|1124397_1124544_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|1124654_1124780_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|1124831_1125398_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|1125439_1126468_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008071.1|1126857_1127727_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000399648.1|1127973_1128954_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|1129206_1129560_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|1129697_1131344_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1131387_1131681_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|1131956_1133213_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|1133228_1133705_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|1134041_1135478_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|1135595_1136897_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|1137012_1137351_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|1137326_1139024_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|1139060_1139636_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|1140015_1141281_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000998055.1|1141397_1142936_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.9e-298
1142238:1142252	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 4
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	2860450	2867590	5349582		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2860450_2861089_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|2861085_2862348_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|2862344_2863253_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2863448_2864216_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_073519285.1|2864266_2864923_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	2.8e-49
WP_073519286.1|2865028_2867590_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 5
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	2945533	2984643	5349582	tail,portal,terminase,protease,integrase,lysis	Enterobacteria_phage(46.94%)	50	2938653:2938668	2958634:2958649
2938653:2938668	attL	TTTGCAGCATAATAAC	NA	NA	NA	NA
WP_073519287.1|2945533_2946703_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	67.0	6.7e-147
WP_073519288.1|2946663_2946870_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_032219794.1|2946929_2947145_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	93.7	1.7e-27
WP_001242718.1|2947141_2947504_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_032219792.1|2947494_2948031_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	2.4e-99
WP_000081280.1|2948158_2948983_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|2949048_2949411_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|2950097_2950772_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|2950862_2951063_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|2951106_2951658_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087326.1|2951654_2952491_+	ash family protein	NA	Q8SBF3	Shigella_phage	99.6	3.2e-151
WP_000933949.1|2952483_2952720_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	93.6	2.8e-36
WP_000061487.1|2952716_2953535_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_072147590.1|2953531_2954026_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	4.3e-87
WP_000066917.1|2954025_2954679_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_053918604.1|2954675_2955002_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_000767118.1|2954998_2955388_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	98.4	3.0e-67
WP_001061380.1|2955407_2956217_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_001564461.1|2956224_2957214_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.2e-194
WP_001047112.1|2957227_2957980_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_000217632.1|2958260_2958686_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
2958634:2958649	attR	GTTATTATGCTGCAAA	NA	NA	NA	NA
WP_000917724.1|2958909_2959113_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|2959263_2960316_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|2960383_2960599_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|2960598_2961096_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|2961092_2961560_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_077898315.1|2961547_2961700_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	6.2e-21
WP_001205130.1|2961841_2962018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|2962375_2962870_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934123.1|2962869_2964972_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|2964968_2965181_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001459763.1|2965180_2966656_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_001546838.1|2966633_2968661_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097039.1|2968747_2969071_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001283154.1|2969063_2969339_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_000677093.1|2969350_2969929_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	2.1e-101
WP_001079398.1|2969925_2970327_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|2970337_2971081_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|2971141_2971528_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|2971536_2971866_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447247.1|2974903_2975233_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|2975242_2975941_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_073519290.1|2975946_2976690_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000741589.1|2976587_2977235_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_073519291.1|2977294_2980693_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_069916437.1|2980759_2981359_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	1.0e-111
WP_000279086.1|2981423_2982737_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|2982738_2983008_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000950792.1|2983184_2984165_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_096150060.1|2984511_2984643_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 6
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	3037669	3074119	5349582	tail,portal,holin,terminase,head,plate,integrase,capsid	Enterobacteria_phage(80.95%)	49	3036604:3036663	3074226:3074349
3036604:3036663	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|3037669_3037810_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488108.1|3038000_3038261_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|3038303_3039413_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005425.1|3039570_3040755_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000290450.1|3040754_3041267_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|3041321_3041687_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333494.1|3041695_3041851_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000853425.1|3041837_3044645_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.1	0.0e+00
WP_000979954.1|3044657_3045146_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905059.1|3045172_3045772_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_001171270.1|3045876_3046713_+	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	94.6	4.9e-152
WP_001164115.1|3046716_3047244_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	2.5e-93
WP_000972183.1|3047272_3047806_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_047335224.1|3047808_3049794_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	94.1	2.2e-174
WP_000071708.1|3049796_3050327_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_001111930.1|3050319_3051216_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_001070742.1|3051219_3051549_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.4e-54
WP_077898325.1|3051566_3052133_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	5.2e-97
WP_000356339.1|3052144_3052780_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920586.1|3052772_3053240_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000780570.1|3053377_3053785_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_000072340.1|3053781_3054174_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.2e-70
WP_000104350.1|3054170_3054494_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|3054496_3054697_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|3054696_3055191_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632330.1|3055293_3056094_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	2.4e-124
WP_001055089.1|3056139_3057192_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_001262673.1|3057215_3058052_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613787.1|3058206_3059958_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087833.1|3059957_3061004_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	98.9	1.8e-204
