The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	368228	475218	4807161	tail,portal,lysis,terminase,protease,integrase	Enterobacteria_phage(39.62%)	106	451451:451465	476963:476977
WP_001260835.1|368228_369050_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|369149_369233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743942.1|369325_369661_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091828.1|370058_371312_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|371418_372312_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|372446_373667_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|373791_374487_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071593517.1|374439_375732_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|375890_376505_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|376547_377402_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|377403_378021_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|378031_380455_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041681.1|380515_382942_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|383140_383446_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|383553_384264_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|384266_384827_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|384861_385203_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|385337_385664_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|385869_387084_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|387095_388115_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|388172_388301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|388302_389583_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|389617_389869_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001774503.1|389941_392413_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296931.1|392505_392697_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|392693_392882_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|393368_393944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073477121.1|393945_394101_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.6e-06
WP_000362155.1|394366_394786_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|394886_395168_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|395151_395577_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073476949.1|395648_396719_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	1.0e-61
WP_073476951.1|396759_397182_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	5.9e-61
WP_137459419.1|399973_401170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073476957.1|401960_402173_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	8.6e-29
WP_032154696.1|402631_402910_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	4.6e-06
WP_001597879.1|402911_403961_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.3e-113
WP_001047133.1|403974_404727_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_000066484.1|405402_405618_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|406372_406588_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_001557934.1|407090_407351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073476961.1|407464_407998_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	3.2e-96
WP_001071776.1|407994_408492_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|408855_409068_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|409078_409267_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|409414_409570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|409742_409916_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|410211_410418_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373425.1|410970_411465_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934102.1|411464_413567_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|413563_413776_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985958.1|413775_415284_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001136588.1|415228_417256_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097039.1|417342_417666_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001283153.1|417658_417934_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|417945_418524_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_072752502.1|418520_418922_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.2e-71
WP_000211132.1|418932_419676_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|419736_420123_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|420131_420461_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_048236858.1|420432_423498_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000447253.1|423497_423827_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152368.1|423836_424535_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000140752.1|424540_425284_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_000741589.1|425181_425829_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_073476963.1|425889_429369_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_032292241.1|429436_430036_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_073477122.1|430100_433451_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
WP_032292238.1|433450_434026_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	5.0e-103
WP_000086522.1|434123_434714_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|435029_435263_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|435331_435445_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_053294854.1|437419_438880_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000214712.1|438914_439118_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|439294_439981_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|440069_440816_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000210373.1|440952_442998_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024746.1|443041_443560_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671737.1|443835_444228_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592814.1|444482_445373_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000901367.1|445591_445687_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054183.1|445813_447001_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087214.1|447195_448095_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803657.1|448125_448344_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|448375_448759_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843414.1|448778_449213_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|449424_450090_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|450114_451305_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
451451:451465	attL	CGGTTTAATGACGTT	NA	NA	NA	NA
WP_073476965.1|451454_452570_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366501.1|452647_453529_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000156615.1|453629_455018_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|455081_456008_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|456007_456367_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558029.1|456505_457924_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_000854633.1|458150_459602_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_001351738.1|459808_460723_+	bestrophin family protein	NA	NA	NA	NA	NA
WP_001286597.1|460726_461485_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|461541_461832_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774183.1|461855_462731_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001222729.1|463831_464824_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911166.1|464823_465852_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000154352.1|467406_468360_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001301023.1|470472_470739_+	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_001125439.1|470738_472061_+	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_053295090.1|472309_473671_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_053295091.1|473667_475218_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
