The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	471618	481060	4809836		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|471618_472545_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|472549_473281_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|473261_473369_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|473428_474160_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|474381_476067_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|476063_476783_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|476829_477300_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|477340_477802_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_032254607.1|477926_479927_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292769.1|479923_481060_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 2
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	493571	586969	4809836	portal,terminase,protease,holin,capsid,tRNA,head,tail,plate,lysis,integrase	Escherichia_phage(29.17%)	99	520820:520847	552888:552915
WP_001295427.1|493571_495605_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|495736_496846_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001307891.1|497108_497390_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|497682_498225_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|498304_498979_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_073508393.1|498994_501475_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|501488_502523_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|502604_502943_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|503161_503986_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|504106_504379_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_073508394.1|504601_505390_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822275.1|505386_506187_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001307284.1|506251_507070_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|507121_507868_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011976.1|507841_508807_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|508803_509808_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000858484.1|509804_511082_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|511338_512391_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|512700_513555_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_032217215.1|513583_514846_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|514855_515308_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|515338_515623_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|515626_516982_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|517029_518070_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|518169_518949_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|519030_519930_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|520344_520662_+	hypothetical protein	NA	NA	NA	NA	NA
520820:520847	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|520926_521940_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|522055_522355_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|522469_522745_+	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|522755_522926_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|522922_523423_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_021525846.1|523486_523711_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_001277958.1|523710_524013_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_001113258.1|524012_524237_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	97.3	2.5e-34
WP_000027664.1|524233_524509_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_073508395.1|524498_526766_+	replication endonuclease	NA	Q858T4	Yersinia_virus	92.9	0.0e+00
WP_001755156.1|527170_530101_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038182.1|530501_531536_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_073508396.1|531535_533308_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_001085948.1|533481_534336_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_073508397.1|534394_535468_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	6.7e-202
WP_000203439.1|535471_536215_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|536314_536824_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|536823_537027_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_073508398.1|537030_537324_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	98.9	2.1e-41
WP_073508399.1|537310_537808_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	1.3e-91
WP_059336788.1|537822_538248_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.2	1.1e-59
WP_053887350.1|538235_538661_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.7	2.3e-65
WP_073508400.1|538768_539236_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	4.8e-80
WP_001001780.1|539228_539681_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_053266706.1|539747_540383_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	7.6e-113
WP_000127163.1|540379_540727_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121497.1|540731_541640_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_001285325.1|541632_542163_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_073508401.1|542173_544219_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	99.1	0.0e+00
WP_040083689.1|544222_544750_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	96.6	1.8e-91
WP_000014362.1|544965_545865_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_073508402.1|546184_547375_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.5	1.8e-224
WP_001251408.1|547387_547906_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|547962_548238_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|548270_548390_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021568196.1|548382_550830_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	99.9	0.0e+00
WP_073508403.1|550844_551324_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.1	7.3e-84
WP_000882969.1|551323_552487_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|552568_552787_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|553059_554421_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
552888:552915	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|554523_554820_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|554821_555118_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|555326_555659_-	YegP family protein	NA	NA	NA	NA	NA
WP_032254534.1|555849_556572_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.7e-31
WP_000675148.1|556568_557972_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000130849.1|557968_559384_-	MFS transporter	NA	NA	NA	NA	NA
WP_000667537.1|559384_562462_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197880.1|562462_565585_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_032254535.1|565584_566832_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001386901.1|567110_567167_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001386899.1|567438_567495_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723109.1|567767_567827_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_000003178.1|568047_568707_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119074.1|568703_569465_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001298837.1|569461_571402_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_073508404.1|572141_573707_+	recombinase family protein	NA	NA	NA	NA	NA
WP_047654892.1|573784_573976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157919889.1|574140_574281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508405.1|574365_574839_+	hypothetical protein	NA	A0A2H4PHE8	Dickeya_phage	34.3	1.4e-15
WP_073508406.1|574850_575402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508407.1|577268_577583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508408.1|577736_578021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508409.1|578454_580275_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_073508511.1|580849_581263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077776148.1|581305_581707_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_112029013.1|581648_581789_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_077898445.1|581760_582225_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	32.4	3.2e-07
