The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	23344	88833	5414571	transposase,integrase,tRNA	Shigella_phage(15.38%)	36	55910:55924	90600:90614
WP_073488138.1|23344_24886_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_001520155.1|25124_25409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655768.1|25394_25490_+|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	88.5	1.7e-05
WP_000355946.1|26135_26456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073505843.1|26469_36333_-|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	36.9	3.3e-29
WP_073505844.1|36345_38112_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	4.6e-22
WP_000124188.1|38253_38469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488131.1|39063_40620_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	2.0e-162
WP_000878026.1|41096_42116_-|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_001534674.1|42425_43100_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	3.6e-12
WP_073488127.1|43536_51462_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	40.9	2.6e-141
WP_077897287.1|51872_52163_-|transposase	transposase	transposase	Q76S41	Shigella_phage	72.0	1.1e-29
WP_073488125.1|53334_53643_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000502746.1|53894_54533_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.7	4.3e-55
WP_000071967.1|54517_55750_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.7	1.1e-59
55910:55924	attL	TCTGGTTTAGATACT	NA	NA	NA	NA
WP_073488123.1|56591_57377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137530672.1|57576_57792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488119.1|61458_62172_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.6	7.0e-14
WP_073488117.1|62203_63439_-	MFS transporter	NA	NA	NA	NA	NA
WP_073488115.1|63451_64276_-	carbon-phosphorus lyase	NA	NA	NA	NA	NA
WP_073488113.1|64598_66773_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_077897286.1|68379_68562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488111.1|69398_71006_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_073488109.1|71029_72679_+	signal transduction protein	NA	NA	NA	NA	NA
WP_001610771.1|72821_74276_+	MFS transporter	NA	NA	NA	NA	NA
WP_073488105.1|74333_75437_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_001610773.1|75460_76288_+	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	29.2	5.3e-05
WP_001610774.1|76281_77187_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_073488103.1|77179_77608_+	heme-binding protein	NA	NA	NA	NA	NA
WP_024193920.1|77655_78666_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062871408.1|80609_81173_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_073488099.1|82140_83574_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|83792_83990_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_014639577.1|84216_84513_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_047659600.1|85625_87443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279878.1|87630_88833_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
90600:90614	attR	AGTATCTAAACCAGA	NA	NA	NA	NA
>prophage 2
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	1348089	1368993	5414571	plate,integrase	Vibrio_phage(66.67%)	19	1353595:1353609	1376324:1376338
WP_000118770.1|1348089_1349433_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_073488048.1|1349436_1349970_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|1350037_1350523_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|1350636_1351008_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_000533466.1|1351004_1351490_-	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_000245849.1|1351542_1353057_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|1353081_1353627_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
1353595:1353609	attL	AATAAACTTCTGCGC	NA	NA	NA	NA
WP_000144225.1|1353688_1353979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040751.1|1353981_1354545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|1354557_1357191_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_000804010.1|1357523_1358438_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000183810.1|1358424_1359255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276642.1|1359251_1359746_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371477.1|1359761_1361645_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000063810.1|1361641_1362637_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000450225.1|1362647_1363694_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001542642.1|1363696_1363969_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000666530.1|1366452_1367133_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
WP_000279885.1|1368426_1368993_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	45.2	2.2e-34
1376324:1376338	attR	GCGCAGAAGTTTATT	NA	NA	NA	NA
>prophage 3
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	1812893	1870672	5414571	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|1812893_1814246_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|1814339_1814891_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|1815046_1816420_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1816595_1817594_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596016.1|1817626_1818622_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_024251350.1|1818608_1819631_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205810.1|1819644_1821147_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|1821286_1822243_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1822552_1823083_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|1823162_1823513_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|1823506_1823758_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|1823970_1824312_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_073488004.1|1824314_1828094_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|1828090_1829824_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|1830029_1830668_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|1830990_1832334_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1832395_1832602_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175286.1|1832926_1833484_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|1833473_1834214_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589439.1|1834403_1836347_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|1836475_1836856_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001461958.1|1836944_1837805_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|1837912_1838878_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331458.1|1838985_1839648_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228343.1|1839692_1841105_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1841413_1842034_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1842252_1842891_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001367946.1|1843025_1844234_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_000604912.1|1844241_1844673_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_040089790.1|1845295_1846084_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1846154_1846604_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1846645_1846873_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1846877_1847192_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|1847198_1847594_