WP_001140702.1|3061496_3063722_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502620.1|3063745_3064867_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001001608.1|3065047_3067831_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000564228.1|3067827_3068217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|3068213_3068831_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000108349.1|3068842_3069142_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	5.3e-40
WP_000153711.1|3069138_3069405_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000985144.1|3069401_3069605_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000991915.1|3069628_3070045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|3070137_3070251_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514274.1|3070247_3070490_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000159462.1|3070501_3070780_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000739029.1|3070790_3071141_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|3071162_3071366_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|3071437_3071575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|3071664_3072069_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290349.1|3072084_3072735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865386.1|3072764_3073112_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|3073117_3074119_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
3074226:3074349	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	3255511	3301220	5349582	tRNA,tail,portal,holin,terminase,head,plate,integrase,capsid	Enterobacteria_phage(84.09%)	57	3262847:3262867	3298794:3298814
WP_001144192.1|3255511_3257440_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|3257443_3257986_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3258082_3258280_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3258332_3258689_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3258811_3258856_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|3259139_3260123_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672369.1|3260137_3262525_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3262529_3262829_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
3262847:3262867	attL	GGCCGCTCTGCGGCCTTTTTT	NA	NA	NA	NA
WP_000078916.1|3263133_3263274_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001445133.1|3263464_3263725_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000027066.1|3264149_3265562_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_029488695.1|3265564_3267598_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_073519293.1|3267766_3268876_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.0e-193
WP_000005384.1|3269033_3270218_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_000290462.1|3270217_3270730_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651566.1|3270785_3271160_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	1.3e-35
WP_032153269.1|3271168_3271324_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.2e-21
WP_073519295.1|3271310_3274118_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.2	0.0e+00
WP_029488413.1|3274130_3274619_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	6.8e-85
WP_000972118.1|3274687_3275221_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	67.2	1.8e-62
WP_073519296.1|3275223_3277287_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	57.7	2.7e-183
WP_000071720.1|3277289_3277820_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_029488416.1|3277812_3278709_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	2.1e-156
WP_001067548.1|3278712_3279042_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077696943.1|3279059_3279626_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	3.6e-98
WP_032338905.1|3279637_3280273_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_000920594.1|3280265_3280733_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_029488419.1|3280870_3281278_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.6e-66
WP_000072327.1|3281274_3281667_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|3281663_3281987_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|3281989_3282190_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063074.1|3282189_3282684_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_029488420.1|3282786_3283587_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	4.9e-125
WP_001055118.1|3283632_3284685_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_001262673.1|3284707_3285544_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_029488421.1|3285698_3287450_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|3287449_3288496_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001561011.1|3289032_3289377_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_024169082.1|3289373_3289784_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001561007.1|3289950_3290286_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	95.4	2.6e-51
WP_000211256.1|3290349_3290661_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_029488422.1|3290665_3291625_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	5.4e-179
WP_149026242.1|3291701_3294524_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.1	0.0e+00
WP_024230413.1|3294530_3294896_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	4.3e-60
WP_024230414.1|3295037_3295283_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	5.5e-35
WP_000985159.1|3295279_3295483_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_040082359.1|3295569_3295683_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_000514277.1|3295679_3295922_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|3295933_3296212_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000917800.1|3296222_3296561_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	1.3e-47
WP_000163908.1|3296575_3296854_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|3296945_3297257_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247208.1|3297345_3298281_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000416304.1|3298291_3298687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|3298876_3299857_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
3298794:3298814	attR	GGCCGCTCTGCGGCCTTTTTT	NA	NA	NA	NA
WP_001154187.1|3299919_3300471_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029479.1|3300470_3301220_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
>prophage 8
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	3376792	3540004	5349582	tRNA,transposase,tail,portal,terminase,protease,head,integrase,capsid,lysis	Enterobacteria_phage(30.77%)	174	3419928:3419949	3434970:3434991
WP_001295400.1|3376792_3378067_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001307229.1|3378125_3378989_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_000765762.1|3379032_3379638_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|3379743_3381246_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|3381856_3382492_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|3382491_3383187_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920784.1|3383190_3383811_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|3383814_3384873_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915761.1|3384873_3387096_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|3387088_3387667_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|3387666_3388248_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|3388324_3388765_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|3388850_3389066_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|3389338_3389464_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|3389706_3390747_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|3390781_3391783_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459406.1|3391886_3393059_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|3393068_3394661_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|3394835_3395864_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|3395975_3396743_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|3396971_3397562_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_000945924.1|3397949_3399761_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075894.1|3399757_3401131_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227014.1|3401169_3402435_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043354.1|3402479_3403988_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|3404088_3405264_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|3405462_3407109_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|3407251_3408655_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001295399.1|3408651_3409581_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732526.1|3409656_3410958_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	5.5e-17
