The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	4185	105026	2206644	holin,capsid,tRNA,head,protease,terminase,portal,tail,integrase,transposase	Streptococcus_phage(93.69%)	123	NA	NA
WP_000163933.1|4185_4755_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000258080.1|4755_8265_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001234978.1|8322_8589_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_000041909.1|8581_8950_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_001224749.1|9069_10338_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001208988.1|10334_11612_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A7K9Y8	Acanthocystis_turfacea_chlorella_virus	24.1	2.5e-06
WP_000892184.1|11615_12158_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.9	2.7e-10
WP_000744557.1|12173_14132_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	45.8	3.2e-109
WP_000588897.1|14253_14733_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000939545.1|21538_21775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205044.1|22005_23292_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.1	2.7e-72
WP_000876726.1|23534_24683_-|integrase	site-specific integrase	integrase	A0A1S5S8M0	Streptococcus_phage	100.0	1.6e-217
WP_073176615.1|24857_25685_-	restriction endonuclease	NA	A0A1S5S8D3	Streptococcus_phage	96.7	1.9e-124
WP_000170933.1|25722_26103_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5S9P5	Streptococcus_phage	100.0	1.5e-68
WP_000285962.1|26115_26379_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	100.0	1.2e-43
WP_000156422.1|26378_26612_-	hypothetical protein	NA	A0A1S5S8D5	Streptococcus_phage	100.0	4.7e-36
WP_000495824.1|26611_26980_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8C4	Streptococcus_phage	100.0	3.2e-63
WP_000842471.1|27285_27768_-	hypothetical protein	NA	A0A1S5S9P0	Streptococcus_phage	100.0	8.4e-80
WP_000032099.1|27822_28026_+	transcriptional regulator	NA	A0A1S5SAW4	Streptococcus_phage	100.0	9.1e-28
WP_001057654.1|28042_28240_+	hypothetical protein	NA	A0A1S5SEL5	Streptococcus_phage	100.0	3.6e-29
WP_001004503.1|28250_28412_+	hypothetical protein	NA	A0A1S5S8H5	Streptococcus_phage	100.0	4.5e-22
WP_000456433.1|28406_28832_-	hypothetical protein	NA	A0A1S5S8M8	Streptococcus_phage	100.0	2.1e-37
WP_061752465.1|28885_29596_+	ORF6C domain-containing protein	NA	A0A1S5S9F1	Streptococcus_phage	98.3	1.2e-130
WP_000370958.1|29608_29866_+	hypothetical protein	NA	A0A1S5SFD5	Streptococcus_phage	100.0	1.2e-43
WP_000462830.1|29951_30272_+	hypothetical protein	NA	A0A1S5SAN6	Streptococcus_phage	100.0	1.9e-48
WP_000391813.1|30287_30584_+	hypothetical protein	NA	A0A1S5SDE3	Streptococcus_phage	100.0	6.2e-49
WP_001289771.1|30576_31383_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SEQ1	Streptococcus_phage	100.0	6.5e-125
WP_000538418.1|31370_31529_+	hypothetical protein	NA	A0A1S5SEV3	Streptococcus_phage	100.0	2.8e-24
WP_050099386.1|31522_32293_+	ATP-binding protein	NA	A0A1S5SF44	Streptococcus_phage	99.6	8.9e-140
WP_050079583.1|32307_32502_+	hypothetical protein	NA	A0A1S5S901	Streptococcus_phage	100.0	1.6e-29
WP_050153794.1|32501_32729_+	hypothetical protein	NA	A0A1S5S904	Streptococcus_phage	100.0	2.3e-40
WP_000233201.1|32781_32946_+	hypothetical protein	NA	A0A141E182	Streptococcus_phage	100.0	1.4e-23
WP_050153793.1|32935_33145_+	hypothetical protein	NA	A0A1S5S965	Streptococcus_phage	100.0	8.5e-29
WP_192929472.1|33116_33446_+	hypothetical protein	NA	E8ZE19	Streptococcus_phage	96.3	1.6e-58
WP_033630928.1|33435_33939_+	DUF1642 domain-containing protein	NA	A0A1S5SFI7	Streptococcus_phage	94.6	9.4e-90
WP_000194861.1|33938_34226_+	hypothetical protein	NA	A0A1S5S9Q8	Streptococcus_phage	100.0	1.7e-48
WP_033630929.1|34225_34687_+	methyltransferase domain-containing protein	NA	A0A1S5S9R6	Streptococcus_phage	99.3	5.6e-89
WP_033630942.1|34967_35453_+	MazG-like family protein	NA	A0A1S5S9S3	Streptococcus_phage	100.0	9.1e-90
WP_033630930.1|35449_35848_+	hypothetical protein	NA	A0A1S5S9X0	Streptococcus_phage	93.5	9.4e-69
WP_000736387.1|35984_36386_+	transcriptional activator	NA	A0A1S5S9L6	Streptococcus_phage	100.0	8.1e-68
WP_000397549.1|36576_37119_+|integrase	site-specific integrase	integrase	A0A1S5SEW4	Streptococcus_phage	100.0	1.4e-99
WP_054388092.1|37283_37475_+	hypothetical protein	NA	A0A1S5S8H4	Streptococcus_phage	95.2	6.6e-28
WP_000282422.1|37594_37915_+	HNH endonuclease	NA	A0A1S5SFJ3	Streptococcus_phage	100.0	2.7e-58
WP_061476800.1|38052_38445_+|terminase	P27 family phage terminase small subunit	terminase	A0A1S5SEN5	Streptococcus_phage	97.7	1.8e-64
WP_061476797.1|38437_40168_+|terminase	terminase large subunit	terminase	A0A1S5S9S5	Streptococcus_phage	99.7	0.0e+00
WP_001002923.1|40175_40394_+	hypothetical protein	NA	A0A1S5SEK2	Streptococcus_phage	100.0	1.3e-32
WP_050218367.1|40411_41614_+|portal	phage portal protein	portal	A0A1S5S8H6	Streptococcus_phage	99.8	2.6e-226
WP_001172115.1|41597_42173_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1S5SEX0	Streptococcus_phage	100.0	2.2e-103
WP_033630932.1|42169_43342_+|capsid	phage major capsid protein	capsid	A0A141E0N4	Streptococcus_phage	100.0	2.5e-202
WP_000120767.1|43353_43644_+	hypothetical protein	NA	A0A1S5S8Q9	Streptococcus_phage	100.0	7.7e-36
WP_000371962.1|43646_43928_+|head,tail	phage head-tail connector protein	head,tail	A0A1S5S8H0	Streptococcus_phage	100.0	1.8e-45