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492911.1|1847920_1848196_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|1848324_1849011_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|1849010_1849865_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|1849874_1850525_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776521.1|1850538_1851003_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|1851012_1851318_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001296880.1|1851333_1852731_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1853085_1854150_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1854257_1855013_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_040089787.1|1855009_1855759_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|1855940_1856270_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1856418_1856694_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|1856810_1858436_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|1858519_1859683_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101649.1|1859685_1860324_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1860333_1860732_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1860749_1861409_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1861459_1862158_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1862176_1862578_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1862703_1863435_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1863614_1866056_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1866094_1866520_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1866724_1868023_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1868126_1868324_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1868405_1869410_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001365141.1|1869412_1870672_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 4
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	2110680	2229980	5414571	tail,capsid,tRNA,transposase,plate,lysis,terminase,portal,protease,head,holin,integrase	Escherichia_phage(46.15%)	118	2170299:2170345	2202712:2202758
WP_000187022.1|2110680_2111781_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|2111820_2112180_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|2112179_2112830_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120810.1|2113160_2114561_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|2114543_2115461_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_000382183.1|2115712_2116996_-	MFS transporter	NA	NA	NA	NA	NA
WP_000690934.1|2117062_2118277_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
WP_001230082.1|2118775_2120149_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|2120209_2120986_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|2120993_2121998_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|2122151_2123303_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005579.1|2123654_2126306_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556301.1|2126488_2128222_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|2128370_2129222_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323849.1|2129208_2129550_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204129.1|2129551_2130430_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_073487977.1|2130395_2132693_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|2132743_2133064_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|2133078_2134158_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174083.1|2134466_2136968_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|2136979_2137642_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_000374004.1|2137652_2138756_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647882.1|2139030_2139648_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001297632.1|2139674_2140580_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001297636.1|2140673_2142854_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|2143182_2144073_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|2144421_2146854_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_073487974.1|2146856_2148017_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|2148293_2148611_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797344.1|2148794_2149403_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000710769.1|2149463_2149676_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_040090268.1|2149878_2152077_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|2152232_2153258_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|2153349_2154309_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|2154401_2154932_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293343.1|2154941_2156273_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|2156339_2157266_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2157358_2157844_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2157928_2158174_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2158598_2159444_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2159466_2160975_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|2161110_2162121_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796320.1|2162217_2162964_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|2162968_2163397_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2163423_2163723_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155254.1|2163934_2164375_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|2164475_2165075_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2165182_2165950_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708994.1|2166004_2166760_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_040090269.1|2166866_2167856_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|2168174_2169137_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2169317_2170220_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2170299:2170345	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2170456_2170675_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_073487971.1|2170756_2171920_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.7	5.4e-205
WP_000978916.1|2171919_2172399_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_073487968.1|2172413_2174861_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000785970.1|2174853_2174973_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031312.1|2175005_2175281_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2175337_2175856_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_073487965.1|2175868_2177059_-|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	97.0	2.9e-222
WP_019841968.1|2177118_2177712_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	7.9e-104
WP_073505857.1|2177742_2178261_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	61.6	1.4e-48
WP_025670940.1|2178260_2178863_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_025670941.1|2178834_2179266_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	5.8e-48
WP_073487956.1|2180466_2181078_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.2e-115
WP_073487953.1|2181079_2181979_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	4.1e-160
WP_000127164.1|2181983_2182331_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_073487950.1|2182327_2182963_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	5.0e-112