WP_001092519.1|3410961_3411681_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|3411809_3412145_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|3412141_3412864_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|3412900_3414283_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|3414468_3415413_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001342403.1|3415936_3417469_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|3417479_3418868_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
3419928:3419949	attL	GGTGTAGTCACTGGTGTAGTCA	NA	NA	NA	NA
WP_000085276.1|3419974_3421204_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|3421569_3421758_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_032145563.1|3421815_3422838_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|3422834_3423065_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336139.1|3423054_3423279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|3423271_3423637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|3423629_3423863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204964.1|3423855_3424089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|3424094_3424394_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|3424390_3426145_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|3426433_3426712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|3426708_3427119_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|3427131_3427404_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|3427691_3428849_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|3428888_3429461_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_000267605.1|3429462_3430674_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020662.1|3430670_3431009_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|3431005_3431302_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|3431301_3431742_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|3431725_3431908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|3432030_3432387_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001560954.1|3432370_3434032_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|3434045_3434327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276154.1|3435613_3435979_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
3434970:3434991	attR	GGTGTAGTCACTGGTGTAGTCA	NA	NA	NA	NA
WP_000046661.1|3435965_3436295_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260840.1|3436333_3437155_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|3437254_3437338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743940.1|3437430_3437766_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|3438162_3439416_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019517.1|3439522_3440416_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|3440550_3441771_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|3441895_3442591_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_073519299.1|3442543_3443836_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|3443994_3444609_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526490.1|3444651_3445506_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3445507_3446125_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342404.1|3446135_3448559_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041687.1|3448619_3451046_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001295396.1|3451244_3451550_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001443598.1|3451657_3452368_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3452370_3452931_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|3452965_3453307_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3453441_3453768_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|3455962_3456214_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048331.1|3456286_3458758_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|3458850_3459042_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3459038_3459227_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344954.1|3459713_3460289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3460290_3460446_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|3460638_3461046_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|3461123_3461351_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|3461334_3461856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054504.1|3461836_3462802_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_001151196.1|3462842_3463262_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.6e-55
WP_000589015.1|3463295_3464636_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|3465072_3465405_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_071527819.1|3465607_3465913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|3465937_3466177_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|3466176_3466464_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|3466535_3466691_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|3466907_3467159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|3467225_3467504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|3467505_3468555_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|3468568_3469321_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|3469588_3469678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|3469732_3469945_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|3470244_3470460_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|3471213_3471429_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|3471433_3471745_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|3471741_3472275_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|3472271_3472769_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|3473130_3473343_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|3473353_3473542_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|3473544_3473610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|3473689_3473845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|3474016_3474190_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035576.1|3474341_3474773_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001031433.1|3475073_3475280_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	1.5e-25
WP_000373425.1|3475842_3476337_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934123.1|3476336_3478439_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|3478435_3478648_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|3478647_3480156_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|3480100_3482128_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097045.1|3482214_3482538_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|3482530_3482806_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_073519300.1|3482817_3483408_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	2.7e-80
WP_001079398.1|3483404_3483806_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|3483817_3484561_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|3484621_3485008_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|3485016_3485346_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447247.1|3488383_3488713_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_001152385.1|3488722_3489421_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_073519290.1|3489426_3490170_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000741589.1|3490067_3490715_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_073519301.1|3490774_3494272_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_001233071.1|3494342_3494942_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_073519393.1|3495006_3498405_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_032332773.1|3498404_3498989_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	1.1e-102
WP_000355484.1|3499058_3499832_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_001519525.1|3500253_3500397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519526.1|3500386_3500536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560788.1|3500522_3501056_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000258782.1|3501059_3501410_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001519527.1|3501743_3502505_+	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	35.0	8.5e-10