WP_000267061.1|43914_44214_+|head	phage head closure protein	head	A0A1S5S8I2	Streptococcus_phage	100.0	3.7e-49
WP_000063886.1|44210_44558_+	HK97 gp10 family phage protein	NA	A0A1S5SEL8	Streptococcus_phage	100.0	8.8e-47
WP_000777003.1|44554_44878_+	hypothetical protein	NA	A0A1S5SEP5	Streptococcus_phage	100.0	3.5e-53
WP_000191278.1|44889_45468_+	hypothetical protein	NA	A0A1S5S8L9	Streptococcus_phage	100.0	2.6e-107
WP_024478843.1|45479_45899_+	hypothetical protein	NA	A0A1S5S9L8	Streptococcus_phage	99.3	1.9e-72
WP_061749540.1|46175_48935_+	hypothetical protein	NA	A0A1S5SB25	Streptococcus_phage	100.0	1.7e-281
WP_061752457.1|48931_49654_+	hypothetical protein	NA	A0A1S5S9H2	Streptococcus_phage	97.9	2.2e-132
WP_078375700.1|49654_57781_+|tail	tail fiber domain-containing protein	tail	A0A1S5S9I2	Streptococcus_phage	97.9	0.0e+00
WP_001091119.1|57875_58079_+	hypothetical protein	NA	X2KU40	Streptococcus_phage	100.0	1.1e-25
WP_000852244.1|58081_58432_+	hypothetical protein	NA	A0A1S5SFA0	Streptococcus_phage	100.0	3.6e-64
WP_001165344.1|58441_58858_+|holin	phage holin family protein	holin	A0A1S5SCE8	Streptococcus_phage	100.0	1.9e-67
WP_050247604.1|58861_59194_+|holin	phage holin	holin	A0A1S5SF85	Streptococcus_phage	100.0	4.3e-51
WP_073176617.1|59197_60154_+	N-acetylmuramoyl-L-alanine amidase LytA	NA	A0A1S5S8S6	Streptococcus_phage	99.7	3.3e-144
WP_001233269.1|60291_60471_-	hypothetical protein	NA	Q3BLW4	Phage_SK137	96.6	2.1e-23
WP_001030863.1|60612_60762_-	hypothetical protein	NA	C5J952	Streptococcus_phage	95.9	9.1e-17
WP_000291875.1|61043_61511_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_000266837.1|61719_62862_-|integrase	site-specific integrase	integrase	U4KJ82	Streptococcus_phage	99.7	3.4e-212
WP_001020945.1|62980_63331_-	hypothetical protein	NA	Q9MBY8	Streptococcus_phage	100.0	7.3e-57
WP_000136430.1|63344_63725_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SE39	Streptococcus_phage	100.0	4.2e-66
WP_000153672.1|63746_64103_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	100.0	4.2e-60
WP_000638668.1|64378_64564_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	98.4	1.0e-25
WP_073176619.1|64565_65264_+	phage antirepressor KilAC domain-containing protein	NA	A0A1S5SDI0	Streptococcus_phage	99.6	4.9e-129
WP_000046504.1|65328_65595_+	hypothetical protein	NA	A0A1S5SDD2	Streptococcus_phage	100.0	5.9e-43
WP_073176621.1|65939_66206_+	helix-turn-helix domain-containing protein	NA	A0A1S5SBR3	Streptococcus_phage	98.9	3.5e-43
WP_000450966.1|66437_66704_+	hypothetical protein	NA	A0A1S5SE97	Streptococcus_phage	100.0	1.1e-41
WP_001134281.1|66786_67239_+	hypothetical protein	NA	A0A1S5S8P1	Streptococcus_phage	100.0	6.5e-82
WP_000774580.1|67244_67946_+	ERF family protein	NA	A0A1S5SEM6	Streptococcus_phage	100.0	1.5e-117
WP_073176622.1|67948_68941_+	DUF1351 domain-containing protein	NA	A0A1S5SEK4	Streptococcus_phage	99.4	2.8e-178
WP_001203349.1|68962_69139_+	hypothetical protein	NA	A0A1S5SE71	Streptococcus_phage	100.0	4.8e-25
WP_050240764.1|69128_69704_+	single-stranded DNA-binding protein	NA	A0A1S5S8T8	Streptococcus_phage	97.9	8.5e-87
WP_000161128.1|69770_69974_+	hypothetical protein	NA	U4KJ79	Streptococcus_phage	100.0	4.4e-30
WP_050240765.1|70109_70859_+	site-specific DNA-methyltransferase	NA	A0A1S5SFX1	Streptococcus_phage	100.0	3.4e-144
WP_000358622.1|70873_71308_+	hypothetical protein	NA	A0A1S5SG21	Streptococcus_phage	100.0	7.4e-67
WP_050240766.1|71309_72047_+	hypothetical protein	NA	Q0R597	Streptococcus_phage	96.7	6.1e-130
WP_001286809.1|72063_72276_+	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	100.0	1.7e-32
WP_000667209.1|72286_72688_+	hypothetical protein	NA	U4KJA0	Streptococcus_phage	100.0	1.9e-72
WP_000573750.1|72689_72896_+	hypothetical protein	NA	A0A1S5SDU5	Streptococcus_phage	100.0	1.1e-31
WP_192929473.1|72944_73262_+	hypothetical protein	NA	A0A141DZV2	Streptococcus_phage	95.2	2.8e-55
WP_050258448.1|73759_74131_+	hypothetical protein	NA	A0A1S5SFV7	Streptococcus_phage	96.7	1.5e-47
WP_050258447.1|74151_74445_+	hypothetical protein	NA	A0A1S5S8M6	Streptococcus_phage	85.6	4.0e-40
WP_000162611.1|74444_74837_+	hypothetical protein	NA	A0A1S5SED1	Streptococcus_phage	100.0	7.1e-69
WP_000425573.1|74902_75997_+	DUF4417 domain-containing protein	NA	A0A1S5SEG1	Streptococcus_phage	100.0	1.1e-202
WP_073176625.1|75977_76724_+	hypothetical protein	NA	A0A1S5SDN7	Streptococcus_phage	99.6	3.7e-135
WP_001136855.1|76927_77383_+	hypothetical protein	NA	A0A1C9LX59	Streptococcus_phage	100.0	5.0e-74
WP_000143806.1|77372_78683_+|terminase	PBSX family phage terminase large subunit	terminase	U4KJA9	Streptococcus_phage	100.0	1.8e-257
WP_023396076.1|78695_80264_+|portal	phage portal protein	portal	Q0R582	Streptococcus_phage	99.8	4.1e-301
WP_073176627.1|80250_80451_+	hypothetical protein	NA	A0A1S5SEA5	Streptococcus_phage	100.0	8.2e-21
WP_073176629.1|80493_81645_+|capsid	phage minor capsid protein	capsid	Q0R580	Streptococcus_phage	99.7	1.9e-218
WP_000896122.1|81783_82347_+	phage scaffolding protein	NA	A0A1S5SEM4	Streptococcus_phage	100.0	9.9e-80
WP_001139820.1|82364_83246_+	hypothetical protein	NA	A0A1S5SCM2	Streptococcus_phage	100.0	2.1e-161
WP_001240344.1|83256_83490_+	hypothetical protein	NA	A0A1S5SEE1	Streptococcus_phage	100.0	6.8e-35
WP_000221834.1|83532_83925_+	hypothetical protein	NA	A0A1C9LXX3	Streptococcus_phage	100.0	1.2e-63