476963:476977	attR	CGGTTTAATGACGTT	NA	NA	NA	NA
>prophage 2
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	646898	688815	4807161	tRNA,lysis,terminase,holin,integrase	Escherichia_phage(46.88%)	44	650691:650707	694413:694429
WP_000837924.1|646898_648032_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|648172_648607_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|648871_649045_-	hypothetical protein	NA	NA	NA	NA	NA
650691:650707	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001351715.1|650746_651859_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000763702.1|651842_653249_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_053272183.1|653251_654553_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	1.8e-148
WP_000089447.1|654533_655628_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000613571.1|655631_655883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|655818_656751_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|656743_657535_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|657672_659130_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|659326_659512_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001351713.1|659728_660226_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839565.1|660225_660441_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|660692_661067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|661238_661667_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|662711_663254_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|663250_663541_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|663540_664140_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000882656.1|664608_664821_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
WP_001117227.1|665484_666684_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957772.1|666695_667388_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|667384_668266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|668396_669674_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|669737_671735_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|672075_672498_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_073476977.1|672538_673609_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	2.1e-62
WP_000693836.1|673680_674106_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|674089_674371_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|674471_674891_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001169151.1|675290_675446_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_053294904.1|675442_675931_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_001352098.1|677369_677540_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|677614_677890_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_024232464.1|677991_680592_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|680584_681394_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|681450_681645_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|681637_681847_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|681925_682141_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_072135188.1|682142_683378_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	7.9e-239
WP_001157407.1|683429_684365_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|684493_685867_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|686344_687328_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|687582_688815_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
694413:694429	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 3
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	1136227	1223699	4807161	tail,tRNA,lysis,portal,head,terminase,protease,capsid,integrase,plate	Salmonella_phage(57.63%)	92	1129190:1129205	1226270:1226285
1129190:1129205	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|1136227_1137520_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1137610_1138954_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1138964_1139576_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|1139734_1143724_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1143858_1144353_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1144897_1145863_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_053294893.1|1145985_1147752_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202175.1|1147752_1149474_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|1149515_1150220_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1150504_1150723_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1151407_1153684_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1153714_1154035_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1154357_1154582_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|1154654_1156601_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|1156597_1157713_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|1157863_1158820_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|1158816_1160475_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1160900_1161596_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|1162090_1162990_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|1163133_1164786_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1164797_1165766_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815337.1|1165898_1167617_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566372.1|1167653_1168655_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136577.1|1168665_1170096_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1170194_1171208_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001252135.1|1171204_1172035_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1172031_1172355_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|1172480_1172996_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1173213_1173942_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1173959_1174691_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1174697_1175414_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1175413_1176082_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|1176372_1177104_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149756.1|1177302_1178430_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|1178470_1178959_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|1179018_1179864_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|1179860_1180814_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|1180823_1181957_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|1182051_1183164_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1183514_1183991_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1184078_1184981_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1185041_1185764_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1185747_1186035_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1186194_1186452_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1186481_1186859_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|1187128_1188814_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1189049_1189268_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_048266810.1|1189358_1190459_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	8.4e-176
WP_032141790.1|1190455_1190941_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_048266809.1|1190937_1194015_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.4	0.0e+00