WP_001001782.1|2183029_2183482_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_000917182.1|2183474_2183942_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001119512.1|2183904_2184063_-	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
WP_073487947.1|2184049_2184475_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	5.5e-67
WP_073487945.1|2184462_2184888_-	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	91.5	1.9e-59
WP_001144101.1|2184902_2185400_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2185399_2185681_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846407.1|2185684_2185888_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	1.2e-30
WP_000988633.1|2185887_2186397_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001593490.1|2186496_2187240_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.2	3.5e-125
WP_073487942.1|2187243_2188317_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	7.4e-201
WP_001085972.1|2188375_2189230_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_000156847.1|2189403_2191176_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_073487938.1|2191175_2192210_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	7.1e-201
WP_001279022.1|2192641_2194600_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000598783.1|2194641_2195691_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.2	7.4e-105
WP_073487935.1|2195802_2198082_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.1	0.0e+00
WP_000634534.1|2198078_2199086_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.1	6.3e-69
WP_001541416.1|2199082_2199364_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	71.4	3.6e-30
WP_073487932.1|2199360_2199585_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	97.3	3.2e-34
WP_001277897.1|2199584_2199887_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557703.1|2199886_2200111_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217682.1|2200174_2200675_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_000453532.1|2200844_2201117_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_001017511.1|2201252_2201546_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	97.9	3.4e-47
WP_000985249.1|2201615_2202596_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001223800.1|2202781_2203282_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2202712:2202758	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033722.1|2203431_2204130_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2204126_2205500_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2205605_2206280_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2206428_2207412_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2207671_2208292_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_000063504.1|2208576_2209611_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297062.1|2209607_2210546_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217137.1|2210529_2211366_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144052.1|2211653_2213123_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_040090401.1|2213119_2214379_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179764.1|2214620_2215445_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619503.1|2215454_2215769_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000729595.1|2216069_2216516_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446010.1|2216526_2217978_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001019508.1|2217967_2219038_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000931335.1|2219037_2220786_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001348539.1|2220835_2221876_-	YiiG family protein	NA	NA	NA	NA	NA
WP_040090399.1|2222028_2222862_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_011310337.1|2223055_2226106_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331377.1|2226118_2227021_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2227017_2227653_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027708.1|2227649_2228579_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_089567729.1|2228766_2229980_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 5
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	3634064	3641204	5414571		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3634064_3634703_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3634699_3635962_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3635958_3636867_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3637062_3637830_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|3637880_3638537_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_040089848.1|3638642_3641204_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
>prophage 6
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	3759634	3857717	5414571	capsid,tail,tRNA,plate,terminase,portal,protease,head,holin,integrase	Shigella_phage(45.1%)	106	3765174:3765205	3846495:3846526
WP_001343689.1|3759634_3760333_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3760401_3760821_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3761027_3762065_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|3762112_3762802_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|3763106_3763490_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|3763545_3764133_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_024251376.1|3764235_3765117_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
3765174:3765205	attL	ATGCCGGATGCGGCGTGAACGCCTTATCCGGC	NA	NA	NA	NA
WP_000219193.1|3765325_3766660_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_040090074.1|3766791_3767529_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001094499.1|3767513_3769136_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001303621.1|3769391_3769547_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001295364.1|3769543_3770119_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168459.1|3770151_3770802_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812053.1|3770801_3771758_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589070.1|3771754_3772234_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790168.1|3772431_3774231_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|3774246_3775221_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|3775493_3776174_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000020737.1|3776170_3777076_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399393.1|3777087_3777816_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_001297412.1|3777827_3778559_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986029.1|3778558_3778939_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000128776.1|3779358_3779439_+	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000054752.1|3779632_3779893_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_042043893.1|3780107_3781505_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_077897296.1|3781698_3783093_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.1	1.6e-208
WP_001127518.1|3783166_3783964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312942.1|3783976_3784264_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	66.3	4.5e-28
WP_000065111.1|3784263_3784458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488396.1|3784692_3785454_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_073488393.1|3785518_3787582_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.2	1.5e-274
