The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	852277	862213	4783504	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_073348935.1|852277_853024_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
WP_011704775.1|853028_853646_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_016349540.1|853642_854224_+	DedA family protein	NA	NA	NA	NA	NA
WP_083557431.1|854234_855275_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	34.7	3.1e-10
WP_011704778.1|855322_856306_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_024946180.1|856390_857404_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_005309452.1|857583_857799_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016349543.1|857814_858258_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_073348936.1|858346_860134_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
WP_073348937.1|860347_862213_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 2
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	1917184	1946086	4783504	plate,protease	Cronobacter_phage(12.5%)	21	NA	NA
WP_005299981.1|1917184_1917616_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073349870.1|1917619_1919386_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_029303268.1|1919349_1920348_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049048591.1|1920404_1921655_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011705718.1|1921654_1922170_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017411064.1|1922172_1923507_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_162275666.1|1923529_1924309_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073349873.1|1924329_1926972_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.4e-91
WP_073349875.1|1926974_1928513_+	sigma-54-dependent transcriptional regulator VasH	NA	NA	NA	NA	NA
WP_049048597.1|1928512_1929118_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_073349877.1|1929126_1930572_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_073349879.1|1930613_1934099_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_073349881.1|1934145_1935576_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017411057.1|1935833_1936121_+	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
WP_073349883.1|1936131_1938177_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.9	1.3e-33
WP_073349885.1|1938186_1940499_+	glucosaminidase domain-containing protein	NA	A7J2B5	Streptococcus_phage	38.0	2.3e-13
WP_123785013.1|1940495_1940846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349886.1|1942038_1942902_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	3.0e-27
WP_005300025.1|1943009_1943228_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005300028.1|1943456_1943774_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
WP_049048605.1|1943833_1946086_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	2.0e-168
>prophage 3
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	1961142	2024679	4783504	terminase,tRNA,integrase,portal,tail,protease	Aeromonas_phage(20.69%)	72	1982517:1982533	1999323:1999339
WP_017409658.1|1961142_1961901_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_073349894.1|1962055_1962841_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.0	1.4e-15
WP_005300065.1|1962896_1963895_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.2	4.7e-08
WP_073349896.1|1964022_1964916_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011705751.1|1964951_1965911_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_162275818.1|1965913_1967509_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_044799825.1|1967599_1968634_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_011705754.1|1968830_1969511_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_005300084.1|1969514_1969751_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_029301161.1|1969747_1970152_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_162275668.1|1970283_1971690_+	YcjX family protein	NA	NA	NA	NA	NA
WP_073349902.1|1971756_1972788_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_073349904.1|1972959_1973754_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_005300093.1|1973808_1974147_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016350472.1|1974523_1976071_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_017409649.1|1976236_1976818_+	YfiR family protein	NA	NA	NA	NA	NA
WP_073349908.1|1976814_1978083_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_029303240.1|1978085_1978574_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016350476.1|1978631_1979366_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	52.5	1.1e-46
WP_073349910.1|1979484_1980600_+	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
WP_011705767.1|1980710_1980989_+	YfcL family protein	NA	NA	NA	NA	NA
WP_073349912.1|1981086_1982751_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	26.7	1.5e-43
1982517:1982533	attL	GAGGGGGGATCGCAATC	NA	NA	NA	NA
WP_073349914.1|1982835_1983717_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_011705770.1|1983904_1984591_-	LrgB family protein	NA	NA	NA	NA	NA
WP_024944025.1|1984587_1984944_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_073349916.1|1985103_1986813_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_039214596.1|1986885_1987392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073349918.1|1987547_1988975_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_162275669.1|1989155_1990349_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P7J2	Enterobacteria_phage	45.8	2.3e-86
WP_073349922.1|1990498_1990915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073349924.1|1992602_1993139_-	hypothetical protein	NA	J9Q748	Salmonella_phage	35.9	7.1e-27
WP_073349926.1|1993359_1993911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073349928.1|1993907_1994255_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	61.4	4.0e-23
WP_073349930.1|1994432_1995353_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_073349932.1|1995463_1996228_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_123785014.1|1996224_1996770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073349935.1|1996799_1997474_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.1	1.7e-38
WP_073349937.1|1997585_1997792_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	57.4	6.2e-16
WP_083557439.1|1997833_1998325_+	phage regulatory CII family protein	NA	NA	NA	NA	NA
WP_073352417.1|1998402_1998606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349941.1|1998595_1998862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349943.1|1998854_1999919_+	hypothetical protein	NA	A0A1I9KG10	Aeromonas_phage	47.8	3.2e-31
1999323:1999339	attR	GAGGGGGGATCGCAATC	NA	NA	NA	NA
WP_073349945.1|1999896_2000382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050498211.1|2000381_2000663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349947.1|2000739_2001450_+	phage regulatory protein/antirepressor Ant	NA	A0A1I9KFA9	Aeromonas_phage	57.3	1.3e-60
