The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	529036	616039	4827779	portal,capsid,terminase,lysis,plate,tRNA,head,tail,integrase,protease	Salmonella_phage(61.82%)	87	521997:522012	618984:618999
521997:522012	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|529036_530329_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|530419_531763_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|531773_532385_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_040071927.1|532539_536685_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|536819_537314_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|537858_538824_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_023156001.1|538946_540713_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|540713_542435_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|542476_543181_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|543465_543684_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|544530_546807_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|546837_547158_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|547480_547705_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|547777_549724_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|549720_550836_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|550986_551943_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|551939_553598_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|554023_554719_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|555213_556113_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|556256_557909_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|557920_558889_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|559021_560740_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|560776_561778_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|561788_563219_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|563317_564331_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|564327_565158_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|565154_565478_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|565603_566119_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|566336_567065_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|567082_567814_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|567820_568537_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|568536_569205_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|569430_570162_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023155863.1|570336_571464_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_023155864.1|571504_571993_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|572052_572898_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|572894_573848_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|573857_574991_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|575085_576198_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|576549_577026_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|577113_578016_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189121.1|578076_578799_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|578782_579070_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|579229_579487_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|579516_579894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|580163_581849_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|582084_582303_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_024220389.1|582393_583494_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.9e-176
WP_000980395.1|583490_583976_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_073466832.1|583972_587050_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_001513105.1|587042_587162_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_001281009.1|587176_587479_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_073466834.1|587533_588049_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	3.7e-89
WP_073466835.1|588058_589231_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	1.6e-201
WP_073466837.1|589337_589751_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	74.6	2.2e-20
WP_073466839.1|589750_591856_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	53.1	1.5e-75
WP_021552380.1|591852_592458_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	3.1e-111
WP_001741414.1|592450_593359_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	8.6e-142
WP_000177580.1|593345_593705_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_001741449.1|593701_594280_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_053891414.1|594348_594795_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	6.6e-63
WP_001039945.1|594787_595219_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_001741481.1|595314_595743_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.2	8.9e-57
WP_024167991.1|595739_596255_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.1e-89
WP_000171568.1|596235_596451_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001741421.1|596454_596658_-	phage Tail protein X family protein	NA	E5G6M9	Salmonella_phage	94.0	6.1e-32
WP_000673520.1|596657_597122_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059191.1|597217_597868_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_001556508.1|597871_598930_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.9	5.8e-182
WP_000216241.1|598946_599780_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	4.5e-121
WP_001098427.1|599922_601689_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_077897270.1|601688_602717_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.5	9.0e-172
WP_001741452.1|602766_605103_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_048264226.1|605699_607820_-	ATPase AAA	NA	NA	NA	NA	NA
WP_001217580.1|608264_608498_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_001154434.1|608508_608697_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_072664303.1|608849_611264_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_000104157.1|611260_612118_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_000752613.1|612114_612342_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244167.1|612341_612575_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000963473.1|612642_612984_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956182.1|612947_613148_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|613155_613665_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|613697_613919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245839.1|614044_614614_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001321204.1|614629_614821_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001471277.1|615007_616039_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
618984:618999	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	1268279	1339035	4827779	protease,transposase,plate,tRNA	Vibrio_phage(25.0%)	55	NA	NA
WP_000420795.1|1268279_1269416_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001402130.1|1269872_1270256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402129.1|1270415_1274927_-	RHS repeat-associated core domain protein	NA	NA	NA	NA	NA
WP_023155452.1|1274957_1275389_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_032283003.1|1275416_1277636_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|1277660_1278008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897271.1|1278028_1278541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114143940.1|1279354_1279534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166652.1|1279588_1280365_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_073466849.1|1280364_1284231_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000522897.1|1284230_1284476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|1284526_1285201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|1285206_1286523_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|1286519_1287863_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|1287866_1288400_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|1288467_1288953_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871595.1|1289066_1289438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533466.1|1289434_1289920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245849.1|1289972_1291487_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|1291511_1292057_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|1292118_1292409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402121.1|1292411_1292975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|1292987_1295621_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_001402119.1|1295953_1296868_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_001402118.1|1296854_1297685_+	impE family protein	NA	NA	NA	NA	NA
