The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	146236	206158	2933966	portal,transposase,terminase,tRNA,head	Enterococcus_phage(28.57%)	58	NA	NA
WP_002287154.1|146236_146752_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002287155.1|147068_148454_+	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002287156.1|148490_149168_+	YutD family protein	NA	NA	NA	NA	NA
WP_002287159.1|149175_149940_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002287161.1|149941_150601_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287163.1|150630_151140_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002287165.1|151251_152250_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002297404.1|152574_153825_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287167.1|154233_154818_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002296072.1|154894_156070_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287231.1|156151_156532_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287172.1|156605_156968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296623.1|157128_158424_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_086956687.1|164652_165815_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287966.1|166023_166398_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287965.1|166511_167141_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294080.1|168230_169559_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|169760_170594_+	phosphotransferase	NA	NA	NA	NA	NA
WP_002287962.1|170609_171347_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|171501_172470_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|172701_173535_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|173568_174408_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|174433_174994_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|175192_176914_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|177078_178221_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287955.1|178236_179448_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|180020_180668_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|181060_183706_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|184015_185329_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|185318_185972_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304462.1|186026_186698_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002303263.1|186592_187945_-	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002303264.1|188010_189300_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303265.1|189386_190091_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303266.1|190290_190557_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002304464.1|190724_190955_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002299038.1|191026_191182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304466.1|191490_191730_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	1.8e-27
WP_002303273.1|191981_192317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303275.1|192549_193491_+	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303277.1|193492_194383_+	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303278.1|194425_195226_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002299339.1|195240_196092_+	AAA family ATPase	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_002317474.1|196088_196406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305847.1|196398_196581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303279.1|196582_197053_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	33.8	9.6e-12
WP_002303280.1|197049_197592_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	40.7	3.9e-17
WP_002303281.1|197588_197972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303282.1|197968_198199_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	52.1	1.6e-12
WP_002303283.1|198205_198409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303285.1|198405_198702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303286.1|198778_199192_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	5.6e-56
WP_002303288.1|199204_199591_+	hypothetical protein	NA	O34053	Streptococcus_phage	53.5	1.6e-28
WP_002303289.1|200540_200801_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	51.1	7.9e-16
WP_002303291.1|201405_202239_+|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	68.8	1.5e-79
WP_002298064.1|202231_203647_+	hypothetical protein	NA	C9E2I7	Enterococcus_phage	79.7	1.0e-218
WP_002303292.1|203658_205188_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.3e-28
WP_002298060.1|205279_206158_+|head	phage head morphogenesis protein	head	NA	NA	NA	NA
>prophage 2
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	209861	269473	2933966	transposase,tRNA,tail,holin,plate	Lactococcus_phage(21.43%)	59	NA	NA
WP_002303295.1|209861_210470_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002303297.1|210469_210811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305859.1|211052_213842_+	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303299.1|213831_214572_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002347081.1|214568_217331_+	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002347082.1|217343_218252_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303306.1|218251_218872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319918.1|218875_219325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347378.1|219324_219819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332774.1|219832_220180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302750.1|220172_220313_+	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.8	1.1e-08
WP_002349260.1|220412_220802_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	69.7	9.0e-40
WP_002302753.1|220798_221809_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.8e-61
WP_002302755.1|221923_223132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025477679.1|224126_224429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347085.1|224407_224815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|224801_225254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347086.1|225246_225645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294067.1|226720_226921_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|227174_228854_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|228855_229068_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|229460_231191_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|231187_232948_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|233042_233240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|233392_233878_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|233981_234575_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|234754_235282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|235372_236110_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|236113_237031_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|237032_238262_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|238295_239249_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|239899_241513_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_002296511.1|241653_242562_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|242744_243869_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287756.1|243893_244073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287755.1|244095_245013_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002302991.1|245005_245839_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|245921_247040_+	