WP_000490740.1|3787638_3787908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042106501.1|3787975_3788614_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	69.3	1.7e-72
WP_000769005.1|3788666_3789215_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_073488391.1|3789230_3790532_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	1.0e-132
WP_073488388.1|3790534_3791437_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000801965.1|3791433_3791583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606440.1|3792230_3792923_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	48.5	3.8e-57
WP_073488382.1|3793036_3793219_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073488379.1|3793211_3795473_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000034494.1|3795790_3796081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001244506.1|3796106_3796529_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174014.1|3796560_3796902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|3797347_3797689_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_073488375.1|3797692_3798169_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001446386.1|3798152_3798545_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	87.7	1.7e-54
WP_073488371.1|3798728_3799079_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.0e-62
WP_000929175.1|3799204_3799699_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_072011717.1|3799932_3801429_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|3801440_3801623_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|3801622_3802864_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193633.1|3802841_3803492_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_073488368.1|3803506_3804712_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	9.1e-224
WP_000601360.1|3804760_3804961_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|3804963_3805287_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|3805283_3805694_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_073488365.1|3805668_3806175_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	2.5e-90
WP_021549522.1|3806171_3806732_+	hypothetical protein	NA	S5FM61	Shigella_phage	99.5	1.4e-105
WP_032225398.1|3806740_3806911_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	3.5e-25
WP_073488362.1|3806894_3808391_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.6	9.8e-276
WP_000090998.1|3808390_3808747_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|3808746_3809016_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_073488359.1|3809157_3810990_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.2	6.7e-303
WP_000679479.1|3811081_3811612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021542892.1|3811673_3813002_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.5	3.8e-247
WP_000999503.1|3812998_3814078_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_001259088.1|3814077_3814626_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424732.1|3814625_3815051_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785299.1|3815037_3816096_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	3.6e-200
WP_000383540.1|3816086_3816671_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_073505851.1|3816674_3817337_+	hypothetical protein	NA	U5P0I1	Shigella_phage	64.9	3.6e-65
WP_073488353.1|3817357_3817801_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	95.2	1.3e-79
WP_073488356.1|3817772_3818189_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	53.9	4.1e-14
WP_143361168.1|3818190_3818607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073488344.1|3818633_3818948_+	recombinase family protein	NA	M1T2R9	Escherichia_phage	92.1	3.3e-40
WP_073488341.1|3818952_3819798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013779.1|3820674_3821523_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190655.1|3821731_3822367_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001295367.1|3822391_3822928_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000734193.1|3822924_3824481_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_040090073.1|3824738_3828626_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	7.7e-131
WP_001297612.1|3829201_3830629_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215861.1|3830793_3831507_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|3831496_3832831_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|3832891_3833230_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|3833274_3834465_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|3834792_3836046_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_001299519.1|3836243_3837437_-	ROK family protein	NA	NA	NA	NA	NA
WP_001351417.1|3837554_3840836_+	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001124889.1|3840932_3841916_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040090070.1|3841938_3843450_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
WP_001276691.1|3843474_3844473_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000700809.1|3844505_3845600_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000158547.1|3845611_3846484_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_001094726.1|3846531_3846954_-	DoxX family protein	NA	NA	NA	NA	NA
3846495:3846526	attR	GCCGGATAAGGCGTTCACGCCGCATCCGGCAT	NA	NA	NA	NA
WP_040090067.1|3847050_3848253_-	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_040090065.1|3848262_3849075_-	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
WP_001080102.1|3849071_3849392_-	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001276076.1|3849391_3849910_-	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_000211172.1|3849906_3851268_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000423257.1|3851403_3852294_+	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000244191.1|3852453_3853593_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000983012.1|3853584_3854865_-	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001299515.1|3855055_3855910_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000553451.1|3856054_3856858_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940019.1|3856976_3857717_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	4281156	4290597	5414571		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|4281156_4282083_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|4282087_4282819_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4282799_4282907_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4282966_4283698_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4283919_4285605_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4285601_4286321_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|4286367_4286838_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|4286877_4287339_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|4287463_4289464_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001349937.1|4289460_4290597_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 8
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	4344644	4355343	5414571	tail,lysis,integrase	Enterobacteria_phage(72.73%)	12	4337348:4337361	4362524:4362537
4337348:4337361	attL	TGGCGATGGCGGCG	NA	NA	NA	NA
WP_073488306.1|4344644_4345718_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.9	1.0e-194