WP_001402117.1|1297681_1298176_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073466851.1|1298191_1300075_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001402115.1|1300071_1301067_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001402114.1|1301077_1302124_+	type VI secretion system protein	NA	NA	NA	NA	NA
WP_023155443.1|1302123_1302399_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_001140175.1|1312220_1312796_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1312983_1314015_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1314007_1314661_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|1314700_1315516_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1315633_1316038_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094031.1|1316034_1316742_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260708.1|1316852_1318571_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000239192.1|1319601_1320312_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1320325_1320748_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185294.1|1320744_1321290_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1321455_1321656_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1321642_1321903_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_023155663.1|1321951_1323250_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1323314_1323704_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1323760_1325902_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|1326000_1326960_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294774.1|1326972_1330455_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|1330491_1331088_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|1331084_1332233_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1332232_1333021_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1333024_1333480_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1333584_1334610_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1334613_1335099_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1335220_1337653_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|1337682_1339035_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 3
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	1915468	1962831	4827779	tail,plate,tRNA	Burkholderia_phage(31.58%)	48	NA	NA
WP_001298868.1|1915468_1916506_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000912594.1|1916869_1917892_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_001295691.1|1918209_1918725_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|1918766_1918976_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001134708.1|1919091_1920471_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|1920489_1921098_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|1921207_1921576_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|1921746_1924170_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455228.1|1924324_1925197_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001297295.1|1925209_1925707_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000783444.1|1927738_1928659_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973658.1|1928901_1930242_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|1930313_1931429_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|1931793_1932984_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001297290.1|1933156_1934701_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252069.1|1934715_1935606_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001097279.1|1935977_1937453_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|1937496_1937907_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000487766.1|1938032_1938176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295279.1|1938176_1938455_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000745708.1|1938501_1940598_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595534.1|1940597_1941335_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|1941331_1941970_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|1942083_1942326_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000790008.1|1942680_1944330_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290317.1|1944854_1946204_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001402759.1|1946265_1946607_-	mor transcription activator family protein	NA	Q6QIE8	Burkholderia_phage	48.1	2.2e-21
WP_001402757.1|1947143_1947431_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	1.8e-16
WP_001402756.1|1947433_1948039_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.7	2.5e-57
WP_000777272.1|1948051_1948366_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_001402755.1|1948512_1948968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|1948964_1949162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001402754.1|1949151_1950576_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.6	6.4e-192
WP_000907502.1|1950575_1951100_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_001402753.1|1951150_1951468_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086722008.1|1951427_1951556_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001402752.1|1951657_1954033_+|tail	phage-related minor tail family protein	tail	A4JWL0	Burkholderia_virus	25.4	9.1e-58
WP_073466856.1|1954032_1954986_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.0	1.6e-34
WP_001402750.1|1954985_1955195_+	phage Tail protein X family protein	NA	A4JWL2	Burkholderia_virus	58.8	3.7e-16
WP_023155398.1|1955182_1956223_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.4	3.0e-74
WP_001402748.1|1956232_1956934_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_001093498.1|1957032_1957392_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951745.1|1957382_1958498_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_001755399.1|1958490_1959123_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	53.0	3.1e-21
WP_001402746.1|1959125_1960952_+|tail	phage tail fiber repeat family protein	tail	A0A0M3ULH6	Salmonella_phage	43.5	2.1e-54
WP_001402745.1|1960958_1961573_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_001402744.1|1961569_1962025_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	3.0e-26
WP_001402743.1|1962039_1962831_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	9.1e-47
>prophage 4
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	2084370	2136531	4827779	portal,capsid,terminase,lysis,plate,head,tail,protease,integrase,holin	Escherichia_phage(41.86%)	66	2100268:2100314	2133743:2133789
WP_000208242.1|2084370_2084901_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|2084910_2086242_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2086308_2087235_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2087327_2087813_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2087897_2088143_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2088567_2089413_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2089435_2090944_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2091079_2092090_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|2092186_2092933_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2092937_2093366_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2093392_2093692_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|2093903_2094344_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802233.1|2094444_2095044_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2095151_2095919_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|2095973_2096729_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045671.1|2096835_2097825_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|2098143_2099106_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2099286_2100189_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2100268:2100314	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2100425_2100644_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_023140596.1|2100725_2101889_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	7.0e-205