WP_000565932.1|83914_84286_+|capsid	phage capsid protein	capsid	A0A1S5SDX7	Streptococcus_phage	100.0	8.0e-54
WP_001017357.1|84285_84630_+	hypothetical protein	NA	A0A141DZI7	Streptococcus_phage	100.0	2.9e-58
WP_001208881.1|84629_85037_+|capsid	phage capsid protein	capsid	A0A1S5SEE3	Streptococcus_phage	100.0	3.2e-72
WP_023396079.1|85033_85483_+	hypothetical protein	NA	A0A1S5SEC5	Streptococcus_phage	100.0	8.4e-82
WP_023396080.1|85547_86036_+	hypothetical protein	NA	U4KJ74	Streptococcus_phage	99.4	8.3e-83
WP_078375701.1|86048_86618_+	hypothetical protein	NA	U4KJ63	Streptococcus_phage	99.5	3.2e-102
WP_073176631.1|86610_89913_+	tape measure protein	NA	A0A1S5SDZ2	Streptococcus_phage	95.4	0.0e+00
WP_000161549.1|89909_91424_+|tail	phage tail family protein	tail	A0A1S5SEJ1	Streptococcus_phage	100.0	2.0e-300
WP_073176633.1|91425_95991_+|tail	phage tail protein	tail	A0A1S5SFY2	Streptococcus_phage	99.3	0.0e+00
WP_024475385.1|96001_98080_+	hypothetical protein	NA	A0A141DZH9	Streptococcus_phage	100.0	0.0e+00
WP_000922100.1|98139_98403_+	hypothetical protein	NA	A0A1S5SEN3	Streptococcus_phage	100.0	1.8e-39
WP_000687457.1|98412_98829_+|holin	phage holin family protein	holin	A0A1S5SEC7	Streptococcus_phage	100.0	4.9e-68
WP_050247604.1|98832_99165_+|holin	phage holin	holin	A0A1S5SF85	Streptococcus_phage	100.0	4.3e-51
WP_073176617.1|99168_100125_+	N-acetylmuramoyl-L-alanine amidase LytA	NA	A0A1S5S8S6	Streptococcus_phage	99.7	3.3e-144
WP_000701992.1|100408_100852_+	dUTP diphosphatase	NA	Q2WG49	Clostridium_botulinum_D_phage	47.3	2.1e-29
WP_001836031.1|100853_101369_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_073176637.1|101382_102744_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001809263.1|102816_103314_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000272771.1|103334_103679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088778796.1|103675_105026_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.9	5.9e-62
>prophage 2
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	117641	129097	2206644		Synechococcus_phage(33.33%)	7	NA	NA
WP_050123218.1|117641_119795_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.2	5.5e-46
WP_000801620.1|119807_121157_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000043300.1|121326_122034_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.2	1.8e-41
WP_000361192.1|122235_125961_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.6	2.8e-37
WP_000220627.1|126053_127496_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	2.8e-54
WP_000182575.1|127532_128555_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.9	1.2e-64
WP_000717501.1|128551_129097_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	9.7e-24
>prophage 3
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	180703	204870	2206644	bacteriocin,tRNA	Planktothrix_phage(50.0%)	26	NA	NA
WP_001230166.1|180703_180991_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000724268.1|181042_183151_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000571330.1|183147_183789_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	4.3e-23
WP_001038474.1|183995_184802_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000031929.1|184818_185046_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_000252931.1|185076_185238_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_001268152.1|185423_186287_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000424429.1|186923_187295_+|bacteriocin	SPH_0218 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_001857889.1|187302_187515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001855840.1|188395_189454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001857891.1|189635_190592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424414.1|190968_191343_+|bacteriocin	SPH_0224 family bacteriocin-like peptide	bacteriocin	NA	NA	NA	NA
WP_000619754.1|191550_192453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_180372847.1|192508_192841_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_000072897.1|192837_193566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770312.1|194701_194941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001811652.1|194925_195204_+	hypothetical protein	NA	M1Q0Z8	Streptococcus_phage	50.5	1.9e-20
WP_061696410.1|195489_197379_+	pneumococcal surface protein A	NA	NA	NA	NA	NA
WP_050198263.1|197779_198901_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000193638.1|199041_199497_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000220953.1|199506_201420_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000331980.1|201798_203478_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000639579.1|203479_203713_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_000282479.1|203992_204208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974047.1|204530_204683_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibB	bacteriocin	NA	NA	NA	NA
WP_000180805.1|204684_204870_-|bacteriocin	fratricide two-peptide bacteriocin subunit CibA	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	252066	258790	2206644		Streptococcus_phage(66.67%)	11	NA	NA
WP_000424665.1|252066_252693_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	40.8	2.1e-30