WP_039264506.1|4345695_4345914_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_039264505.1|4346363_4347062_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264504.1|4347192_4347360_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_024215524.1|4347356_4347638_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_024239663.1|4347654_4347969_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_000041317.1|4347980_4348463_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_039264503.1|4349128_4349572_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_039264502.1|4349610_4349985_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264501.1|4350083_4350266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071885001.1|4351408_4354759_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264499.1|4354758_4355343_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
4362524:4362537	attR	TGGCGATGGCGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP010133	Escherichia coli strain C11 chromosome, complete genome	5414571	4855434	4926704	5414571	capsid,tail,transposase,terminase,lysis,portal,head,integrase	Enterobacteria_phage(33.96%)	82	4850724:4850739	4883147:4883162
4850724:4850739	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000041556.1|4855434_4857861_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|4858059_4858365_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4858472_4859183_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4859185_4859746_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4859780_4860122_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4860256_4860583_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4860788_4862003_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836057.1|4862014_4863034_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001360138.1|4863091_4863202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876978.1|4863221_4864502_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|4864536_4864788_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000102147.1|4864860_4867299_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	1.4e-114
WP_001070257.1|4867389_4867581_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854562.1|4867577_4867766_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|4868333_4868552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4868711_4868867_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_040089727.1|4869033_4869441_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|4869524_4869755_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705355.1|4869738_4870260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054512.1|4870240_4871206_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_001151262.1|4871246_4871669_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001374839.1|4871665_4872022_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
WP_001317460.1|4875466_4875799_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_001326990.1|4876001_4876307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|4876331_4876571_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4876570_4876858_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|4876929_4877085_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|4877301_4877553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090315.1|4877619_4877898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|4877899_4878949_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_040090316.1|4878962_4879715_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|4879993_4880083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|4880137_4880350_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4880650_4880866_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4881619_4881835_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|4881839_4882151_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|4882147_4882681_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000066495.1|4883538_4883751_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
4883147:4883162	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_071524604.1|4883761_4883950_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|4883952_4884018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|4884097_4884253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|4884424_4884598_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|4884749_4885160_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|4885217_4885451_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|4885839_4886385_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027295.1|4886359_4888285_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|4888281_4888488_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001345555.1|4888484_4890086_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_073488207.1|4890066_4891386_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	3.7e-234
WP_001358225.1|4891395_4891728_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063254.1|4891783_4892809_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_073488203.1|4892850_4893246_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.3e-58
WP_000785282.1|4893257_4893611_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4893622_4894201_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_073488200.1|4894197_4894593_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001543784.1|4894600_4895341_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479135.1|4895356_4895779_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
WP_000459457.1|4895760_4896195_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840337.1|4896187_4898767_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_000847331.1|4898763_4899093_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152624.1|4899092_4899791_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|4899796_4900540_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4900476_4901109_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_089567729.1|4903841_4905055_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230359.1|4905980_4906580_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_072025145.1|4906644_4909950_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.6e-283
WP_000086527.1|4910221_4910812_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4911128_4911362_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4911430_4911544_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527753.1|4913519_4914980_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000214712.1|4915015_4915219_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|4915396_4916083_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|4916171_4916918_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001299399.1|4917054_4919100_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024561.1|4919144_4919663_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671731.1|4919938_4920331_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592826.1|4920585_4921476_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000901367.1|4921694_4921790_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|4921916_4923104_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087216.1|4923298_4924198_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000577184.1|4924242_4924941_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000998071.1|4925165_4926704_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	8.4e-299