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_073119935.1|247033_248932_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|248925_250149_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002287747.1|250234_252169_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|252394_253051_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|253124_253478_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|253669_254599_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|254609_255446_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287742.1|255693_256470_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287741.1|256645_257389_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|257381_258962_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|259212_259692_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002289867.1|259707_260460_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002290883.1|261012_261738_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002290885.1|261991_262258_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002290886.1|262254_262686_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002295049.1|262711_263014_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002302985.1|263203_264040_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002295053.1|264103_264535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302984.1|264596_265919_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002302982.1|266072_267713_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_000202380.1|268153_269473_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
>prophage 3
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	451847	564458	2933966	transposase,tRNA	Streptococcus_phage(42.86%)	100	NA	NA
WP_002303202.1|451847_453395_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002297185.1|453659_454955_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002305661.1|455122_456169_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	63.1	1.8e-122
WP_002323224.1|456248_457262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305663.1|457298_458243_+	GDP-L-fucose synthase	NA	A0A1D8KU05	Synechococcus_phage	53.4	1.5e-93
WP_002305664.1|458310_459624_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	26.9	2.6e-38
WP_002323227.1|459707_460610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305666.1|460614_462267_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	40.5	2.6e-104
WP_002305667.1|462290_463157_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002350942.1|463198_463390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073119958.1|463419_463932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|463962_465264_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002305669.1|465587_465941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349152.1|466883_467078_+	hypothetical protein	NA	M1PSF2	Streptococcus_phage	72.0	1.1e-14
WP_002305671.1|467382_467541_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_002325884.1|467795_468749_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305672.1|468911_469862_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|470577_470853_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002305673.1|470959_471724_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289559.1|471846_472350_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002305674.1|472757_473405_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002305675.1|473567_474836_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.4e-41
WP_002323866.1|474862_476062_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002305677.1|476180_477488_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002288760.1|477958_479077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323868.1|479377_479698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|480149_480350_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002305678.1|480496_483286_+	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	31.0	2.1e-90
WP_002321579.1|483332_483860_+	peptidase	NA	NA	NA	NA	NA
WP_002305679.1|483880_485071_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002305681.1|485110_486409_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002305683.1|487203_487878_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002323072.1|487874_488216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|488245_488605_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002305684.1|489128_491213_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	9.9e-117
WP_002288779.1|491523_492990_+	amino acid permease	NA	NA	NA	NA	NA
WP_002349135.1|493299_493773_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	28.8	1.1e-10
WP_002294855.1|493846_494287_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|494299_494509_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002349136.1|494508_496695_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.7	1.4e-121
WP_002323053.1|496714_498886_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	2.9e-71
WP_002305688.1|498997_501169_-	transglutaminase	NA	NA	NA	NA	NA
WP_002323055.1|501158_502232_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010721082.1|502245_503094_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002323057.1|503447_504737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|504810_505380_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_094932120.1|505753_506916_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
WP_042959742.1|506996_507572_+	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	35.9	4.8e-13
WP_086953915.1|507641_508980_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_008266934.1|509259_509673_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002305694.1|509904_510162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|510447_511698_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|512107_513082_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002322761.1|513811_514129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|514332_514698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305696.1|514905_515388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|515584_516475_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002305697.1|516799_519271_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	29.2	3.1e-45
WP_002297195.1|519373_521110_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|521106_521811_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|521941_522445_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|522404_522743_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|522763_524182_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|524293_524872_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|524875_525397_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|525475_526030_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|526282_526558_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|526569_526821_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|526945_527737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|527906_528428_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|528417_529179_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|529314_529662_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002286921.1|530034_530697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305699.1|530775_534003_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286925.1|534116_534431_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|534443_534818_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002305701.1|534818_535172_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002349191.1|535242_536595_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.4	3.8e-162