WP_000162574.1|3503252_3503735_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|3503866_3504343_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3504332_3504623_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3504684_3505026_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3505174_3506836_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3506921_3507800_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|3507922_3508513_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287917.1|3508547_3509153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|3509275_3510562_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3510582_3511374_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3511540_3512902_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3513038_3513287_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3513305_3513854_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3513884_3514652_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3514693_3515041_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3515117_3515600_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|3515615_3516842_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|3516831_3517350_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|3517499_3517865_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|3518074_3519145_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3519155_3520277_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200118.1|3520319_3521480_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3521578_3521626_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178456.1|3521729_3522071_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3522341_3523079_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|3523213_3524194_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|3524190_3524922_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3525051_3527625_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3533480_3534779_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3534775_3535099_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3535144_3536500_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082969.1|3536613_3539274_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001298975.1|3539305_3540004_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	3786198	3864745	5349582	tRNA,transposase,tail,portal,holin,terminase,protease,head,plate,integrase,capsid	Shigella_phage(49.09%)	88	3783718:3783734	3834915:3834931
3783718:3783734	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000194515.1|3786198_3787632_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|3787847_3788762_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001163428.1|3790611_3790812_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206732.1|3790943_3791249_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_073519321.1|3791248_3791611_-	hypothetical protein	NA	U5P092	Shigella_phage	98.3	1.8e-66
WP_000008236.1|3791601_3792138_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081297.1|3792265_3793090_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|3793155_3793518_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|3794118_3794415_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000389078.1|3794618_3795509_+	BRCT domain-containing protein	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
WP_000853319.1|3795491_3796178_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000187185.1|3796313_3796562_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000515875.1|3796584_3797136_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	1.3e-100
WP_001250269.1|3797311_3797491_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_073519322.1|3797480_3798422_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	6.2e-151
WP_073519323.1|3798418_3798913_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
WP_073519324.1|3798912_3799566_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
WP_000210164.1|3799562_3799889_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767111.1|3799885_3800275_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061397.1|3800294_3801092_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_073519325.1|3802101_3802854_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.8e-137
WP_044069184.1|3803004_3803262_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	6.1e-37
WP_001283169.1|3803341_3803728_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_073519326.1|3803714_3803996_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	42.9	5.0e-16
WP_044069183.1|3803995_3804610_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.4	3.8e-93
WP_073519327.1|3804617_3804887_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	2.0e-22
WP_032201148.1|3805027_3805258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050437385.1|3805332_3805896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032201150.1|3805998_3806349_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.6e-50
WP_000929182.1|3806475_3806970_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	5.6e-87
WP_072011717.1|3807203_3808700_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|3808711_3808894_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_073519328.1|3808893_3810135_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	1.7e-241
WP_001193631.1|3810112_3810763_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_073519329.1|3810777_3811983_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	5.3e-224
WP_000601367.1|3812032_3812233_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	4.9e-26
WP_000927711.1|3812235_3812559_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_032177310.1|3812555_3812966_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	96.3	3.6e-71
WP_023154798.1|3812937_3813462_+	hypothetical protein	NA	U5P416	Shigella_phage	99.4	3.3e-93
WP_073519330.1|3813458_3814019_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	6.8e-105
WP_000497751.1|3814027_3814198_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_050921975.1|3814181_3815678_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.0	3.5e-273
WP_000090998.1|3815677_3816034_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|3816030_3816354_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_021557515.1|3816438_3818340_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
WP_000738065.1|3818404_3818893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519331.1|3818949_3820323_+	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	97.5	4.2e-241
WP_073519332.1|3820319_3821399_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.3e-205
WP_001259087.1|3821398_3821947_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	6.6e-97
WP_000424728.1|3821946_3822372_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_000785301.1|3822358_3823417_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000383556.1|3823407_3823992_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_072291070.1|3823995_3825078_+|tail	phage tail protein	tail	U5P0I1	Shigella_phage	61.1	1.0e-48
WP_073519333.1|3825077_3825665_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	51.8	1.6e-56
WP_047668518.1|3825893_3826985_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.4	2.2e-14
WP_000355479.1|3827457_3828231_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_073519334.1|3829056_3829800_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021526115.1|3830503_3831661_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
WP_000368131.1|3831972_3832905_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|3833198_3833954_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937837.1|3834135_3835194_-	hypothetical protein	NA	NA	NA	NA	NA
3834915:3834931	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001296861.1|3835561_3836902_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|3837273_3837558_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531948.1|3837737_3839048_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000425058.1|3839047_3841192_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|3841394_3841880_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|3842563_3843127_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112828.1|3843208_3845851_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281615.1|3845870_3846623_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|3846597_3847146_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|3847142_3847613_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|3847609_3848134_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001356216.1|3848120_3848993_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|3849114_3849666_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001298774.1|3849831_3850764_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|3850798_3851884_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043812.1|3851887_3852712_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|3852711_3853521_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001089235.1|3853520_3854069_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|3854102_3854381_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000399648.1|3854628_3855609_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_073519336.1|3855779_3857786_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|3857944_3859165_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127749.1|3859448_3860627_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|3860623_3861619_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699121.1|3861717_3862854_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_001289165.1|3862919_3863933_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283581.1|3863932_3864745_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	4064345	4073787	5349582		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|4064345_4065272_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4065276_4066008_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4065988_4066096_-	protein YohO	NA	NA	NA	NA	NA