WP_000763311.1|1194007_1194127_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1194141_1194444_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207656.1|1194498_1195014_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046140.1|1195023_1196196_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
WP_024244557.1|1196338_1196905_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_073476995.1|1196935_1197346_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.8	2.5e-64
WP_001008225.1|1197366_1197810_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.0	9.2e-81
WP_073476997.1|1197781_1198384_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	9.5e-97
WP_073476999.1|1198383_1199934_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.8	4.2e-205
WP_048266804.1|1199930_1200536_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_073477001.1|1200528_1201437_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	88.7	7.3e-141
WP_048266802.1|1201423_1201783_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	8.6e-53
WP_000993753.1|1201779_1202358_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.5e-91
WP_048266801.1|1202636_1204412_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_048266800.1|1204487_1204934_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	4.3e-54
WP_149026028.1|1204926_1205358_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	88.1	8.1e-66
WP_001337513.1|1205453_1205882_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_059340429.1|1205890_1206256_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.3	7.2e-15
WP_028985765.1|1206257_1206770_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000171569.1|1206750_1206966_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_000868175.1|1206969_1207173_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|1207172_1207637_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059197.1|1207732_1208383_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.9e-111
WP_000742525.1|1208386_1209445_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
WP_000216240.1|1209461_1210295_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
WP_073477005.1|1210437_1212216_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_042044475.1|1212202_1213237_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	2.8e-173
WP_053065571.1|1213266_1214706_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_000700647.1|1215109_1215787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1215900_1216134_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154430.1|1216144_1216333_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_073477007.1|1216486_1218901_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_073477009.1|1218897_1219755_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	1.3e-160
WP_000752613.1|1219751_1219979_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244216.1|1219978_1220212_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_001352070.1|1220279_1220621_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000956182.1|1220584_1220785_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460891.1|1220792_1221302_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_001247707.1|1221334_1221556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047320.1|1221681_1222251_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001513672.1|1222266_1222458_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290937.1|1222646_1223699_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1226270:1226285	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 4
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	1759763	1877212	4807161	tail,transposase,lysis,portal,head,terminase,capsid,protease,holin,integrase,plate	Shigella_phage(39.76%)	137	1831811:1831856	1873311:1873356
WP_000131044.1|1759763_1761797_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|1761925_1762513_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|1762526_1763999_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|1764012_1765683_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|1765895_1766564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|1766806_1767502_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|1767494_1768922_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|1768932_1769652_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|1770178_1771033_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|1771258_1772584_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|1772691_1772928_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001349760.1|1774237_1774570_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000355479.1|1775349_1776123_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_001568589.1|1776183_1776738_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	4.4e-88
WP_032164935.1|1776767_1777157_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	4.2e-13
WP_053295118.1|1777178_1777619_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_001386003.1|1777590_1778193_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.4e-95
WP_001349760.1|1778465_1778798_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000355479.1|1779577_1780351_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_001568589.1|1780411_1780966_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	4.4e-88
WP_032164935.1|1780995_1781385_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	4.2e-13
WP_053295118.1|1781406_1781847_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_001386003.1|1781818_1782421_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.4e-95
WP_000738423.1|1783341_1783635_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|1783725_1783908_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_047668528.1|1784124_1784601_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	7.8e-86
WP_001120502.1|1784604_1784940_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_032246417.1|1785016_1786069_-	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	97.7	7.0e-204
WP_032192725.1|1786218_1786413_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	93.8	3.7e-26
WP_000737263.1|1786990_1788073_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000072039.1|1789205_1790060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053295119.1|1790086_1790785_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|1791056_1791683_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|1791773_1792505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192349.1|1794158_1795205_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|1795313_1796246_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|1796232_1797636_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_053271813.1|1797910_1799122_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|1799191_1800205_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_053271812.1|1800201_1801152_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	6.9e-33
WP_053271811.1|1801148_1801958_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000222149.1|1801967_1802834_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000543446.1|1802862_1803816_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_053271809.1|1806005_1807304_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	2.3e-47
WP_001247776.1|1807630_1807894_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|1807908_1808172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643628.1|1808400_1808682_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350438.1|1808716_1809286_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000101612.1|1809391_1812274_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|1812273_1812465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053295054.1|1812525_1814253_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	4.4e-86