WP_002286932.1|536654_537797_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|537821_538076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|538331_539516_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|539512_539650_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|540395_542306_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|542409_542634_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|542646_543147_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|543243_545091_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002305705.1|545093_545990_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|546039_546429_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002298631.1|548662_550489_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002296840.1|551533_552721_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002305708.1|553021_555151_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	1.8e-182
WP_002289057.1|555147_556155_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|556171_557083_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|557210_557939_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|557935_559345_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002305709.1|559672_560794_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|561213_561450_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002302055.1|561402_562356_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|562694_563204_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956705.1|563296_564458_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
>prophage 4
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	577803	633528	2933966	integrase,transposase,tRNA	Streptococcus_phage(33.33%)	52	571978:571993	589771:589786
571978:571993	attL	AATGTAATAGGTGATT	NA	NA	NA	NA
WP_086956687.1|577803_578965_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002285758.1|579096_579291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|579280_579634_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002299190.1|579735_581283_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002288962.1|581434_581863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|581849_582092_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|582391_582607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|582713_583028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|583131_584310_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|584712_585006_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002302440.1|585102_586404_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002305732.1|587349_589677_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_080490133.1|592789_593962_+	class C sortase	NA	NA	NA	NA	NA
589771:589786	attR	AATCACCTATTACATT	NA	NA	NA	NA
WP_002288983.1|594123_594618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321037.1|594614_594809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|595203_595626_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|595791_596985_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|597208_597586_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|597573_597912_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|598045_598489_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|598750_599566_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002300930.1|599575_600238_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002289620.1|600442_602107_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|602119_602830_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|602959_603457_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|603641_603902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|604263_604503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|604839_606018_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|606134_606449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302293.1|607592_607895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|608213_609509_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288592.1|610173_610947_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|611090_611441_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|611421_612138_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|612137_613586_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|613655_614165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|614154_614880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|615107_616403_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002303943.1|616624_618745_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002288581.1|618974_620153_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002305727.1|620168_620927_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|620949_621435_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|621505_622759_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|622875_624225_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|624336_625683_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|625990_626377_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002326704.1|626425_627334_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311774.1|627546_628506_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002297633.1|629369_629582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|629859_631659_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|631782_632379_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002301399.1|632568_633528_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 5
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	641990	704666	2933966	protease,transposase,tRNA	Streptococcus_phage(28.57%)	57	NA	NA
WP_002296623.1|641990_643286_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296121.1|643495_644014_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|644090_645047_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|645212_646019_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293904.1|646015_647005_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002301321.1|647001_648006_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|648137_648680_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002289885.1|648699_649398_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002293902.1|649418_649631_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|649630_650593_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|650610_651006_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|651168_651534_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_010729586.1|651530_653342_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|653403_653571_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|653818_654808_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|654819_656304_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|656327_657308_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288447.1|657396_658221_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|658204_658747_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|658753_659218_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002301319.1|659214_660231_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288442.1|660839_661541_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202380.1|661828_663148_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002288439.1|663685_664915_+	arginine deiminase	NA	NA	NA	NA	NA
WP_002288437.1|665005_666025_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288434.1|666139_667087_+	carbamate kinase	NA	NA	NA	NA	NA