WP_000141100.1|253064_253517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174331.1|253513_253714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003774.1|253715_253931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000058832.1|253927_254269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000492137.1|254261_254543_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	67.8	7.9e-30
WP_000158192.1|254677_255544_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.0	8.2e-126
WP_000434361.1|255596_257066_+	DNA primase family protein	NA	Q9AZI5	Lactococcus_phage	35.2	8.1e-65
WP_000865230.1|257428_257596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000173130.1|257679_258210_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	48.7	2.8e-36
WP_000811078.1|258280_258790_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	53.9	5.8e-47
>prophage 5
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	499130	554049	2206644	bacteriocin,transposase,tRNA	Klosneuvirus(20.0%)	52	NA	NA
WP_001810089.1|499130_499301_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_073176709.1|500062_500320_+	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001838249.1|500445_501885_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000691685.1|501888_503238_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_001063601.1|503426_504275_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_000403162.1|504289_504838_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_057532045.1|504907_505093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656549.1|505203_506886_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	7.7e-19
WP_001148103.1|506870_507701_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000181373.1|507893_508397_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000185828.1|508849_509413_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000678709.1|509426_510053_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000867297.1|510080_510470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333646.1|510474_510924_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000418402.1|511051_511639_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_000105242.1|512028_513636_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.0	8.9e-142
WP_000026645.1|514194_515826_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000795169.1|516118_521098_+	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001096743.1|521187_522384_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000119888.1|522519_523047_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000659547.1|523123_523480_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_001122900.1|523516_524863_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_001808898.1|524952_525072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001220759.1|525637_526918_+	restriction endonuclease subunit S	NA	A0A1V0SKS6	Klosneuvirus	29.2	6.9e-12
WP_000651177.1|526974_527772_+	tyrosine-type DNA invertase PsrA	NA	A0A0H4TI16	Erysipelothrix_phage	28.7	1.3e-21
WP_000240090.1|527782_528391_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	30.1	3.9e-13
WP_050285397.1|528338_529904_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000029055.1|529903_531367_-	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000229101.1|531379_533713_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	27.6	5.8e-25
WP_000550235.1|534392_534830_+	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_000255781.1|534993_536028_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_000046035.1|536054_536579_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034662.1|537058_538882_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.2	1.3e-133
WP_000114422.1|538883_539240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066301.1|539641_540778_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	31.0	1.7e-22
WP_000777760.1|541099_541387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278301.1|541396_541807_-	HIT family protein	NA	B5LJ12	Mycobacterium_phage	31.6	3.4e-05
WP_000889919.1|541874_542606_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.1e-25
WP_073176713.1|542602_543652_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000132572.1|543819_544149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682126.1|544424_544763_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001219143.1|544767_545505_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_073176715.1|545518_546859_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000358814.1|546903_547059_-	quorum-sensing system pheromone BlpC	NA	NA	NA	NA	NA
WP_001069098.1|547115_548477_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_001093268.1|550815_551046_+|bacteriocin	bacteriocin-like peptide BlpU	bacteriocin	NA	NA	NA	NA
WP_000346298.1|551048_551168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727118.1|551464_551629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846944.1|551625_552030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379879.1|553182_553437_+|bacteriocin	two-peptide bacteriocin subunit BlpM	bacteriocin	NA	NA	NA	NA
WP_001099492.1|553452_553656_+|bacteriocin	two-peptide bacteriocin subunit BlpN	bacteriocin	NA	NA	NA	NA
WP_001813641.1|553899_554049_+|bacteriocin	bacteriocin-like peptide BlpO	bacteriocin	NA	NA	NA	NA
>prophage 6
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	915501	925908	2206644	holin	Streptococcus_phage(70.0%)	11	NA	NA