WP_023140595.1|2101888_2102368_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.5e-84
WP_073466858.1|2102382_2104830_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_000785970.1|2104822_2104942_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2104974_2105250_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_073466860.1|2105306_2105825_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	9.4e-93
WP_023140593.1|2105837_2107028_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.4e-224
WP_001572865.1|2107287_2107980_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	99.1	5.6e-125
WP_001406733.1|2108471_2108651_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_000002748.1|2108703_2108982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021568195.1|2109202_2109730_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	96.0	3.1e-91
WP_021568194.1|2109733_2111743_-	hypothetical protein	NA	Q7Y4D4	Escherichia_virus	97.6	0.0e+00
WP_021548487.1|2111753_2112284_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
WP_073466862.1|2112276_2113185_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|2113189_2113537_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_073466863.1|2113533_2114169_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.2e-111
WP_001001786.1|2114235_2114688_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917145.1|2114680_2115148_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001300730.1|2115110_2115284_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_047612620.1|2115255_2115681_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	3.2e-67
WP_047612623.1|2115668_2116094_-	hypothetical protein	NA	M1SV74	Escherichia_phage	94.3	2.8e-55
WP_001144101.1|2116108_2116606_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2116605_2116887_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2116890_2117094_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2117093_2117603_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_032252464.1|2117702_2118446_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.2	1.2e-122
WP_073466865.1|2118449_2119523_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	7.4e-201
WP_047090262.1|2119581_2120436_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	90.8	2.1e-142
WP_073466867.1|2120609_2122382_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_073466869.1|2122381_2123416_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	9.3e-201
WP_023140581.1|2123708_2124626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140580.1|2124628_2124913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140578.1|2125379_2126327_-	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	38.0	4.9e-31
WP_001534953.1|2126566_2127124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024261709.1|2127144_2127528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140576.1|2127848_2130128_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.5	0.0e+00
WP_023140575.1|2130117_2130393_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	3.3e-44
WP_001113270.1|2130389_2130614_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277898.1|2130616_2130916_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|2130915_2131140_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2131203_2131704_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|2131873_2132146_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|2132282_2132576_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|2132645_2133626_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|2133812_2134313_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2133743:2133789	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|2134462_2135161_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2135157_2136531_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 5
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	3268138	3289093	4827779	transposase	Escherichia_phage(71.43%)	21	NA	NA
WP_001067858.1|3268138_3268843_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|3269011_3269872_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_012477590.1|3271086_3272007_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.7e-175
WP_001067858.1|3272040_3272745_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000951934.1|3273736_3273928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|3273951_3274179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|3274229_3275366_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|3275332_3275482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3276808_3277513_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065897011.1|3278029_3278941_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|3278972_3280172_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|3280277_3280904_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|3280935_3281172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|3281225_3282062_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3282061_3282865_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043260.1|3282925_3283741_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001067855.1|3284285_3284990_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|3285111_3286017_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|3286013_3287252_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|3287251_3287836_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|3288328_3289093_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 6
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	3462413	3475596	4827779		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3462413_3463175_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3463168_3463795_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3463934_3465074_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3465136_3466129_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001402448.1|3466222_3467587_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|3467675_3468452_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3468456_3469095_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3469091_3470354_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3470350_3471259_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|3471424_3472222_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141314.1|3472272_3472929_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001272924.1|3473034_3475596_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 7
NZ_CP010150	Escherichia coli strain D7 chromosome, complete genome	4827779	4076677	4086118	4827779		Enterobacteria_phage(85.71%)	10	NA	NA
WP_023155600.1|4076677_4077604_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_001471850.1|4077608_4078340_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|4078320_4078428_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4078487_4079219_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4079440_4081126_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4081122_4081842_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4081888_4082359_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4082398_4082860_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|4082984_4084985_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292770.1|4084981_4086118_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