WP_002302440.1|667237_668539_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002288432.1|669007_670699_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288430.1|671152_671698_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002326699.1|671701_671830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326698.1|671822_672914_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293881.1|673130_673610_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293880.1|673968_674751_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293878.1|674849_675731_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293877.1|675866_676589_+	UMP kinase	NA	NA	NA	NA	NA
WP_002293875.1|676591_677149_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010729587.1|677467_678718_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	62.1	6.8e-113
WP_002294134.1|679126_679939_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002294135.1|679935_680736_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_080490134.1|680896_682165_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294137.1|682232_683942_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002288497.1|684153_688512_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	40.8	1.9e-21
WP_002288499.1|688656_689130_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002288500.1|689152_690328_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288501.1|690349_690643_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002288509.1|690639_690951_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002288511.1|690963_693270_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002288513.1|693296_693644_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002297218.1|693838_695134_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288514.1|695404_695578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288520.1|698755_699679_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002288521.1|699682_700624_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288522.1|700975_701761_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288523.1|701773_702625_+	sugar transporter	NA	NA	NA	NA	NA
WP_002296526.1|702748_703201_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294467.1|703665_704034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294466.1|704183_704666_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	874263	892179	2933966	integrase,protease,transposase	Bacillus_phage(16.67%)	19	866175:866193	898911:898929
866175:866193	attL	TAGTGGAGAATATTTGTTA	NA	NA	NA	NA
WP_002353651.1|874263_875406_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	2.0e-39
WP_002288357.1|875625_876753_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|876809_877763_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|877918_879097_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321532.1|879342_879633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|879750_880011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|880147_880561_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|881016_881502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|881640_881856_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|882079_882880_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002353507.1|882898_884767_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|884759_885251_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|885238_885793_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|885810_886806_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|886947_888198_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|888606_889005_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311093.1|888988_889684_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296627.1|890267_891155_-	rotamase	NA	NA	NA	NA	NA
WP_002296628.1|891339_892179_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
898911:898929	attR	TAGTGGAGAATATTTGTTA	NA	NA	NA	NA
>prophage 7
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	1246344	1255405	2933966		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1246344_1246923_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002321731.1|1246919_1247963_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1247994_1249434_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1249418_1251641_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1251641_1252313_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1252314_1252569_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1252568_1253297_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1253552_1253930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1254109_1255405_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 8
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	1493897	1531552	2933966	protease,transposase	Streptococcus_phage(27.27%)	34	NA	NA
WP_002287598.1|1493897_1496132_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|1496279_1496600_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002302440.1|1496713_1498015_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287661.1|1498305_1498530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295394.1|1498727_1500308_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1500708_1502085_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1502212_1503331_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002290819.1|1503472_1503907_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002290817.1|1503984_1504518_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|1504611_1505790_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|1505782_1506580_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|1506686_1508069_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|1508242_1508821_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002296956.1|1509142_1509613_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|1509720_1510947_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297218.1|1511769_1513065_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292860.1|1513222_1513423_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|1513556_1514165_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|1514249_1514720_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|1514767_1515682_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|1515827_1516631_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|1516808_1517756_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002302440.1|1517839_1519141_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002303172.1|1519324_1519618_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1519645_1520311_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|1520450_1521083_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|1521089_1522157_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|1522153_1522885_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|1523053_1523533_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|1523668_1524844_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|1525047_1526217_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002303174.1|1526483_1528106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1528347_1529526_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002286097.1|1530598_1531552_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	1592406	1668453	2933966	portal,transposase,protease,terminase,tRNA,head,tail,holin,integrase,capsid	Enterococcus_phage(31.25%)	92	1628479:1628514	1667802:1667837
WP_002286621.1|1592406_1595205_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286622.1|1595466_1596174_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_073120016.1|1596194_1596977_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_073120020.1|1597025_1597313_-	YggT family protein	NA	NA	NA	NA	NA