WP_077898446.1|582369_582930_+|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_135566170.1|582901_583111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021534377.1|583120_583666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508410.1|585153_586479_+|head,protease	HK97 family phage prohead protease	head,protease	R9TPU0	Vibrio_phage	25.5	3.7e-16
WP_073508411.1|586495_586969_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
>prophage 3
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	1295243	1356206	4809836	terminase,holin,tRNA,tail,lysis,integrase	Escherichia_phage(41.67%)	64	1318339:1318355	1361807:1361823
WP_000837924.1|1295243_1296377_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|1296517_1296952_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|1297728_1297842_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1297910_1298144_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_073508438.1|1298460_1299051_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.9e-25
WP_000885611.1|1299148_1299724_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073508439.1|1299723_1302798_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_023909745.1|1302862_1303462_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_073508440.1|1303528_1306927_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_000741591.1|1306987_1307635_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_073508441.1|1307532_1308276_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.3e-148
WP_001152434.1|1308281_1308980_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|1308979_1309318_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073508442.1|1309310_1312544_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	2.9e-107
WP_012565075.1|1313017_1313377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488565.1|1313527_1314490_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	2.6e-56
WP_000144678.1|1314516_1314909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|1314905_1315286_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|1315286_1315670_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|1315669_1316065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908084.1|1316068_1316245_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000918487.1|1316287_1317427_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_073508443.1|1317525_1318290_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	8.7e-87
1318339:1318355	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_073508444.1|1318394_1319507_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	2.4e-114
WP_000763702.1|1319490_1320897_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_032085165.1|1322181_1323276_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_172903414.1|1323279_1323531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|1323466_1324399_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_073508446.1|1324391_1325180_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.4e-49
WP_001703139.1|1325317_1326775_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|1326971_1327157_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135310.1|1327373_1327871_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|1327870_1328086_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|1328337_1328712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|1328883_1329312_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|1330356_1330899_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|1330895_1331186_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|1331185_1331785_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|1332598_1332937_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001117226.1|1333660_1334860_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957772.1|1334871_1335564_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|1335560_1336442_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|1336572_1337850_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|1337913_1339911_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|1340251_1340674_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|1340714_1341785_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|1341856_1342282_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|1342265_1342547_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|1342647_1343067_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001312793.1|1343618_1344107_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|1344548_1344770_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|1344769_1344940_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|1345014_1345290_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105142.1|1345391_1347983_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.0	1.3e-243
WP_000166319.1|1347975_1348785_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|1348841_1349036_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|1349028_1349238_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|1349316_1349532_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073508447.1|1349533_1350769_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.0	3.0e-238
WP_001157407.1|1350820_1351756_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123738.1|1351884_1353258_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|1353287_1353461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387395.1|1353735_1354719_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1354973_1356206_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1361807:1361823	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 4
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	1804507	1891888	4809836	portal,terminase,protease,capsid,tRNA,head,tail,plate,lysis,integrase	Salmonella_phage(55.17%)	91	1797468:1797483	1894459:1894474
1797468:1797483	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|1804507_1805800_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|1805890_1807234_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1807244_1807856_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077054.1|1808010_1812078_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1812212_1812707_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|1813251_1814217_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043603.1|1814339_1816106_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.6e-22
WP_001202188.1|1816106_1817828_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|1817869_1818574_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1818858_1819077_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1819761_1822038_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1822068_1822389_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1822711_1822936_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|1823008_1824955_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|1824951_1826067_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|1826217_1827174_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|1827170_1828829_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1829254_1829950_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1830444_1831344_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_032254650.1|1831487_1833140_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1833151_1834120_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|1834252_1835971_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|1836007_1837009_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1837019_1838450_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1838548_1839562_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|1839558_1840389_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1840385_1840709_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|1840834_1841350_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027195.1|1841567_1842296_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-28