WP_005324004.1|2001446_2001644_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_073349949.1|2001658_2002633_+	DUF968 domain-containing protein	NA	R9TRM9	Vibrio_phage	34.9	8.1e-29
WP_050498212.1|2002643_2003006_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1J0GV15	Halomonas_phage	46.6	1.4e-18
WP_042047485.1|2003115_2003622_+	antitermination protein	NA	NA	NA	NA	NA
WP_073349951.1|2003815_2004022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349953.1|2004024_2004516_+	lysozyme	NA	A0A193GZ38	Enterobacter_phage	38.5	3.3e-15
WP_073349955.1|2004515_2005055_+	DUF2514 family protein	NA	A0A059VF51	Pseudomonas_phage	33.3	8.2e-07
WP_081805673.1|2005237_2005717_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	56.1	6.9e-42
WP_073352421.1|2005787_2007635_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	57.1	3.1e-191
WP_041211165.1|2007631_2007841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041211166.1|2007837_2009400_+|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	51.2	1.5e-138
WP_073352419.1|2009353_2011417_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	53.4	3.4e-194
WP_073349956.1|2011473_2011788_+	DUF2190 family protein	NA	A0A088C4T4	Shewanella_sp._phage	50.0	9.0e-06
WP_073349959.1|2011787_2012084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349961.1|2012091_2012694_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	38.1	1.5e-20
WP_153810814.1|2012728_2012896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349963.1|2012928_2013351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349965.1|2013343_2013814_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	44.2	6.2e-27
WP_123785016.1|2013813_2014245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073349969.1|2014265_2014586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123785017.1|2014563_2016693_+	hypothetical protein	NA	A0A2I7S649	Vibrio_phage	33.0	3.4e-32
WP_073349973.1|2016692_2017295_+	hypothetical protein	NA	A0A2P1CKS5	Pantoea_phage	39.3	6.5e-29
WP_073349975.1|2017291_2017876_+	hypothetical protein	NA	A0A0A0RP51	Escherichia_phage	49.5	2.5e-46
WP_073349977.1|2017878_2018277_+	hypothetical protein	NA	Q7Y3Z5	Yersinia_phage	53.8	1.1e-35
WP_083557443.1|2018276_2022635_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	49.3	7.4e-191
WP_083557444.1|2022720_2024274_+	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	64.1	3.3e-186
WP_043162866.1|2024334_2024679_+	diversity-generating retroelement protein Avd	NA	A0A1I9KFC4	Aeromonas_phage	99.1	4.2e-57
>prophage 4
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	2333120	2397146	4783504	integrase,transposase,protease	Trichoplusia_ni_ascovirus(25.0%)	60	2352904:2352919	2397256:2397271
WP_073350232.1|2333120_2335100_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_153810815.1|2335240_2335402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073350237.1|2335427_2335823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073350239.1|2335851_2336214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350241.1|2336444_2337473_-	hypothetical protein	NA	B1NI81	Stenotrophomonas_phage	29.3	7.7e-14
WP_073350243.1|2337506_2337773_-	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_073350245.1|2337774_2338893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153810816.1|2338998_2339157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350247.1|2339369_2339642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350249.1|2339657_2341295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083557447.1|2341802_2342615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350253.1|2343343_2344621_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_073350255.1|2344899_2345214_-	YebG family protein	NA	NA	NA	NA	NA
WP_060389423.1|2345387_2346284_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_073350259.1|2346332_2348303_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.3	1.9e-05
WP_073350261.1|2348551_2349133_+	phasin family protein	NA	NA	NA	NA	NA
WP_073350262.1|2349221_2350406_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_073350264.1|2350407_2351058_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073350266.1|2351100_2351901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073350268.1|2352016_2353450_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
2352904:2352919	attL	GGCGACTGCCCTGCTG	NA	NA	NA	NA
WP_073350270.1|2353732_2354110_-	polyhydroxyalkanoic acid system family protein	NA	NA	NA	NA	NA
WP_073350272.1|2354309_2355053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073350274.1|2355137_2356583_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_073350276.1|2356712_2357840_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_024945212.1|2357851_2358739_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_016350706.1|2358887_2359520_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016350707.1|2359497_2360106_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_073350278.1|2360183_2362736_+	MCE family protein	NA	NA	NA	NA	NA
WP_162275686.1|2362866_2364294_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_073350282.1|2364514_2364784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162275822.1|2364967_2365957_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011706112.1|2366296_2367076_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_073350286.1|2367097_2368045_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_073350288.1|2368029_2368671_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	41.3	2.6e-28
WP_016350715.1|2368670_2369672_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_073350290.1|2369661_2370516_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_073350292.1|2370535_2371777_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_005300909.1|2371859_2372096_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	47.1	1.7e-09
WP_005300916.1|2372253_2372988_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	1.4e-17
WP_024944762.1|2373001_2373937_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_073350294.1|2374006_2374966_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_029303012.1|2374973_2375993_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_005300935.1|2376002_2376170_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011706102.1|2376189_2376711_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_073350296.1|2376959_2377625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073350297.1|2377694_2378669_-	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_073350299.1|2378671_2379865_-	MdtL family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_162275687.1|2380048_2380630_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_073350303.1|2380707_2381355_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_073350305.1|2381354_2382338_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_073350307.1|2382710_2385842_+	ribonuclease E	NA	NA	NA	NA	NA