WP_002286627.1|1597327_1597927_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_002286628.1|1597940_1598618_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002286629.1|1598634_1599876_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002286631.1|1599898_1601224_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_073120023.1|1601379_1602600_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002286637.1|1602614_1603703_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002286638.1|1603728_1605090_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002286639.1|1605103_1606066_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002303009.1|1606091_1608284_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002294542.1|1608284_1608686_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002286642.1|1608690_1609650_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002286645.1|1609670_1610102_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_002286647.1|1610271_1610640_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002286649.1|1610810_1611767_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002291876.1|1611839_1611956_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_002286651.1|1612010_1613693_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002286653.1|1613710_1614160_-	arginine repressor	NA	NA	NA	NA	NA
WP_002286655.1|1614266_1615085_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002286656.1|1615093_1615984_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002286657.1|1615985_1616210_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_002286658.1|1616214_1617552_-	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	29.5	6.7e-26
WP_002286660.1|1617552_1618407_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.7	6.8e-40
WP_002286662.1|1618503_1618953_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002286664.1|1618945_1619371_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002286665.1|1619616_1620681_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002286666.1|1620852_1621098_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002286668.1|1621236_1621611_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_002286670.1|1621693_1622608_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_002294546.1|1622628_1623432_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289456.1|1623464_1624454_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_002289455.1|1624556_1625048_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289453.1|1625238_1628073_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
1628479:1628514	attL	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_002305361.1|1628691_1629486_+	DUF4428 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	32.9	4.3e-12
WP_002305364.1|1629581_1629884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1629919_1630291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1630292_1630694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1630707_1631115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|1632037_1633200_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286484.1|1634139_1635165_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|1635161_1635386_-|holin	holin	holin	NA	NA	NA	NA
WP_002286686.1|1635382_1635676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1635713_1635851_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|1635852_1636299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305370.1|1636461_1638552_-	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	49.6	9.6e-88
WP_002305372.1|1638575_1640867_-	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_002305373.1|1640876_1641614_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305374.1|1641664_1645084_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_002305377.1|1645100_1645283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286510.1|1645285_1645648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305379.1|1645667_1646273_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002297404.1|1646681_1647932_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002286516.1|1648067_1648472_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|1648464_1648866_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|1648855_1649209_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|1649198_1649510_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|1649506_1650382_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|1650391_1651552_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|1651551_1652238_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|1652200_1653379_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|1653398_1655093_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286538.1|1655070_1655385_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|1655487_1655769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|1655773_1656118_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002305387.1|1656377_1657025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020944850.1|1657246_1657426_+	YegP family protein	NA	NA	NA	NA	NA
WP_002305389.1|1657418_1657760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349267.1|1657783_1658020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|1658294_1658762_-	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002296604.1|1658946_1659192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|1659151_1659508_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002305393.1|1659507_1659813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|1659809_1659971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305394.1|1659985_1660345_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002305396.1|1660341_1661193_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305397.1|1661209_1662040_-	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305398.1|1662042_1662729_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305399.1|1662734_1662974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|1663299_1663488_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002349273.1|1663508_1663793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305401.1|1663794_1663989_-	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002305403.1|1663985_1664762_-	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002349274.1|1664888_1665110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305405.1|1665410_1665755_+	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002321996.1|1665790_1666186_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305409.1|1666238_1666550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301539.1|1666561_1667710_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002289452.1|1667802_1668096_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
1667802:1667837	attR	ATTAAGCTTCTTGAGCTACTGGATAAACAGACACTT	NA	NA	NA	NA
WP_002289451.1|1668108_1668453_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 10
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	1687538	1696010	2933966		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|1687538_1689728_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|1690042_1690645_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|1690698_1691820_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|1691928_1692801_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|1692869_1693217_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|1693209_1694034_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|1694069_1695008_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|1695021_1695351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294039.1|1695365_1696010_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 11