WP_001025704.1|915501_916410_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	3.1e-06
WP_000745389.1|916406_916868_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000403195.1|916857_917745_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.0	1.3e-09
WP_000728255.1|917747_919643_+|holin	phosphorylcholine esterase CbpE	holin	Q332B9	Clostridium_botulinum_C_phage	24.1	1.9e-10
WP_073176995.1|919722_920853_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	58.7	8.5e-115
WP_000254677.1|920862_922125_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	64.5	1.1e-139
WP_073176998.1|922128_922926_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	50.6	1.2e-59
WP_000033362.1|923144_923783_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	68.1	9.8e-76
WP_000806708.1|923779_924670_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	51.4	6.4e-73
WP_000358228.1|924709_925027_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	60.0	2.9e-28
WP_001166873.1|925029_925908_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.7	3.9e-115
>prophage 7
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	1199433	1238311	2206644	holin,transposase,protease	Indivirus(20.0%)	36	NA	NA
WP_000411210.1|1199433_1200303_-|holin	choline kinase LicA	holin	NA	NA	NA	NA
WP_000609894.1|1200319_1201342_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_000638504.1|1201346_1202054_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_044814531.1|1202389_1203877_+	type IV teichoic acid flippase TacF	NA	NA	NA	NA	NA
WP_000811993.1|1203886_1204690_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	32.9	9.0e-10
WP_001199653.1|1204691_1205501_+|holin	phosphorylcholine transferase LicD	holin	A0A1V0SD50	Indivirus	30.3	9.1e-10
WP_001126435.1|1205774_1208951_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_000166701.1|1209263_1210343_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	6.3e-59
WP_001293845.1|1210392_1211316_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	31.7	8.7e-25
WP_000850024.1|1211334_1211856_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_000244451.1|1212066_1212696_-	endonuclease III	NA	NA	NA	NA	NA
WP_023396323.1|1212695_1213238_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000389597.1|1213407_1213725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558897.1|1213963_1215523_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	27.5	9.3e-11
WP_050072400.1|1215566_1216466_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_000219847.1|1216467_1217028_-	LemA family protein	NA	NA	NA	NA	NA
WP_000802934.1|1217121_1217835_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000808288.1|1218235_1219519_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	35.3	4.0e-60
WP_000863628.1|1219713_1221285_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000402071.1|1221296_1221629_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_023396325.1|1221719_1222097_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_001003501.1|1222168_1223473_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.2	1.7e-26
WP_000023518.1|1223485_1224292_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001009001.1|1224334_1225333_+	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068669.1|1225612_1225960_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000237416.1|1226078_1226408_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.8	6.3e-10
WP_000712098.1|1226401_1226776_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000362435.1|1226772_1227039_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001162129.1|1227154_1227598_-	flavodoxin	NA	NA	NA	NA	NA
WP_000401775.1|1227701_1228637_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_001808393.1|1228690_1228975_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001835775.1|1229031_1229520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000199575.1|1231266_1232613_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000436627.1|1232691_1233948_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	91.9	9.5e-224
WP_000711943.1|1234530_1234701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088804224.1|1236960_1238311_+|transposase	IS3-like element ISSpn4 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.6	1.8e-63
>prophage 8
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	1325480	1382163	2206644	holin,bacteriocin,transposase,tRNA	Streptococcus_phage(20.0%)	58	NA	NA
WP_001090150.1|1325480_1326509_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_073177112.1|1327169_1328297_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_000835656.1|1329011_1329563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000058041.1|1329960_1330785_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.5	1.1e-74
WP_000283127.1|1330781_1332242_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.1	9.7e-103
WP_000797183.1|1332357_1332846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107505.1|1332835_1333045_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	49.1	4.1e-07
WP_000773497.1|1333429_1334158_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_073177114.1|1334173_1334965_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.9	1.2e-22
WP_001809119.1|1336373_1336685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169086.1|1336699_1337986_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.6e-40
