The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	126674	139857	4833228		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|126674_129236_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|129341_129998_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|130048_130816_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|131011_131920_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|131916_133179_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|133175_133814_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|133818_134595_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|134683_136048_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|136141_137134_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|137196_138336_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|138475_139102_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|139095_139857_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 2
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	1818663	1830653	4833228	integrase	Enterobacteria_phage(80.0%)	14	1817140:1817154	1832943:1832957
1817140:1817154	attL	AGATTGCGAGATGCC	NA	NA	NA	NA
WP_073464941.1|1818663_1819923_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.2e-72
WP_073464939.1|1820024_1820753_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_073464937.1|1821433_1822006_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	7.2e-94
WP_073464936.1|1822079_1822580_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_073464934.1|1822576_1823311_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	3.9e-129
WP_001149160.1|1823864_1824131_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_071940787.1|1824127_1824718_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_073464933.1|1824710_1824998_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	1.2e-46
WP_000459308.1|1824990_1825446_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_000856729.1|1825581_1825902_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783659.1|1825916_1828250_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_087889224.1|1828604_1828799_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	2.2e-23
WP_001338066.1|1829542_1829665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001366032.1|1829672_1830653_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	9.4e-102
1832943:1832957	attR	AGATTGCGAGATGCC	NA	NA	NA	NA
>prophage 3
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	2773303	2794701	4833228	protease,lysis,integrase,tail	Enterobacteria_phage(46.88%)	35	2764804:2764818	2799051:2799065
2764804:2764818	attL	CTGGAAGATGGCCTG	NA	NA	NA	NA
WP_000533643.1|2773303_2774374_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|2774351_2774570_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|2774609_2774777_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000026224.1|2774865_2775147_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|2775338_2775887_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763363.1|2775883_2776105_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188870.1|2776203_2776419_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548514.1|2776495_2776687_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682305.1|2776659_2776842_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_000100847.1|2777515_2778301_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|2778306_2778603_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|2778677_2778821_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2778789_2778954_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|2779026_2779395_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001383906.1|2779583_2780453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340004.1|2780461_2780785_-	antitermination protein N	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
WP_000618037.1|2781138_2781543_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
WP_000028392.1|2781539_2782172_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|2782277_2782493_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|2782612_2782906_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001540841.1|2783027_2783390_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000971055.1|2783386_2783527_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|2783612_2783990_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|2784145_2784670_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|2784862_2785822_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839596.1|2787090_2787306_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135261.1|2787305_2787803_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000092273.1|2787799_2788267_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|2788254_2788407_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|2788758_2789169_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|2789225_2789459_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_073464802.1|2790141_2790726_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.6e-104
WP_000586341.1|2790799_2792131_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_073464800.1|2792876_2793353_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001543588.1|2793411_2794701_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
2799051:2799065	attR	CTGGAAGATGGCCTG	NA	NA	NA	NA
>prophage 4
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	2874889	2929821	4833228	terminase,tail,protease,portal,integrase	Salmonella_phage(51.85%)	56	2868532:2868546	2885112:2885126
2868532:2868546	attL	TGAAAAACCTGAAAG	NA	NA	NA	NA
WP_000290937.1|2874889_2875942_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|2876130_2876322_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_024220196.1|2876337_2876907_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000188450.1|2877052_2877256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|2877320_2877830_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956192.1|2877837_2878134_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|2878251_2878593_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244209.1|2878660_2878894_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000752613.1|2878893_2879121_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_073464783.1|2879117_2879975_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	6.0e-161
WP_073464781.1|2879971_2882386_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|2882539_2882728_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|2882738_2882972_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_073464779.1|2883300_2885193_+	NTPase KAP	NA	NA	NA	NA	NA