WP_001240410.1|4066155_4066887_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	4.8e-111
WP_001295431.1|4067108_4068794_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4068790_4069510_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4069556_4070027_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4070067_4070529_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001298843.1|4070653_4072654_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|4072650_4073787_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 11
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	4086298	4150242	5349582	tRNA,tail,portal,holin,terminase,head,integrase,plate,capsid,lysis	Escherichia_phage(46.67%)	72	4113549:4113576	4145158:4145185
WP_001295427.1|4086298_4088332_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005457.1|4088463_4089573_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|4089835_4090117_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|4090410_4090953_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|4091033_4091708_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945416.1|4091723_4094204_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|4094217_4095252_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|4095333_4095672_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|4095890_4096715_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|4096835_4097108_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195605.1|4097330_4098119_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|4098115_4098916_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001298848.1|4098980_4099799_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	4.5e-25
WP_000434035.1|4099850_4100597_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011951.1|4100570_4101536_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|4101532_4102537_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858482.1|4102533_4103811_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|4104067_4105120_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289787.1|4105429_4106272_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|4106312_4107575_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|4107584_4108037_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|4108067_4108352_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490714.1|4108355_4109711_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|4109758_4110799_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|4110898_4111678_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|4111759_4112659_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|4113073_4113391_+	hypothetical protein	NA	NA	NA	NA	NA
4113549:4113576	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001543021.1|4113655_4114669_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	5.4e-193
WP_001306384.1|4114784_4115084_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|4115198_4115474_+	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|4115484_4115655_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|4115651_4116152_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4116215_4116440_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|4116439_4116742_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_001113270.1|4116741_4116966_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|4116962_4117238_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_063118428.1|4117227_4119504_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_000038148.1|4122004_4123039_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_024234797.1|4123038_4124811_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|4124984_4125839_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_053893575.1|4125897_4126971_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	3.7e-200
WP_023281156.1|4126974_4127718_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	6.6e-124
WP_000988639.1|4127817_4128327_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_024244865.1|4128326_4128530_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000123123.1|4128533_4128815_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4128814_4129312_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_024244866.1|4129326_4129752_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.0	5.2e-57
WP_053893576.1|4129739_4130183_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_000917139.1|4130272_4130740_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_001001787.1|4130732_4131185_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_024244868.1|4131256_4132042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093749.1|4132125_4132761_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.1e-111
WP_000127163.1|4132757_4133105_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4133109_4134018_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285314.1|4134010_4134541_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_053893577.1|4134551_4136783_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	54.7	2.7e-157
WP_024244870.1|4136784_4137312_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	2.5e-85
WP_024199507.1|4137581_4138127_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	97.2	2.3e-94
WP_001286726.1|4138456_4139647_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001251408.1|4139659_4140178_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|4140234_4140510_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4140542_4140662_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073519340.1|4140654_4143102_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000978908.1|4143116_4143596_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000882975.1|4143595_4144759_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000468308.1|4144840_4145059_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|4145329_4146691_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4145158:4145185	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|4146793_4147090_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|4147091_4147388_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001298852.1|4147596_4147929_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|4148119_4148842_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|4148838_4150242_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 12
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	4282060	4333568	5349582	tail,portal,holin,terminase,head,integrase,capsid	Enterobacteria_phage(37.78%)	59	4281508:4281523	4312618:4312633
4281508:4281523	attL	ATCGTCTTCCCATTCA	NA	NA	NA	NA
WP_000533621.1|4282060_4283086_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096345.1|4283085_4283289_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073519348.1|4283347_4285819_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_000854559.1|4286099_4286288_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001340038.1|4286688_4286853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171943.1|4286856_4287075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379593.1|4287234_4287390_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000448563.1|4287556_4287964_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|4288047_4288278_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705353.1|4288261_4288783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|4288763_4289729_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001151251.1|4289769_4290192_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	1.4e-62
WP_000566848.1|4290444_4291344_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001373963.1|4291658_4292312_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000892866.1|4292324_4293020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967409.1|4293705_4293918_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
WP_000975572.1|4294135_4294399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360223.1|4294465_4294744_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_001265301.1|4294745_4295795_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.6e-107