WP_001262531.1|1338609_1338792_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_078064042.1|1338801_1339167_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000065723.1|1340428_1341991_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	1.4e-19
WP_000936188.1|1342132_1342831_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000071691.1|1342873_1343770_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000872226.1|1343778_1344714_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001102216.1|1344710_1345436_-	CppA family protein	NA	NA	NA	NA	NA
WP_000290644.1|1345519_1346155_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	27.7	9.6e-07
WP_000972851.1|1346156_1346984_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000526286.1|1347005_1347341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000929997.1|1347341_1348058_-	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	31.6	1.1e-27
WP_001272941.1|1348570_1349182_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	4.9e-16
WP_000855735.1|1349226_1349955_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000272310.1|1349993_1350905_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	8.5e-89
WP_000926600.1|1350970_1351195_-	DUF4059 family protein	NA	NA	NA	NA	NA
WP_000590970.1|1351272_1352016_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	4.7e-29
WP_001103449.1|1352015_1352816_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000889093.1|1352973_1353330_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	57.3	1.2e-33
WP_001170347.1|1353323_1353854_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.3	1.4e-46
WP_000405832.1|1353853_1354348_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	52.1	1.9e-42
WP_000858730.1|1354482_1354929_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_001097986.1|1354925_1355573_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000689945.1|1355593_1356175_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_000138517.1|1356175_1357051_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_000036790.1|1357202_1358582_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000175406.1|1358875_1359799_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_000915928.1|1359858_1360464_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.7	2.2e-53
WP_000673698.1|1360482_1361727_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	52.7	4.9e-55
WP_000371288.1|1361842_1362100_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_000164769.1|1362141_1364178_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000038764.1|1364401_1365319_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000369578.1|1365512_1366274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001099672.1|1366546_1367389_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	2.2e-51
WP_001855094.1|1367502_1368894_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001842109.1|1369128_1369506_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_000915911.1|1369738_1370716_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000850572.1|1370712_1371795_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.3	5.2e-37
WP_001040724.1|1373288_1374485_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	29.6	7.3e-32
WP_000348122.1|1375395_1376265_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_000248971.1|1376488_1377166_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_001021431.1|1377123_1378203_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_001842111.1|1378313_1378568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200316.1|1378907_1379441_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001811210.1|1379427_1379643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001811209.1|1379609_1379753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000121703.1|1379986_1381705_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	83.0	4.4e-272
WP_000434644.1|1381815_1382163_+|bacteriocin	PedC/BrcD family bacteriocin maturation disulfide isomerase	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	1417868	1502336	2206644	holin,capsid,tRNA,head,terminase,protease,portal,tail,integrase	Streptococcus_phage(73.91%)	95	1425364:1425396	1506719:1506751
WP_000390781.1|1417868_1418618_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_000689600.1|1418671_1419031_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_151892413.1|1419032_1420394_-	bifunctional Cof-type HAD-IIB family hydrolase/peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	2.6e-25
WP_000068664.1|1420728_1420968_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000609607.1|1420999_1421470_-	single-stranded DNA-binding protein SsbA	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	67.7	2.4e-55
WP_001151785.1|1421481_1421772_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_161801414.1|1421924_1423271_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	6.3e-56
WP_000565216.1|1423427_1423652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777792.1|1423644_1424832_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000747257.1|1424828_1425317_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
1425364:1425396	attL	AATACTCTTCGAAAATCTCTTCAAACCACGTCA	NA	NA	NA	NA