2885112:2885126	attR	CTTTCAGGTTTTTCA	NA	NA	NA	NA
WP_000885505.1|2885717_2886389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077897245.1|2886440_2887490_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	4.1e-172
WP_073464775.1|2887489_2889256_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_073465039.1|2889822_2889885_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000980400.1|2892595_2893081_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011793.1|2893077_2894178_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_000972391.1|2894268_2894487_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|2894722_2896408_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|2896677_2897055_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|2897084_2897342_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201560.1|2897501_2897789_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001543595.1|2897772_2898495_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2898555_2899458_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2899545_2900022_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|2900372_2901485_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|2901579_2902713_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|2902722_2903676_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|2903672_2904518_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2904577_2905066_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|2905106_2906234_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|2906432_2907164_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|2907454_2908123_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|2908122_2908839_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|2908845_2909577_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|2909594_2910323_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|2910540_2911056_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2911181_2911505_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|2911501_2912332_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|2912328_2913342_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|2913440_2914871_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566376.1|2914881_2915883_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|2915919_2917638_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|2917770_2918739_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|2918750_2920403_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001338421.1|2920546_2921446_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|2921940_2922636_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|2923060_2924719_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_149025508.1|2924715_2925672_-	DUF535 family protein	NA	NA	NA	NA	NA
WP_000746460.1|2925822_2926938_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|2926934_2928881_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2928953_2929178_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2929500_2929821_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 5
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	2957100	2963689	4833228	integrase	Escherichia_phage(42.86%)	7	2953022:2953035	2962427:2962440
2953022:2953035	attL	TTGCTTGCTGCGTA	NA	NA	NA	NA
WP_000067977.1|2957100_2957898_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|2957929_2958925_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|2959018_2959330_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_073464764.1|2959434_2959623_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	6.1e-18
WP_023148821.1|2959622_2960786_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	4.1e-205
WP_000468308.1|2960868_2961087_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|2961406_2963689_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
2962427:2962440	attR	TACGCAGCAAGCAA	NA	NA	NA	NA
>prophage 6
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	3334493	3404210	4833228	terminase,holin,tail,protease,integrase	Enterobacteria_phage(44.78%)	89	3334291:3334307	3384402:3384418
3334291:3334307	attL	AGAACACTTTCTTAAAT	NA	NA	NA	NA
WP_000627155.1|3334493_3335687_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
WP_001237029.1|3335922_3336165_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000432226.1|3336203_3337316_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_073464684.1|3337327_3340237_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	93.8	0.0e+00
WP_000884659.1|3340376_3340538_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	100.0	1.7e-24
WP_001568763.1|3340549_3340756_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_019076927.1|3341083_3341308_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
WP_149025511.1|3342168_3342891_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	54.3	1.4e-70
WP_019076923.1|3342959_3343187_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	2.4e-16
WP_060643426.1|3343218_3343758_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	84.4	1.0e-78
WP_000072106.1|3343842_3344751_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
WP_000838082.1|3344747_3345437_+	Replication protein 14	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
WP_016066204.1|3345438_3345783_+	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	100.0	1.3e-58
WP_016066205.1|3345779_3345977_+	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
WP_073464680.1|3345973_3346519_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	92.1	7.7e-37
WP_001229289.1|3346520_3346898_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	100.0	1.1e-69
WP_000161222.1|3346894_3347113_+	DUF4014 family protein	NA	K7P7J6	Enterobacteria_phage	97.2	4.6e-33
WP_077897258.1|3347173_3347443_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	55.9	1.6e-11
WP_021571821.1|3347442_3347700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073464677.1|3347696_3349685_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.0	1.6e-201
WP_016247098.1|3349784_3350021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247099.1|3350113_3350371_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	81.3	7.0e-25
WP_073464675.1|3350726_3351326_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	97.5	7.7e-107
WP_039022272.1|3351325_3351532_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	100.0	8.7e-34
WP_001472175.1|3351534_3351825_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	100.0	1.1e-50
WP_001472176.1|3351821_3352184_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	99.2	1.4e-63