WP_001275372.1|1814340_1814799_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|1814821_1815736_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001005473.1|1815838_1816726_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090787.1|1816815_1817427_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_053271805.1|1817506_1818652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786815.1|1818641_1819082_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_044864659.1|1819085_1820801_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|1820797_1821295_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_053271802.1|1822303_1822939_-	recombinase family protein	NA	NA	NA	NA	NA
WP_053271801.1|1823142_1823481_-	IclR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_053271800.1|1823632_1824784_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.6e-42
WP_073477026.1|1825223_1826087_+	GTPase family protein	NA	NA	NA	NA	NA
WP_053271797.1|1826178_1827000_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.8	2.1e-46
WP_029039039.1|1827216_1827918_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001115854.1|1827954_1828191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029039038.1|1828190_1828634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029039037.1|1828657_1829125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029039036.1|1829201_1829441_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_053271796.1|1829542_1830001_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	9.0e-15
WP_073477028.1|1830016_1830493_+	RadC family protein	NA	NA	NA	NA	NA
WP_053271794.1|1830501_1830723_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_007777712.1|1830743_1831061_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_007777710.1|1831081_1831423_+	YkfI toxin protein	NA	NA	NA	NA	NA
1831811:1831856	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_073477030.1|1832271_1833966_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_130723338.1|1834013_1834298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073477032.1|1834767_1835529_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	35.0	1.1e-09
WP_000258782.1|1835862_1836213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560788.1|1836216_1836750_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001519526.1|1836736_1836886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519525.1|1836875_1837019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|1837440_1838214_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_063856337.1|1838274_1838829_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	2.8e-87
WP_073477034.1|1838858_1839350_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	34.5	1.1e-05
WP_001089536.1|1839352_1839796_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	51.0	1.6e-37
WP_040076167.1|1839767_1840370_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	89.4	3.9e-90
WP_073477036.1|1840369_1841170_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	4.0e-50
WP_073477038.1|1841173_1841758_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.2e-112
WP_021527505.1|1841748_1842807_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	5.6e-201
WP_000424729.1|1842793_1843219_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_069896014.1|1843218_1843767_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	99.5	1.1e-96
WP_073477040.1|1843766_1844846_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	7.7e-206
WP_073477042.1|1844842_1846171_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	97.7	7.4e-243
WP_000679479.1|1846232_1846763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073477044.1|1846854_1848687_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.7	1.4e-300
WP_000661047.1|1848828_1849098_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|1849097_1849454_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_073477046.1|1849453_1850950_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.8	2.0e-276
WP_032225398.1|1850933_1851104_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	3.5e-25
WP_021549522.1|1851112_1851673_-	hypothetical protein	NA	S5FM61	Shigella_phage	99.5	1.4e-105
WP_000213502.1|1851669_1852176_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702402.1|1852150_1852561_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000927711.1|1852557_1852881_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601365.1|1852883_1853084_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257490.1|1853132_1854338_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
WP_001193631.1|1854352_1855003_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_024246577.1|1854980_1856222_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	5.0e-241
WP_000605613.1|1856221_1856404_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
WP_072011717.1|1856415_1857912_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929190.1|1858145_1858640_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	8.6e-88
WP_001135214.1|1858765_1859116_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	4.7e-64
WP_109161702.1|1859168_1859363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073477048.1|1859893_1860286_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	92.3	3.3e-58
WP_021563578.1|1860269_1860746_-	glycoside hydrolase family protein	NA	U5P0A9	Shigella_phage	99.4	2.9e-88
WP_001120496.1|1860749_1861076_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000357056.1|1861422_1862442_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|1862456_1862837_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_073477050.1|1862851_1863841_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	3.3e-195
WP_073477052.1|1863848_1864658_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	7.4e-153
WP_073477054.1|1864677_1865067_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	2.1e-68
WP_000210146.1|1865063_1865390_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	6.6e-52
WP_073477056.1|1865386_1866040_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
WP_073477058.1|1866039_1866528_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.8	8.6e-80
WP_021528956.1|1866524_1867466_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	100.0	1.5e-144
WP_001250269.1|1867455_1867635_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|1867810_1868362_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_000205494.1|1868399_1868600_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|1868697_1869324_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549623.1|1869571_1869778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|1869749_1870184_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|1870711_1871248_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|1871238_1871601_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|1871600_1871906_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|1872132_1873296_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|1873500_1874754_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1873311:1873356	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|1874765_1875869_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|1876156_1877212_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 5
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	1887274	1953057	4807161	transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	57	NA	NA