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2027513	2092337	2933966	transposase,tRNA	Streptococcus_phage(18.18%)	52	NA	NA
WP_002346541.1|2027513_2028833_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_154080572.1|2029020_2029164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025477414.1|2029670_2031371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297417.1|2031473_2032307_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_002286368.1|2032610_2034776_-	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	32.7	1.9e-06
WP_002317159.1|2035035_2037330_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002286375.1|2037322_2037988_+	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.9	2.7e-12
WP_002294627.1|2037980_2038988_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_002294628.1|2039009_2040029_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286385.1|2040309_2041677_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_002286392.1|2041785_2043207_-	amino acid permease	NA	NA	NA	NA	NA
WP_002286400.1|2043449_2045327_-	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_002297419.1|2045617_2046874_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.7	3.1e-81
WP_080490136.1|2047453_2048755_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002317158.1|2048823_2049423_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002328397.1|2049848_2050802_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002317156.1|2051637_2053248_+	tetronasin resistance protein	NA	NA	NA	NA	NA
WP_002289290.1|2053324_2053984_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289292.1|2054266_2054932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317155.1|2055078_2055684_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_002317154.1|2055711_2056695_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_002304157.1|2056696_2057092_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_002292575.1|2057244_2057565_+	putative heavy metal-binding protein	NA	NA	NA	NA	NA
WP_002319540.1|2057676_2058546_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002317152.1|2058641_2059946_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002317151.1|2060104_2060452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317148.1|2062843_2064499_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_002294651.1|2064500_2064815_-	rhodanese-like domain-containing protein	NA	E4WM79	Ostreococcus_tauri_virus	39.1	3.4e-05
WP_002294653.1|2064984_2065245_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_002321527.1|2065258_2065573_+	sulfur reduction protein DsrE	NA	NA	NA	NA	NA
WP_002294657.1|2066180_2066735_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002317147.1|2066860_2068789_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	27.0	1.0e-19
WP_002292560.1|2069094_2069811_-	aquaporin family protein	NA	M1HVL5	Acanthocystis_turfacea_Chlorella_virus	36.9	1.6e-29
WP_002317146.1|2069811_2071635_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_002294668.1|2071648_2073145_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002296783.1|2073280_2074741_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002324354.1|2074730_2076026_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_002317143.1|2076368_2077046_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002324353.1|2077075_2078167_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_002294674.1|2078267_2078702_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002317141.1|2078849_2080487_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002307889.1|2080813_2082127_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.1	5.7e-46
WP_152138210.1|2082422_2083895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|2084039_2085335_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296840.1|2085456_2086644_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002317139.1|2087112_2087337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317138.1|2087356_2087725_-	glyoxalase	NA	NA	NA	NA	NA
WP_070600817.1|2087925_2088636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349822.1|2088653_2089151_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002292540.1|2089187_2089640_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073120058.1|2089832_2090786_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002346541.1|2091017_2092337_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
>prophage 12
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2108093	2157142	2933966	transposase,tRNA	Anoxybacillus_phage(33.33%)	41	NA	NA
WP_002325907.1|2108093_2108837_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_010726130.1|2109031_2111752_+	YfhO family protein	NA	NA	NA	NA	NA
WP_002325911.1|2112656_2113907_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_024265259.1|2114134_2115088_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002317135.1|2115272_2115704_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002325913.1|2115700_2117335_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002317133.1|2117556_2118192_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002297446.1|2118338_2119580_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002317131.1|2119777_2120815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972672.1|2121956_2122910_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_010726126.1|2122992_2123154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312639.1|2123472_2124342_-	ROK family protein	NA	NA	NA	NA	NA
WP_002317128.1|2124361_2125483_-	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_002312636.1|2125484_2125880_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002349742.1|2125898_2126705_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002312633.1|2126697_2127486_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312631.1|2127499_2127976_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002323457.1|2128047_2130705_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002317125.1|2130723_2131128_-	restriction endonuclease subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.4	4.7e-15
WP_002313258.1|2131360_2131618_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_024265257.1|2131653_2132607_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002286103.1|2132855_2133944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317124.1|2134186_2135824_-	resolvase	NA	A0A2P1JU08	Anoxybacillus_phage	28.1	3.1e-41
WP_002317123.1|2135827_2137201_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	22.8	1.6e-14
WP_024265256.1|2137216_2137456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317121.1|2137634_2139281_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_002317120.1|2139428_2140478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024265255.1|2141097_2141988_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002304106.1|2142062_2142359_-	peptidase	NA	NA	NA	NA	NA
WP_002317118.1|2142351_2142645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|2142848_2144168_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002296259.1|2144474_2145026_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002317116.1|2145199_2145499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317115.1|2145525_2145834_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002317441.1|2147604_2148924_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.5	6.9e-209
WP_002317114.1|2149101_2150274_-	MFS transporter	NA	NA	NA	NA	NA
WP_002317113.1|2150276_2152526_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002317112.1|2152622_2153477_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010778368.1|2153563_2154472_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002317111.1|2154639_2155770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113787899.1|2155980_2157142_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	4.6e-79