WP_001567566.1|3352180_3352321_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	100.0	1.7e-20
WP_073464673.1|3352317_3353133_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	97.0	1.0e-141
WP_016066213.1|3353637_3353916_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_073465033.1|3353893_3354436_+	lysozyme	NA	K7PM52	Enterobacteria_phage	99.4	4.7e-103
WP_016247106.1|3354432_3354981_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.6	1.8e-09
WP_071839683.1|3354984_3355200_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_016247107.1|3355178_3355343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958715.1|3355422_3355623_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	1.3e-18
WP_023277179.1|3355722_3356094_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	56.6	1.1e-34
WP_073464672.1|3356097_3356736_+	hypothetical protein	NA	I6S676	Salmonella_phage	87.7	1.0e-109
WP_016247111.1|3356767_3357256_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	84.3	2.1e-54
WP_073464670.1|3357252_3358824_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.1	6.0e-308
WP_073464668.1|3358828_3360232_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.5	4.4e-238
WP_073464667.1|3360233_3361337_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.6	1.9e-188
WP_016247115.1|3361357_3361822_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	59.6	4.5e-46
WP_073464665.1|3362161_3362914_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	90.4	3.1e-121
WP_016156686.1|3362931_3364071_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_073464663.1|3364109_3364343_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	3.7e-17
WP_073464661.1|3364345_3364828_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	84.4	3.7e-75
WP_073464660.1|3364829_3365183_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	94.0	2.4e-55
WP_073464658.1|3365185_3365785_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	1.7e-98
WP_073464657.1|3365774_3366191_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	79.2	1.4e-59
WP_073464655.1|3366237_3367170_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	94.5	1.2e-159
WP_048986151.1|3367212_3367548_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	72.1	2.0e-40
WP_073465031.1|3367918_3368536_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	77.0	5.1e-61
WP_073464653.1|3368601_3368940_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	93.8	8.6e-55
WP_016247126.1|3368957_3369245_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_073464652.1|3369244_3372292_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	75.2	0.0e+00
WP_073464650.1|3372365_3372752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045357007.1|3372855_3373113_+	hypothetical protein	NA	Q9MCR9	Enterobacteria_phage	92.9	1.8e-36
WP_131619226.1|3373126_3373357_-	hypothetical protein	NA	Q9MCR8	Enterobacteria_phage	94.7	3.1e-32
WP_023277160.1|3373520_3373871_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	95.7	1.2e-56
WP_023277159.1|3373870_3374641_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.5	1.1e-142
WP_023277158.1|3374653_3375385_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	94.2	1.6e-146
WP_073464648.1|3375372_3375966_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	79.4	2.0e-78
WP_016247135.1|3376020_3379500_+	host specificity protein J	NA	G8C7R4	Escherichia_phage	87.7	0.0e+00
WP_000807260.1|3379803_3380478_+	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	100.0	5.1e-123
WP_001228569.1|3380589_3380823_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_073464646.1|3380883_3382227_+|tail	phage tail protein	tail	K7P6T0	Enterobacteria_phage	62.4	7.2e-145
WP_073464645.1|3382283_3382838_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	50.5	4.7e-42
WP_073464643.1|3382834_3383698_-|tail	tail fiber domain-containing protein	tail	I6PDG4	Cronobacter_phage	40.2	8.5e-22
WP_073465029.1|3383732_3384281_+	recombinase family protein	NA	K7PGS7	Enterobacteria_phage	95.1	7.6e-93
WP_000967595.1|3384399_3384696_-	YciI family protein	NA	NA	NA	NA	NA
3384402:3384418	attR	AGAACACTTTCTTAAAT	NA	NA	NA	NA
WP_001360141.1|3384919_3385639_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|3385678_3386077_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|3386181_3386721_-	septation protein A	NA	NA	NA	NA	NA
WP_000028545.1|3386750_3387494_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737226.1|3387850_3388489_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_073464641.1|3388548_3389055_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|3389100_3389601_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3389686_3389866_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|3390246_3391053_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|3391052_3392246_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|3392257_3393619_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|3393619_3395215_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_057696002.1|3395214_3396777_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3396868_3396913_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|3397050_3397932_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3397928_3398549_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|3400683_3401556_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278883.1|3401595_3402186_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|3402182_3402941_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|3403160_3404210_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	3684524	3702228	4833228	terminase,tail,lysis	Enterobacteria_phage(52.94%)	23	NA	NA
WP_073464588.1|3684524_3685985_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	7.3e-42
WP_120795384.1|3687958_3688072_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3688140_3688374_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|3688690_3689281_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885614.1|3689378_3689954_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_001233090.1|3690771_3691371_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_073464586.1|3691757_3693095_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	8.5e-263