WP_000006255.1|1887274_1887772_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_024192679.1|1887947_1888697_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|1888906_1889167_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|1889169_1889448_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1889603_1890344_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1890314_1891082_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1891287_1891866_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|1892105_1894550_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|1894592_1895066_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|1895219_1895990_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|1896030_1897167_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|1897597_1897990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053294990.1|1897967_1902212_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_073477062.1|1902287_1904429_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	4.8e-26
WP_001142958.1|1904638_1905157_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|1905851_1906352_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_053295070.1|1906386_1906611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|1906661_1908137_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|1908143_1908557_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|1908560_1910411_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_050940104.1|1910374_1911457_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_072135217.1|1911481_1911694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072135218.1|1911709_1912762_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_053295071.1|1912758_1913283_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|1913285_1914617_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|1914621_1915383_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|1915391_1918157_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|1918153_1918897_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|1918901_1920314_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_126722386.1|1920422_1923857_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_053295073.1|1923867_1925085_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|1925108_1925591_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|1925634_1926549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053295074.1|1926558_1927038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053628.1|1927174_1927960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300756.1|1928498_1929230_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_001556414.1|1929294_1929762_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.1	1.0e-50
WP_001297210.1|1929758_1930481_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052717.1|1930514_1931270_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1931341_1932700_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001230983.1|1933374_1934175_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648577.1|1934415_1935330_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997050.1|1935326_1936130_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_001140174.1|1941984_1942557_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1942744_1943776_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1943768_1944422_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|1944461_1945277_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1945394_1945799_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1945795_1946503_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260707.1|1946613_1948332_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001469748.1|1948384_1949209_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|1949408_1950119_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|1950132_1950555_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1950551_1951097_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1951262_1951463_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1951449_1951710_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|1951758_1953057_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	3967888	3981071	4807161		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3967888_3968650_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3968643_3969270_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3969409_3970549_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3970611_3971604_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|3971697_3973062_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|3973150_3973927_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3973931_3974570_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|3974566_3975829_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|3975825_3976734_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_053294956.1|3976929_3977697_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.6e-69
WP_001141322.1|3977747_3978404_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_053294957.1|3978509_3981071_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 7
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	4060692	4072098	4807161	integrase	Enterobacteria_phage(70.0%)	12	4059679:4059692	4072224:4072237
4059679:4059692	attL	AATATCATTTATCC	NA	NA	NA	NA
WP_073477101.1|4060692_4063026_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_000856729.1|4063040_4063361_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032153988.1|4063496_4063952_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_073477103.1|4063944_4064232_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	3.3e-47
WP_073477105.1|4064224_4064815_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_077897269.1|4064811_4065078_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.1e-44
WP_073477107.1|4065630_4066365_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.6e-130
WP_000638628.1|4066361_4066862_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4066935_4067508_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_073477109.1|4067826_4069635_+	DEAD/DEAH box helicase family protein	NA	J7KK96	Streptococcus_phage	28.0	1.6e-14
WP_021513174.1|4069666_4070854_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	1.3e-105
WP_000162574.1|4071615_4072098_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
4072224:4072237	attR	GGATAAATGATATT	NA	NA	NA	NA
>prophage 8
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	4607357	4616799	4807161		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|4607357_4608284_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4608288_4609020_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4609000_4609108_-	protein YohO	NA	NA	NA	NA	NA
WP_069357594.1|4609167_4609899_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
WP_001295431.1|4610120_4611806_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4611802_4612522_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4612568_4613039_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_053294822.1|4613079_4613541_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.0	1.6e-75
WP_001423058.1|4613665_4615666_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_053294821.1|4615662_4616799_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.6e-161
>prophage 9
NZ_CP010171	Escherichia coli strain H7 chromosome, complete genome	4807161	4711364	4718887	4807161		Enterobacteria_phage(42.86%)	7	NA	NA
WP_053294812.1|4711364_4712759_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000999466.1|4712916_4713912_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_053294811.1|4714154_4715048_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	4.6e-47
WP_001515524.1|4715419_4716505_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_032208164.1|4716504_4717404_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	4.1e-27
WP_053294810.1|4717461_4718340_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	2.3e-107
WP_032208168.1|4718344_4718887_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.5	4.6e-50