WP_000756569.1|1842313_1843045_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1843051_1843768_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1843767_1844436_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1844727_1845459_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149732.1|1845633_1846761_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|1846801_1847290_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1847349_1848195_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|1848191_1849145_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996024.1|1849154_1850288_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126097.1|1850382_1851495_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1851845_1852322_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1852409_1853312_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189152.1|1853372_1854095_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|1854078_1854366_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|1854525_1854783_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|1854812_1855190_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|1855459_1857145_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972390.1|1857380_1857599_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.4	6.8e-21
WP_001011799.1|1857689_1858790_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	2.2e-176
WP_073508456.1|1858786_1859272_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_073508457.1|1859268_1862346_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.0	0.0e+00
WP_000763311.1|1862338_1862458_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1862472_1862775_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|1862829_1863345_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_016245849.1|1863354_1864527_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905010.1|1864669_1865236_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_073508458.1|1865266_1865758_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_032262100.1|1865760_1866204_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	49.7	4.8e-37
WP_077898455.1|1866175_1866778_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	88.5	8.0e-96
WP_073508460.1|1866777_1868298_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.9	8.3e-198
WP_063119797.1|1868294_1868900_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.6e-110
WP_053887518.1|1868892_1869801_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.4	1.8e-144
WP_063119796.1|1869787_1870147_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	4.7e-51
WP_063119795.1|1870143_1870722_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.3e-92
WP_073508461.1|1870829_1871645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063119794.1|1871689_1872136_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.1	1.6e-61
WP_001039945.1|1872128_1872560_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_021548673.1|1872655_1873084_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_063119793.1|1873080_1873458_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	3.0e-16
WP_063119792.1|1873459_1873972_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	1.2e-87
WP_000171568.1|1873952_1874168_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1874171_1874375_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_028985766.1|1874374_1874839_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	9.3e-76
WP_000059191.1|1874934_1875585_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742507.1|1875588_1876647_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_000216257.1|1876663_1877497_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_001098431.1|1877639_1879406_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000658058.1|1879405_1880428_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.8	3.5e-168
WP_021556031.1|1880476_1881481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1881821_1882055_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1882065_1882254_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000752613.1|1885683_1885911_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|1885910_1886144_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000963473.1|1886211_1886553_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|1886516_1886717_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|1886724_1887234_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001741427.1|1887298_1887502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024167989.1|1887647_1888214_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.8	6.7e-36
WP_073508463.1|1888242_1889307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181678351.1|1889508_1890414_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	39.7	1.7e-52
WP_024167988.1|1890385_1890757_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.8	4.3e-31
WP_001741445.1|1890835_1891888_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	8.0e-107
1894459:1894474	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 5
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	1922415	2023042	4809836	portal,terminase,transposase,capsid,head,tail,lysis,integrase	Enterobacteria_phage(46.38%)	114	1948698:1948732	2024476:2024510
WP_000399648.1|1922415_1923396_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|1923674_1925267_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|1925485_1926406_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032296745.1|1926464_1927583_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|1927579_1928047_-	manganese-binding transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|1928232_1928361_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054679.1|1928632_1930216_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|1930264_1930780_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1930832_1930898_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|1931132_1932020_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1932318_1932822_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1933225_1933972_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159071.1|1934110_1934770_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1934766_1935489_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267255.1|1935605_1937831_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|1937827_1938754_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|1939029_1939290_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430073.1|1939553_1941836_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_073508464.1|1941877_1942555_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	31.5	1.2e-18
WP_000146343.1|1942628_1942895_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1943159_1943420_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443508.1|1943648_1944734_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|1944874_1945837_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001398823.1|1945864_1948015_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_001145128.1|1948134_1948617_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
1948698:1948732	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000399648.1|1948876_1949857_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000007102.1|1950127_1951492_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|1951720_1952392_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|1952394_1953390_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|1953382_1955119_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|1955111_1956245_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|1956255_1957362_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|1957323_1957734_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|1957866_1958628_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|1958624_1959866_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045450.1|1959865_1960822_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088650.1|1960857_1961571_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|1961640_1962288_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|1962489_1963194_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|1963330_1963783_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|1963784_1964030_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|1964022_1964508_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|1964510_1965023_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|1965044_1966034_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|1966430_1967339_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|1967530_1969552_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|1970130_1970808_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|1970800_1971556_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|1971542_1972697_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|1972693_1973734_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|1973820_1975110_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|1975168_1975645_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001468417.1|1976390_1977722_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