WP_001214976.1|2388125_2388533_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|2388670_2389555_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|2389586_2390786_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|2390891_2391542_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|2391573_2391816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|2391873_2394840_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|2394843_2395404_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|2395579_2395930_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|2396132_2397146_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2397256:2397271	attR	CAGCAGGGCAGTCGCC	NA	NA	NA	NA
>prophage 5
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	2401863	2453668	4783504	tRNA,integrase,transposase	Escherichia_phage(33.33%)	51	2421356:2421415	2432954:2433076
WP_073352450.1|2401863_2403336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_073350311.1|2403913_2404579_+	type B chloramphenicol O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.4	1.2e-23
WP_083557448.1|2404666_2405851_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000376623.1|2406360_2406861_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000287615.1|2407039_2408584_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000080861.1|2410368_2411505_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|2411555_2411783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|2411806_2411998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|2412479_2413022_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|2413034_2413895_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|2414127_2414832_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|2415106_2416120_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|2416264_2416762_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|2416873_2417164_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|2417169_2417961_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|2418124_2418472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|2418465_2419305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|2419432_2419636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|2419791_2420997_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|2421007_2421313_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
2421356:2421415	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001389365.1|2421539_2422304_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|2422796_2423381_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|2423380_2424619_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|2424615_2425521_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|2425642_2426347_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073350313.1|2426964_2427864_-	VEB family class A extended-spectrum beta-lactamase	NA	NA	NA	NA	NA
WP_073350315.1|2427974_2428385_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000004159.1|2428590_2429829_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|2429825_2430731_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|2430852_2431557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001300294.1|2432946_2433615_-	EAL domain-containing protein	NA	NA	NA	NA	NA
2432954:2433076	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGTTTGGTCACGGGCATCA	NA	NA	NA	NA
WP_000993386.1|2433650_2433887_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2433883_2434246_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2434263_2435958_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2436009_2436432_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|2436467_2436743_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2436756_2437107_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2437178_2437613_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_073350319.1|2437969_2439439_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_011706092.1|2439846_2440428_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.8	1.4e-28
WP_011706091.1|2440491_2441136_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.5	1.4e-32
WP_073350321.1|2441245_2442328_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_073350323.1|2442514_2444548_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_073350325.1|2444766_2445402_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005300975.1|2445487_2445760_-	acylphosphatase	NA	NA	NA	NA	NA
WP_073350327.1|2445845_2447276_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.4	1.4e-26
WP_101617324.1|2447381_2448575_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_073350330.1|2449059_2449704_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_073350332.1|2449964_2451149_+	acyltransferase	NA	NA	NA	NA	NA
WP_073350334.1|2451533_2452571_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_073350336.1|2452567_2453668_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	3238386	3248287	4783504		Escherichia_phage(37.5%)	11	NA	NA
WP_073352524.1|3238386_3239490_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.5	3.0e-40
WP_073350964.1|3239509_3240220_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	28.3	4.8e-15
WP_073350965.1|3240212_3240731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_073350967.1|3240717_3241125_-	FdtA/QdtA family cupin domain-containing protein	NA	NA	NA	NA	NA
WP_073350970.1|3241133_3241676_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.6	2.7e-50
WP_073350972.1|3241738_3242617_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	2.1e-105
WP_073350974.1|3242729_3243617_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	9.0e-27
WP_073350976.1|3243616_3244702_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.9	1.7e-96
WP_073350977.1|3244701_3245967_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	NA	NA	NA	NA
WP_073350978.1|3246022_3247147_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.8	2.3e-27
WP_073350980.1|3247210_3248287_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.9	6.9e-98
>prophage 7
NZ_CP018201	Aeromonas hydrophila strain MX16A chromosome, complete genome	4783504	3727482	3734976	4783504	protease	Staphylococcus_phage(50.0%)	8	NA	NA
WP_016351731.1|3727482_3727953_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
WP_073351380.1|3728150_3729347_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.5	3.9e-09
WP_073351382.1|3729410_3730520_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	6.1e-65
WP_073351383.1|3730661_3731315_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	1.6e-20
WP_073351385.1|3731369_3732479_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	2.1e-49
WP_010675395.1|3732575_3733025_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_073351387.1|3733159_3733639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707102.1|3733722_3734976_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