WP_000421825.1|3693169_3693709_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548593.1|3694259_3694466_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|3694761_3694935_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|3695107_3695263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|3695410_3695599_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3695609_3695822_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|3696185_3696683_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|3696679_3697213_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|3697209_3697521_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839590.1|3697525_3697741_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|3698494_3698710_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_073464585.1|3699385_3700138_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	5.6e-131
WP_001265197.1|3700151_3701201_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.3	1.3e-112
WP_001309521.1|3701202_3701481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980999.1|3701547_3701799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073464583.1|3702015_3702228_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	5.1e-29
>prophage 8
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	3705463	3718361	4833228		Shigella_phage(14.29%)	13	NA	NA
WP_073464582.1|3705463_3706429_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	7.7e-56
WP_122999053.1|3706409_3706631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005552.1|3709007_3709259_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876986.1|3709293_3710574_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|3710575_3710704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|3710761_3711781_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|3711792_3713007_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3713212_3713539_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3713673_3714015_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3714049_3714610_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3714612_3715323_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|3715430_3715736_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041681.1|3715934_3718361_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
>prophage 9
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	4179882	4186189	4833228		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|4179882_4180428_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_004016728.1|4180432_4181311_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_004016730.1|4181369_4182269_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.3e-28
WP_000699403.1|4182268_4183354_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_044067113.1|4183726_4184620_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	2.3e-46
WP_045174079.1|4184794_4186189_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	6.3e-19
>prophage 10
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	4232748	4239376	4833228	terminase,tRNA,portal	Escherichia_phage(50.0%)	7	NA	NA
WP_000675150.1|4232748_4234152_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|4234148_4234871_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|4235061_4235394_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|4235540_4236902_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_073465019.1|4237174_4237393_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	4.0e-37
WP_001333118.1|4238072_4238342_+|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
WP_033560205.1|4238341_4239376_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.4e-201
>prophage 11
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	4242827	4250600	4833228	integrase	Salmonella_phage(36.36%)	12	4237047:4237073	4248792:4248818
4237047:4237073	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_073464487.1|4242827_4245140_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.4	0.0e+00
WP_000027664.1|4245129_4245405_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|4245401_4245626_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277895.1|4245625_4245928_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	5.0e-46
WP_000557701.1|4245927_4246152_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217684.1|4246215_4246716_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_001005161.1|4246712_4246883_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.0e-24
WP_000043869.1|4246893_4247169_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|4247283_4247583_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|4247698_4248712_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001318299.1|4248977_4249295_-	hypothetical protein	NA	NA	NA	NA	NA
4248792:4248818	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807356.1|4249700_4250600_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 12
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	4293743	4303184	4833228		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001300968.1|4293743_4294880_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|4294876_4296877_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|4297001_4297463_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_073464477.1|4297502_4297973_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_073464475.1|4298019_4298739_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4298735_4300421_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4300642_4301374_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4301433_4301541_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4301521_4302253_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|4302257_4303184_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 13
NZ_CP010169	Escherichia coli strain H5 chromosome, complete genome	4833228	4518870	4589700	4833228	terminase,lysis,holin,protease,portal,integrase,tRNA,coat	Enterobacteria_phage(46.03%)	90	4516075:4516091	4569041:4569057
4516075:4516091	attL	ATGCGCGACATCAAAAA	NA	NA	NA	NA
WP_001283585.1|4518870_4519683_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|4519682_4520696_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699145.1|4520761_4521898_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