WP_001217464.1|4295807_4296167_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001064889.1|4296163_4296853_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_073519349.1|4298393_4300244_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_053897820.1|4300525_4300741_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|4300996_4301269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|4301428_4301962_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|4302182_4302296_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|4302517_4302703_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|4303230_4303545_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|4303626_4303851_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|4304253_4304763_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300274.1|4304734_4306663_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000259002.1|4306646_4306853_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831809.1|4306849_4308442_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_073519350.1|4308431_4309937_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000256818.1|4309973_4310321_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522630.1|4310378_4311407_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000201528.1|4311458_4311833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|4311825_4312179_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|4312193_4312769_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
4312618:4312633	attR	ATCGTCTTCCCATTCA	NA	NA	NA	NA
WP_000683071.1|4312765_4313161_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|4313168_4313921_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479084.1|4313934_4314366_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.7e-42
WP_000533425.1|4314392_4314806_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000847393.1|4316548_4316878_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.7e-53
WP_001152529.1|4316877_4317576_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.9e-129
WP_001300229.1|4317580_4318324_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	5.7e-144
WP_000090913.1|4318260_4318863_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_000515383.1|4318923_4322319_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_001230450.1|4322386_4322986_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_000279086.1|4323050_4324364_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|4324365_4324635_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000950792.1|4324811_4325792_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.7e-87
WP_096150060.1|4326138_4326270_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950984.1|4326433_4327315_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	1.0e-147
WP_000652080.1|4327538_4328387_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_001131650.1|4328913_4329489_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	75.9	1.5e-75
WP_001102750.1|4329826_4331065_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_000767413.1|4331743_4332220_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001399730.1|4332278_4333568_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
>prophage 13
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	4578336	4635366	5349582	transposase,tail,portal,holin,terminase,protease,head,integrase,capsid,lysis	Enterobacteria_phage(38.24%)	77	4568214:4568231	4643575:4643592
4568214:4568231	attL	TTAGCGTCGCATCAGGCA	NA	NA	NA	NA
WP_000066490.1|4578336_4578549_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4578559_4578748_+	cold-shock protein	NA	NA	NA	NA	NA
WP_012816753.1|4578722_4578953_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4578942_4579116_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829674.1|4579164_4580238_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399835.1|4580309_4583054_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_000533665.1|4583148_4584222_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001303849.1|4584199_4584418_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281197.1|4584535_4584880_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001277762.1|4584982_4585162_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
WP_000208001.1|4585258_4586047_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.6	3.3e-49
WP_000582233.1|4586057_4586813_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	3.2e-142
WP_001289864.1|4586814_4587222_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763378.1|4587218_4587440_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_000188870.1|4587538_4587754_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548537.1|4587830_4588022_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|4587994_4588177_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186784.1|4588173_4588854_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000100844.1|4588850_4589636_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_073519243.1|4589660_4589939_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.7e-45
WP_001371715.1|4589992_4590157_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	7.1e-23
WP_001198860.1|4590125_4590290_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|4590362_4590731_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_071533307.1|4590934_4591114_-	antirestriction Ral family protein	NA	M1FQU1	Enterobacteria_phage	98.3	4.3e-29
WP_001434513.1|4591192_4591528_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	64.9	5.0e-31
WP_000528775.1|4591971_4592748_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001074605.1|4592735_4593278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250469.1|4593375_4594083_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_001180318.1|4594161_4594389_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000195204.1|4594495_4594792_+	Regulatory protein CII from phage origin	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	1.5e-47
WP_000185469.1|4594824_4595724_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	2.3e-171
WP_000145931.1|4596419_4596710_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000229806.1|4598076_4598283_+	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000344548.1|4598300_4598621_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.7	1.4e-35
WP_170996547.1|4598969_4600183_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	6.5e-169
WP_024182502.1|4600541_4600724_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	95.0	1.8e-27
WP_000612803.1|4601227_4603000_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|4603569_4604136_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223930.1|4604110_4604713_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001028835.1|4604709_4605375_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	2.9e-131
WP_001235472.1|4605371_4605995_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_000499454.1|4607075_4607234_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_033816266.1|4607314_4607713_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|4607855_4608071_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135302.1|4608070_4608568_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092324.1|4608564_4609002_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.4e-70
WP_000881326.1|4609151_4609769_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001443307.1|4609956_4610151_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_001429103.1|4610578_4611085_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_001300274.1|4611056_4612985_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_000259002.1|4612968_4613175_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831809.1|4613171_4614764_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_001253918.1|4614753_4616259_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000256723.1|4616295_4616643_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522623.1|4616700_4617729_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|4617780_4618164_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204560.1|4618156_4618510_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000975031.1|4618524_4619058_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_000683065.1|4619054_4619450_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|4619457_4620210_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|4620223_4620655_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|4620681_4621095_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_073519352.1|4621075_4623655_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_001152631.1|4623978_4624674_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	4.7e-132
WP_001302649.1|4624693_4625014_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|4625120_4625294_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001434463.1|4625364_4626288_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	97.7	3.9e-174
WP_000967259.1|4626342_4627080_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.3	7.2e-139
WP_028127181.1|4626977_4627619_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_153274582.1|4627691_4628030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519353.1|4628096_4631576_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_001230450.1|4631643_4632243_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_000279086.1|4632307_4633621_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|4633622_4633892_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767050.1|4634112_4634655_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|4634599_4634794_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|4634784_4635366_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