WP_001171282.1|1978226_1979189_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001541481.1|1979192_1979720_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.7	1.2e-92
WP_000972143.1|1979748_1980282_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_073508465.1|1980284_1983122_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q1MVL8	Enterobacteria_phage	60.6	1.0e-204
WP_001233093.1|1983186_1983786_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_032226672.1|1983856_1987354_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_000090873.1|1987414_1988047_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	6.5e-96
WP_001152639.1|1988733_1989432_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|1989431_1989761_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840305.1|1989757_1992319_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000459457.1|1992311_1992746_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001736197.1|1992727_1993150_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	87.9	7.0e-62
WP_001543784.1|1993165_1993906_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000683128.1|1993913_1994309_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_073508466.1|1994305_1994884_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000785282.1|1994895_1995249_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1995260_1995656_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|1995697_1996723_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_032198469.1|1996778_1997111_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_032198468.1|1997120_1998440_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	2.1e-234
WP_001345555.1|1998420_2000022_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|2000018_2000225_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027267.1|2000221_2002147_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|2002121_2002667_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000105084.1|2003055_2003289_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|2003345_2003756_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|2004105_2004627_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000092234.1|2004832_2005270_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	3.0e-68
WP_001135297.1|2005266_2005764_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	3.2e-90
WP_000839596.1|2005763_2005979_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|2006567_2007650_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204791.1|2007838_2008222_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2008307_2008448_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|2008444_2008807_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|2008803_2009094_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224912.1|2009086_2009257_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_001053034.1|2009256_2009712_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_072147432.1|2009708_2009810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001391403.1|2009906_2010158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338663.1|2010734_2010974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709099.1|2011085_2012612_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_044168796.1|2012708_2012819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|2012867_2013200_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145901.1|2013267_2013570_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788812.1|2013566_2014268_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_077699007.1|2014264_2015284_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.3e-110
WP_001182903.1|2015280_2015820_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|2015889_2016120_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2016224_2016914_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|2017511_2017718_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|2017793_2018090_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2018095_2018881_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|2018877_2019558_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682318.1|2019554_2019737_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548541.1|2019709_2019901_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	4.7e-26
WP_000188870.1|2019977_2020193_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763367.1|2020291_2020513_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000120064.1|2020723_2021326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|2021568_2021736_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|2021775_2021994_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|2021971_2023042_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
2024476:2024510	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 6
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	2526703	2577811	4809836	integrase,capsid,transposase,plate	Enterobacteria_phage(27.27%)	48	2526541:2526560	2540264:2540283
2526541:2526560	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001269632.1|2526703_2527981_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000179458.1|2528062_2528776_-	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.8	1.0e-49
WP_047658937.1|2528807_2530640_-	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.6	3.4e-28
WP_000452041.1|2530654_2530858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032220865.1|2530946_2531975_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_024233087.1|2531993_2532356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024233086.1|2532352_2532565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032220863.1|2532890_2533229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129161.1|2533230_2533641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113706407.1|2534062_2534626_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000005469.1|2534785_2534956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2535133_2536296_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000065231.1|2538398_2538938_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.8	1.1e-27
WP_165352201.1|2539279_2539438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788776.1|2539504_2539657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893255.1|2540454_2541708_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
2540264:2540283	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_001285288.1|2541719_2542823_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|2543110_2544166_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|2544204_2544606_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|2544663_2545908_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|2545999_2546458_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|2546718_2548176_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_000602103.1|2548232_2548847_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_000528863.1|2548843_2549983_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.1e-32
WP_001059855.1|2550228_2550681_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|2550677_2551733_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207568.1|2551803_2552589_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001438980.1|2552533_2554273_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|2554377_2554656_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|2554648_2555005_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000729704.1|2556019_2556280_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|2556282_2556561_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2556716_2557457_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2557427_2558195_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2558400_2558979_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973081.1|2559218_2561663_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|2561705_2562179_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118029.1|2562332_2563103_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_053285589.1|2563144_2564281_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001350058.1|2565151_2565589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508475.1|2565548_2569610_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_032254958.1|2569685_2571827_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	5.3e-25