WP_000615834.1|4521996_4522992_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|4522988_4524167_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|4524431_4525652_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683822.1|4525810_4527817_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4527937_4528216_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089218.1|4528249_4528798_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|4528797_4529607_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043816.1|4529606_4530431_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4530434_4531520_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|4531554_4532487_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4532652_4533204_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_073464435.1|4533275_4534133_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844747.1|4534134_4534674_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714137.1|4534670_4535159_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018448.1|4535155_4535665_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482742.1|4535680_4536433_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_042966536.1|4536452_4539098_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033319.1|4539179_4539743_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4540426_4540912_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_073464433.1|4541114_4543259_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531932.1|4543258_4544569_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4544749_4545034_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|4545405_4546746_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_016242291.1|4547112_4548369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4548550_4549306_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368117.1|4549599_4550532_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
WP_073464432.1|4550843_4552001_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.1e-221
WP_073464430.1|4552287_4554135_-	hypothetical protein	NA	Q716G1	Shigella_phage	46.7	2.8e-147
WP_073465018.1|4554235_4555159_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	98.0	2.3e-174
WP_000677939.1|4555227_4555389_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_000090241.1|4555479_4555731_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000821222.1|4555747_4556167_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_032178650.1|4556285_4556609_+	hypothetical protein	NA	B9UDL2	Salmonella_phage	97.4	5.4e-14
WP_073464429.1|4559095_4560391_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	90.7	1.2e-184
WP_000964882.1|4560400_4561093_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_073464427.1|4561095_4561551_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	1.1e-86
WP_073464425.1|4561550_4562399_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	3.3e-103
WP_073464423.1|4562398_4563817_-	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.4	1.2e-275
WP_001054834.1|4563816_4564317_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_024180326.1|4564294_4564555_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	96.6	2.4e-25
WP_001196946.1|4564599_4565895_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_000373006.1|4565894_4566806_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_062810285.1|4566819_4568985_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_000417851.1|4568985_4570485_-|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	100.0	4.8e-307
4569041:4569057	attR	TTTTTGATGTCGCGCAT	NA	NA	NA	NA
WP_000729920.1|4570462_4570951_-	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_001029634.1|4571223_4571613_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	58.9	2.1e-36
WP_000807787.1|4571614_4571857_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.7	8.3e-36
WP_001139680.1|4572164_4572317_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_073464422.1|4572304_4572742_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	1.9e-70
WP_000229389.1|4572738_4573215_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|4573198_4573522_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|4573955_4574579_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|4574575_4574764_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_025748958.1|4574760_4575123_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	3.5e-62
WP_062893758.1|4575119_4575410_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001279421.1|4575409_4575679_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_073464420.1|4575671_4575848_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	5.7e-26
WP_073464418.1|4575840_4576182_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	7.3e-62
WP_001254220.1|4576184_4576361_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_045172983.1|4576357_4576768_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.4e-70
WP_000344553.1|4576967_4577252_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.4	2.0e-33
WP_000807325.1|4577269_4577476_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	97.1	6.9e-31
WP_073464416.1|4577548_4578925_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.2e-253
WP_001608293.1|4578921_4579743_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_000166961.1|4579729_4579891_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001177653.1|4579925_4580204_-	lambda phage CII family protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_059334175.1|4580323_4580539_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	97.2	2.4e-34
WP_016242500.1|4580614_4581310_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_073464414.1|4581590_4581977_+	antitermination protein	NA	Q716D8	Shigella_phage	99.1	3.4e-55
WP_000915090.1|4581985_4582123_+	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_032353701.1|4582177_4582648_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_053878831.1|4582694_4582991_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	2.1e-49
WP_001037043.1|4582990_4583149_+	hypothetical protein	NA	K7PMD4	Enterobacterial_phage	100.0	9.9e-22
WP_063121024.1|4583281_4584250_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000638547.1|4584274_4584406_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_073464412.1|4584390_4584543_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.4e-20
WP_000050554.1|4584618_4584789_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_025866375.1|4584799_4585405_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	2.1e-107
WP_000951334.1|4585404_4585788_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111303.1|4585811_4586105_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_001214456.1|4586115_4586280_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_000812188.1|4586276_4586837_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	69.9	8.6e-60
WP_072018156.1|4586833_4587067_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_073464410.1|4587925_4588681_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	31.5	5.5e-09
WP_073464408.1|4588673_4588958_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	4.2e-47
WP_073464407.1|4589030_4589375_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	4.5e-59
WP_001163428.1|4589499_4589700_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