WP_000039647.1|1425637_1426186_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_050198442.1|1426422_1432023_-	YSIRK signal domain/LPXTG anchor domain surface protein	NA	A0A2I2L3G6	Orpheovirus	35.7	1.7e-09
WP_001245190.1|1432238_1433723_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000697775.1|1433773_1434502_-	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	39.0	2.6e-40
WP_000508269.1|1434580_1434745_-	YczI family protein	NA	NA	NA	NA	NA
WP_000822863.1|1434810_1436406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412220.1|1436417_1436828_-	peptide deformylase	NA	A0A2I7R224	Vibrio_phage	32.2	1.3e-09
WP_001277403.1|1436943_1437735_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_000032458.1|1437747_1440444_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.6	8.1e-71
WP_000813916.1|1440747_1441932_+	CDF family manganese efflux transporter MntE	NA	NA	NA	NA	NA
WP_001279133.1|1442074_1443946_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.1	3.0e-56
WP_001138814.1|1443942_1445127_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	45.5	2.0e-37
WP_000027902.1|1445138_1445906_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_000762070.1|1446182_1447031_-	DegV family protein	NA	NA	NA	NA	NA
WP_001050086.1|1447032_1447407_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_000521410.1|1447480_1448833_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000742290.1|1448856_1449636_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_001011058.1|1449622_1450480_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_000081003.1|1450615_1451584_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	100.0	2.8e-66
WP_061367891.1|1451835_1452792_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1S5SCM9	Streptococcus_phage	99.1	1.6e-143
WP_001186228.1|1452795_1453128_-|holin	phage holin	holin	E8ZDJ3	Streptococcus_phage	100.0	3.3e-51
WP_050142252.1|1453131_1453548_-|holin	phage holin family protein	holin	A0A1S5SEC7	Streptococcus_phage	98.6	5.4e-67
WP_000852244.1|1453557_1453908_-	hypothetical protein	NA	A0A1S5SFA0	Streptococcus_phage	100.0	3.6e-64
WP_001091119.1|1453910_1454114_-	hypothetical protein	NA	X2KU40	Streptococcus_phage	100.0	1.1e-25
WP_000068031.1|1462222_1462573_-	hypothetical protein	NA	A0A060QSS8	Streptococcus_phage	100.0	3.1e-63
WP_000212159.1|1462581_1466235_-	hypothetical protein	NA	A0A1S5SBS7	Streptococcus_phage	100.0	0.0e+00
WP_000478016.1|1466221_1466572_-	hypothetical protein	NA	A0A1S5S814	Streptococcus_phage	100.0	1.2e-56
WP_001185634.1|1466610_1466991_-	hypothetical protein	NA	A0A1S5S849	Streptococcus_phage	100.0	1.2e-65
WP_050228844.1|1466995_1467409_-|tail	phage tail protein	tail	A0A060QN80	Streptococcus_phage	100.0	1.2e-71
WP_050228845.1|1467414_1467783_-	hypothetical protein	NA	A0A060QNT4	Streptococcus_phage	100.0	1.2e-65
WP_050228846.1|1467779_1468295_-	HK97 gp10 family phage protein	NA	A0A141E1X2	Streptococcus_phage	95.3	2.4e-88
WP_000478943.1|1468269_1468608_-	hypothetical protein	NA	A0A1S5SCH1	Streptococcus_phage	100.0	8.6e-47
WP_000021220.1|1468588_1468900_-|head,tail	phage head-tail adapter protein	head,tail	A0A1S5SES7	Streptococcus_phage	100.0	2.5e-48
WP_000669349.1|1468901_1469090_-	hypothetical protein	NA	X2L097	Streptococcus_phage	100.0	1.1e-27
WP_000054934.1|1469079_1469262_-	Rho termination factor N-terminal domain-containing protein	NA	X2KSZ5	Streptococcus_phage	100.0	1.2e-23
WP_000123890.1|1469273_1470119_-|capsid	N4-gp56 family major capsid protein	capsid	X2KPH5	Streptococcus_phage	100.0	5.9e-153
WP_001288024.1|1470125_1470710_-	DUF4355 domain-containing protein	NA	X2KU26	Streptococcus_phage	100.0	5.6e-86
WP_000890164.1|1470926_1471178_-	hypothetical protein	NA	A0A1S5SB84	Streptococcus_phage	98.8	4.4e-40
WP_000877356.1|1471179_1471425_-	hypothetical protein	NA	A0A141E0I6	Streptococcus_phage	100.0	1.2e-42
WP_000565275.1|1471467_1471881_-	HD domain-containing protein	NA	A0A060QNR4	Streptococcus_phage	99.3	3.2e-67
WP_000651747.1|1471877_1472087_-	hypothetical protein	NA	A0A141E1P2	Streptococcus_phage	100.0	2.6e-33
WP_179131855.1|1472088_1473726_-|capsid	minor capsid protein	capsid	A0A060QST6	Streptococcus_phage	98.3	3.8e-297
WP_000285389.1|1473634_1475104_-|portal	phage portal protein	portal	A0A1S5SCF7	Streptococcus_phage	100.0	1.2e-278
WP_050168011.1|1475115_1476414_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SBQ5	Streptococcus_phage	99.8	8.0e-258
WP_001841119.1|1476391_1476832_-|terminase	terminase small subunit	terminase	A0A1S5SCD2	Streptococcus_phage	100.0	2.0e-75
WP_050168009.1|1477389_1477809_-	DUF1492 domain-containing protein	NA	A0A126GGN9	Streptococcus_phage	100.0	2.0e-69
WP_050168005.1|1477878_1478250_-	hypothetical protein	NA	A0A126GGP7	Streptococcus_phage	100.0	8.8e-53
WP_073177124.1|1478249_1478567_-	3-dehydroquinate synthase	NA	A0A1S5SDY8	Streptococcus_phage	94.3	1.3e-49
WP_073177126.1|1478563_1478956_-	hypothetical protein	NA	A0A1S5SGC6	Streptococcus_phage	96.1	4.2e-69
WP_073177129.1|1479260_1479932_-	DUF1642 domain-containing protein	NA	U4KJ89	Streptococcus_phage	98.7	2.0e-127
WP_050250933.1|1479933_1480248_-	hypothetical protein	NA	A0A1S5SCT8	Streptococcus_phage	99.0	5.0e-57
WP_000119453.1|1480398_1480737_-	hypothetical protein	NA	A0A1S5SDI1	Streptococcus_phage	100.0	5.6e-62
WP_001277861.1|1480733_1480922_-	hypothetical protein	NA	A0A1S5S928	Streptococcus_phage	100.0	5.5e-27