WP_001142958.1|2572036_2572555_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|2573251_2573752_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|2573786_2574011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056975.1|2574061_2575537_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611738.1|2575543_2575957_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032254961.1|2575960_2577811_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	4658707	4665847	4809836		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4658707_4659346_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4659342_4660605_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4660601_4661510_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4661705_4662473_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|4662523_4663180_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|4663285_4665847_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 8
NZ_CP010117	Escherichia coli strain C2 chromosome, complete genome	4809836	4702443	4778141	4809836	portal,terminase,transposase,capsid,tRNA,head,tail,plate,lysis,integrase	Salmonella_phage(67.24%)	85	4743995:4744039	4779427:4779471
WP_000047176.1|4702443_4705074_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4705308_4705494_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|4707086_4707653_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|4707649_4708078_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611802.1|4708150_4709707_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|4709856_4710372_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|4710435_4711974_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_032254508.1|4711990_4713163_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|4713289_4713820_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|4713910_4714246_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|4714235_4714973_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165699.1|4715096_4716281_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|4716571_4717564_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|4717620_4718685_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|4718677_4719880_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|4720234_4721194_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246540.1|4721203_4723348_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.1e-194
WP_000080947.1|4723320_4723731_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_032254509.1|4723727_4723973_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	2.4e-06
WP_001295174.1|4724220_4724550_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|4724701_4725046_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|4725082_4725532_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|4726199_4726604_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229467.1|4726650_4727175_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|4727184_4727484_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|4727666_4727825_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|4727908_4728358_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|4728358_4729021_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4729041_4730442_-	GABA permease	NA	NA	NA	NA	NA
WP_000097641.1|4730752_4732033_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_032255081.1|4732046_4733495_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271942.1|4733517_4734786_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993087.1|4734805_4735783_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_085947771.1|4737291_4738453_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577254.1|4738605_4740324_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_000214996.1|4740325_4742074_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000448925.1|4742144_4742561_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|4742599_4743829_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
4743995:4744039	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_073508497.1|4744152_4745346_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	49.0	1.0e-105
WP_073508498.1|4745400_4746528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508499.1|4746524_4747544_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.2	1.6e-189
WP_077898454.1|4747547_4748177_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	56.0	2.1e-62
WP_000102106.1|4748300_4748543_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_073508500.1|4748575_4749085_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.7	5.4e-85
WP_073508501.1|4749092_4749389_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	2.4e-21
WP_000996717.1|4749506_4749848_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|4749915_4750149_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|4750148_4750376_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104141.1|4750372_4751230_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	1.3e-160
WP_073508502.1|4751226_4753641_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.5	0.0e+00
WP_001154431.1|4753794_4753983_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217566.1|4753993_4754227_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	3.7e-33
WP_000516592.1|4754300_4754561_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	62.2	5.8e-19
WP_053274844.1|4754609_4755221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073508503.1|4755510_4756209_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_001759370.1|4756217_4757252_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.4e-172
WP_001098431.1|4757251_4759018_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_073508504.1|4759160_4759994_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
WP_000742530.1|4760010_4761069_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.2e-181
WP_000059191.1|4761072_4761723_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|4761818_4762283_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|4762282_4762486_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_001419996.1|4762489_4762705_+	membrane protein	NA	E5G6N0	Salmonella_phage	81.7	8.2e-27
WP_001069916.1|4762685_4763198_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	1.2e-87
WP_000727851.1|4763199_4763577_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_023352535.1|4763573_4764002_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_001039936.1|4764097_4764529_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_023352536.1|4764521_4764968_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_000993775.1|4765036_4765615_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|4765611_4765971_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|4765957_4766866_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|4766858_4767464_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_073508505.1|4767460_4768963_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.1	6.8e-152
WP_073508506.1|4768959_4769346_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	58.3	2.5e-26
WP_073508507.1|4769317_4769761_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	49.3	3.1e-36
WP_073508508.1|4769763_4770255_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	6.3e-06
WP_000905010.1|4770285_4770852_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046120.1|4770994_4772167_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|4772176_4772692_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|4772746_4773049_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|4773063_4773183_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001492913.1|4773175_4776253_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980394.1|4776249_4776735_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_073508509.1|4776731_4777832_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.1e-175
WP_000972389.1|4777922_4778141_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
4779427:4779471	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