4643575:4643592	attR	TTAGCGTCGCATCAGGCA	NA	NA	NA	NA
>prophage 14
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	4764311	4826810	5349582	tRNA,transposase,tail,holin,terminase,head,integrase,capsid	Escherichia_phage(27.78%)	75	4759405:4759419	4765886:4765900
4759405:4759419	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|4764311_4765430_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|4765398_4765668_-	excisionase	NA	NA	NA	NA	NA
WP_073519354.1|4765729_4768201_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
4765886:4765900	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|4768293_4768485_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4768481_4768670_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4769070_4769235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171974.1|4769238_4769457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4769616_4769772_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_014966210.1|4770041_4770332_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000100896.1|4770331_4770523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823909.1|4770540_4771041_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_001048458.1|4771148_4771424_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000693918.1|4771407_4771833_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262344.1|4771904_4772921_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	76.1	1.2e-88
WP_072130322.1|4772832_4773375_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450649.1|4773408_4774179_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	1.6e-80
WP_001151239.1|4774194_4774617_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	1.1e-64
WP_077631714.1|4774659_4775676_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_000935423.1|4775921_4776134_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|4776166_4776385_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|4776386_4776650_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|4776660_4777530_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|4777645_4777750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|4777939_4778152_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|4778319_4778598_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265092.1|4778599_4779655_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140011.1|4779655_4780021_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_000640023.1|4780029_4780572_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000917767.1|4780884_4781082_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611213.1|4781232_4782282_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000466957.1|4782753_4783185_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_073519355.1|4783755_4785606_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_053897820.1|4786044_4786260_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|4786515_4786788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|4786947_4787481_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|4788127_4788334_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|4788398_4788623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|4788979_4789120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|4789249_4789435_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000279816.1|4789476_4789842_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_000958380.1|4790132_4790696_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|4790692_4792354_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_069722407.1|4792417_4794355_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063094.1|4794399_4794621_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125984.1|4796661_4796988_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|4796998_4797349_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|4797345_4797792_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4797788_4798133_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|4798199_4798916_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030060.1|4798921_4799296_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|4799391_4799601_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|4799648_4802891_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|4802883_4803225_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|4803224_4803923_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|4803933_4804677_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|4804622_4805255_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_073519356.1|4805500_4808977_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.3	0.0e+00
WP_001360257.1|4809045_4809669_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_073519394.1|4809733_4811056_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	96.8	4.4e-70
WP_001023435.1|4811057_4811327_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|4811440_4812016_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|4812306_4812888_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|4812955_4813591_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|4813718_4814777_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|4814851_4815502_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|4815684_4816275_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|4816548_4817412_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4817395_4818532_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359439.1|4818781_4820011_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4820156_4821278_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735406.1|4821353_4822814_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4822813_4823485_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4823652_4825023_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|4825026_4825668_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4825703_4826810_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	5031993	5086162	5349582	tRNA,transposase,tail,holin,terminase,plate,integrase	Escherichia_phage(79.37%)	71	5031627:5031642	5066338:5066353
5031627:5031642	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|5031993_5033226_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|5033480_5034464_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|5034941_5036315_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157394.1|5036443_5037379_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	6.5e-145
WP_000040844.1|5037430_5038666_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	6.0e-239
WP_000079604.1|5038667_5038883_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073519364.1|5038982_5039171_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_021500490.1|5039163_5039358_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_063100796.1|5039421_5040510_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	99.4	1.1e-204
WP_073519365.1|5040524_5043686_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	68.4	0.0e+00
WP_073519366.1|5043786_5044062_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	2.8e-40
WP_000245533.1|5044136_5044313_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_073519367.1|5044306_5044528_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	5.3e-37
WP_001559054.1|5044923_5045157_+	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	96.1	2.9e-33
WP_073519369.1|5045118_5045424_-	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	95.0	1.4e-43
WP_000753628.1|5045673_5046135_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_061892277.1|5046242_5046518_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	8.9e-42
WP_057514222.1|5046501_5046924_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	3.4e-69
WP_000417086.1|5046936_5047233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000010975.1|5047233_5047485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026245.1|5047774_5048689_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	92.7	1.3e-102
WP_187658851.1|5048681_5049143_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	9.2e-84
WP_073519371.1|5049177_5049963_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.8	2.5e-49
WP_054626788.1|5050269_5050566_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.8	2.4e-45
WP_073519372.1|5050758_5051073_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	86.7	5.9e-50
WP_061351715.1|5051069_5051399_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	35.8	8.4e-23
WP_077898318.1|5051400_5051757_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	91.5	1.3e-53
WP_163428211.1|5051847_5052021_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	70.2	3.7e-14
WP_061351723.1|5052151_5052385_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	83.1	2.8e-28
WP_073519374.1|5052782_5052995_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	92.9	1.5e-25