WP_000194862.1|1480921_1481209_-	hypothetical protein	NA	A0A141E0P3	Streptococcus_phage	100.0	7.8e-49
WP_050202881.1|1481208_1481733_-	DUF1642 domain-containing protein	NA	A0A1S5SE33	Streptococcus_phage	83.3	8.6e-78
WP_050202882.1|1481725_1481914_-	hypothetical protein	NA	A0A1S5S997	Streptococcus_phage	59.7	3.2e-11
WP_000233203.1|1481900_1482068_-	hypothetical protein	NA	A0A1S5SEY3	Streptococcus_phage	100.0	5.0e-24
WP_061753256.1|1482168_1482477_-	VRR-NUC domain-containing protein	NA	A0A2H4JH82	uncultured_Caudovirales_phage	92.2	2.1e-47
WP_180378733.1|1482728_1484279_-	DNA primase family protein	NA	A0A2H4JBQ3	uncultured_Caudovirales_phage	89.7	5.2e-280
WP_061753253.1|1484268_1485066_-	bifunctional DNA primase/polymerase	NA	A0A2H4JBR5	uncultured_Caudovirales_phage	90.5	1.8e-135
WP_061753251.1|1485069_1485552_-	DUF669 domain-containing protein	NA	A0A2H4JER1	uncultured_Caudovirales_phage	95.0	1.2e-78
WP_073177130.1|1485557_1486967_-	DEAD/DEAH box helicase	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	89.6	3.4e-246
WP_061753247.1|1486923_1487625_-	AAA family ATPase	NA	A0A2H4JI15	uncultured_Caudovirales_phage	97.4	3.1e-131
WP_061753245.1|1487621_1488098_-	siphovirus Gp157 family protein	NA	A0A2H4JBT9	uncultured_Caudovirales_phage	81.9	7.6e-65
WP_061753243.1|1488094_1488436_-	hypothetical protein	NA	A0A1S5SA87	Streptococcus_phage	87.6	3.4e-51
WP_050253754.1|1488570_1488762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049512772.1|1488742_1489069_-	hypothetical protein	NA	Q708Q6	Streptococcus_phage	56.5	8.4e-15
WP_049512774.1|1489138_1489411_-	hypothetical protein	NA	A0A1S5SAL2	Streptococcus_phage	96.7	1.1e-41
WP_055348618.1|1489641_1490178_-	hypothetical protein	NA	A0A1S5SDG6	Streptococcus_phage	92.1	1.3e-89
WP_055348619.1|1490211_1490403_-	DNA-binding protein	NA	A0A1S5SA94	Streptococcus_phage	95.2	2.5e-27
WP_073177132.1|1490506_1490596_+	type I addiction module toxin, Fst family	NA	NA	NA	NA	NA
WP_073177133.1|1491011_1491362_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SA75	Streptococcus_phage	79.3	2.0e-46
WP_073177134.1|1491371_1491755_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SAG2	Streptococcus_phage	97.6	1.9e-66
WP_073177135.1|1491770_1492841_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	97.2	1.9e-180
WP_000266847.1|1492963_1494091_+|integrase	site-specific integrase	integrase	A0A1S5SEM0	Streptococcus_phage	100.0	4.5e-209
WP_000011306.1|1494178_1495090_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	99.7	1.5e-154
WP_001231086.1|1495086_1496064_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	100.0	1.2e-184
WP_000163033.1|1496060_1496951_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.9e-06
WP_001140412.1|1497002_1497383_-	RidA family protein	NA	NA	NA	NA	NA
WP_151892414.1|1497393_1497981_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_025170719.1|1497989_1499222_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	3.8e-132
WP_000442258.1|1499258_1499429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162447.1|1499428_1499935_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	43.8	7.9e-28
WP_001864315.1|1500064_1500583_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_073177137.1|1500821_1502336_-|holin	choline binding-anchored murein hydrolase LytC	holin	NA	NA	NA	NA
1506719:1506751	attR	TGACGTGGTTTGAAGAGATTTTCGAAGAGTATT	NA	NA	NA	NA
>prophage 10
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	1800103	1807435	2206644		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_000167835.1|1800103_1800805_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	35.1	2.3e-33
WP_001108391.1|1800820_1800931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000777246.1|1801227_1802187_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.8	4.0e-57
WP_001193668.1|1802176_1803133_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000764306.1|1803129_1803882_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	5.6e-14
WP_073177313.1|1803977_1804943_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000821640.1|1805167_1805410_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.4	1.3e-17
WP_001222228.1|1805409_1806132_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000105310.1|1806118_1806688_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.9	5.0e-15
WP_000351907.1|1806706_1807435_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	22.3	5.3e-09
>prophage 11
NZ_CP018136	Streptococcus pneumoniae strain SP49 chromosome, complete genome	2206644	2184799	2193553	2206644		Bacillus_phage(33.33%)	9	NA	NA
WP_000510408.1|2184799_2185639_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	32.6	1.5e-15
WP_000835715.1|2185623_2186451_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	33.3	3.5e-17
WP_000712132.1|2186447_2186993_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001227958.1|2187003_2187825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000170189.1|2187866_2189150_-	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	30.0	8.4e-18
WP_000424271.1|2189146_2190397_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	42.3	2.7e-93
WP_000455903.1|2190555_2190924_+	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	57.3	7.0e-18
WP_000266660.1|2190926_2192024_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000073428.1|2192074_2193553_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	2.2e-94