WP_000687430.1|5053217_5053391_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	1.6e-17
WP_000940332.1|5053450_5054050_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	2.4e-108
WP_073519375.1|5054049_5054340_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	5.1e-48
WP_000640136.1|5054336_5054879_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000898679.1|5055829_5056027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351476.1|5056025_5056418_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_000950570.1|5056407_5056683_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
WP_000014553.1|5056685_5057063_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	2.3e-64
WP_149026241.1|5057077_5057260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071702711.1|5057384_5057597_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_032218059.1|5057572_5057752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519376.1|5057869_5058658_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	42.7	1.0e-50
WP_069901011.1|5058650_5059583_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	55.1	1.1e-83
WP_001307172.1|5059518_5059770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519377.1|5059773_5060865_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_000021158.1|5060854_5062183_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.4	9.3e-262
WP_001559065.1|5062201_5063638_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.2	2.7e-267
WP_001018390.1|5063582_5064416_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	98.5	2.4e-154
WP_162830753.1|5065472_5066686_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
5066338:5066353	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_057107048.1|5067024_5067642_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.5	2.9e-117
WP_001272370.1|5067656_5068685_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	100.0	5.1e-191
WP_000780861.1|5068741_5069212_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|5069211_5069652_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762301.1|5069648_5070089_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	97.9	7.0e-81
WP_001139505.1|5070075_5071020_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_000506595.1|5071019_5072357_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	2.6e-243
WP_000938146.1|5072380_5072812_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	5.6e-75
WP_000684992.1|5072808_5073426_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	3.6e-83
WP_000918396.1|5073490_5075566_+	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.7	2.8e-127
WP_000056327.1|5075569_5076238_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209262.1|5076234_5076501_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_001271167.1|5076500_5077508_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.7	4.0e-180
WP_000063620.1|5077507_5078221_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001261327.1|5078503_5078851_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426902.1|5079000_5080161_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
WP_072277864.1|5080201_5081428_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.5	4.9e-225
WP_001199731.1|5081411_5082038_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_077898319.1|5082034_5083588_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	78.6	3.7e-225
WP_077898320.1|5083590_5084136_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.6	3.5e-74
WP_073519379.1|5084159_5085593_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	56.1	2.7e-81
WP_077898321.1|5085592_5086162_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	69.9	2.2e-71
>prophage 16
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	5288491	5303796	5349582	tail	Enterobacteria_phage(66.67%)	12	NA	NA
WP_000527799.1|5288491_5289952_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
WP_120795384.1|5291927_5292041_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|5292109_5292343_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|5292659_5293250_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885621.1|5293347_5293923_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.0e-100
WP_073519385.1|5293922_5297276_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_069916437.1|5297340_5297940_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	1.0e-111
WP_073519291.1|5298006_5301405_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000741589.1|5301464_5302112_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_001317470.1|5302009_5302753_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_000884310.1|5302758_5303457_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	6.2e-132
WP_000447253.1|5303466_5303796_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
>prophage 17
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	5306833	5333316	5349582	transposase,tail,portal,terminase,protease,lysis	Enterobacteria_phage(44.83%)	45	NA	NA
WP_001161009.1|5306833_5307163_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|5307171_5307558_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|5307618_5308362_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|5308372_5308774_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677093.1|5308770_5309349_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	2.1e-101
WP_001283154.1|5309360_5309636_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_001097039.1|5309628_5309952_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|5310038_5312066_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|5312010_5313519_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|5313518_5313731_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934123.1|5313727_5315830_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000373425.1|5315829_5316324_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031433.1|5316886_5317093_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	1.5e-25
WP_000035576.1|5317393_5317825_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001019139.1|5317976_5318150_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|5318321_5318477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|5318556_5318622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|5318624_5318813_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|5318823_5319036_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|5319397_5319895_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|5319891_5320425_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|5320421_5320733_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|5320737_5320953_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|5321706_5321922_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|5322221_5322434_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|5322488_5322578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|5322845_5323598_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|5323611_5324661_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|5324662_5324941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|5325007_5325259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|5325475_5325631_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|5325702_5325990_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|5325989_5326229_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071527819.1|5326253_5326559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|5326761_5327094_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589015.1|5327530_5328871_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151196.1|5328904_5329324_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.6e-55
WP_000054504.1|5329364_5330330_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|5330310_5330832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|5330815_5331043_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|5331120_5331528_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|5331720_5331876_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344954.1|5331877_5332453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|5332939_5333128_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|5333124_5333316_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
>prophage 18
NZ_CP010119	Escherichia coli strain C3 chromosome, complete genome	5349582	5342104	5348166	5349582		Cronobacter_phage(33.33%)	7	NA	NA
WP_000967409.1|5342104_5342317_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
WP_000975572.1|5342534_5342798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360223.1|5342864_5343143_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_001265301.1|5343144_5344194_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.6e-107
WP_001217464.1|5344206_5344566_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001064889.1|5344562_5345252_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_073519386.1|5346792_5348166_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	94.1	6.7e-255