>prophage 13
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2365721	2375414	2933966	integrase	Streptococcus_phage(77.78%)	12	2362677:2362692	2374294:2374309
2362677:2362692	attL	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_002298578.1|2365721_2367287_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
WP_000237797.1|2367354_2368548_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|2368574_2368775_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845143.1|2369272_2369503_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000675479.1|2369499_2369982_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	8.5e-48
WP_010924747.1|2370110_2370221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001227350.1|2370452_2370806_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_001803271.1|2370863_2371031_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	62.0	2.3e-13
WP_073120086.1|2371149_2373069_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	94.8	0.0e+00
WP_011058339.1|2373084_2373171_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_012972536.1|2373445_2374384_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
2374294:2374309	attR	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_000768373.1|2374391_2375414_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
>prophage 14
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2382549	2391877	2933966		Streptococcus_phage(87.5%)	12	NA	NA
WP_000723887.1|2382549_2382945_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|2383016_2383655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000425404.1|2383710_2384211_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.0	1.7e-54
WP_000675717.1|2384271_2385051_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|2385092_2385314_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|2385310_2385601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|2385597_2386782_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_001130244.1|2386963_2388367_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000185761.1|2388388_2389162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|2389171_2389549_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|2389569_2389884_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_000181735.1|2390083_2391877_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
>prophage 15
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2459594	2530705	2933966	integrase,protease,transposase	Bacillus_phage(20.0%)	60	2476345:2476361	2523836:2523852
WP_002289035.1|2459594_2462087_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
WP_002289033.1|2462307_2463231_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_021415055.1|2463248_2464490_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.2e-42
WP_002289031.1|2464623_2465970_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_002304806.1|2466904_2467858_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002294811.1|2467870_2468974_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002289025.1|2469063_2469999_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_002289023.1|2470300_2472235_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002294810.1|2472691_2473108_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002304808.1|2473121_2473688_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_002289380.1|2473710_2474697_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002289382.1|2474851_2476834_-	collagen-binding MSCRAMM adhesin Scm	NA	NA	NA	NA	NA
2476345:2476361	attL	CGAAATCAATATATTCA	NA	NA	NA	NA
WP_002289384.1|2477120_2477645_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_002297289.1|2477961_2478930_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289388.1|2479086_2479893_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002289390.1|2479889_2480795_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289394.1|2480812_2481781_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002320801.1|2482499_2486126_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002295965.1|2486204_2489858_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	8.4e-63
WP_002288139.1|2490452_2491478_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288137.1|2491752_2493438_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288135.1|2493451_2494735_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288134.1|2494804_2495674_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288133.1|2495670_2496507_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002340552.1|2496532_2497600_+	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288129.1|2497596_2498424_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288127.1|2498468_2499494_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288124.1|2499490_2501674_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288122.1|2501673_2502804_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288121.1|2502800_2503478_+	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288119.1|2503561_2504089_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288144.1|2504289_2504976_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288118.1|2505055_2506594_+	gluconokinase	NA	NA	NA	NA	NA
WP_002297290.1|2506713_2507181_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002295975.1|2507699_2508143_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002287505.1|2508158_2508551_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002297291.1|2508639_2509866_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002320809.1|2509937_2510096_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297292.1|2510783_2511524_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002297293.1|2511615_2512803_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297294.1|2513124_2513967_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297295.1|2513963_2514914_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297302.1|2514928_2515162_+	iron-dependent repressor	NA	NA	NA	NA	NA
WP_071858995.1|2515492_2516077_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297304.1|2516207_2516876_+	cobalt transporter	NA	NA	NA	NA	NA
WP_002311663.1|2516877_2518302_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297308.1|2518319_2518889_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002297309.1|2518998_2520753_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297310.1|2520736_2522479_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002296840.1|2522787_2523975_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
2523836:2523852	attR	TGAATATATTGATTTCG	NA	NA	NA	NA
WP_002297316.1|2524475_2524745_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297318.1|2524759_2524939_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297319.1|2524970_2525348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297320.1|2525368_2525518_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_073120091.1|2525541_2526525_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002322279.1|2526554_2526677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2526694_2528218_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002304820.1|2528241_2528481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122610.1|2528655_2529948_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_106913778.1|2530180_2530705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	8.8e-14
>prophage 16
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2556060	2575668	2933966		Streptococcus_phage(86.67%)	19	NA	NA
WP_002297345.1|2556060_2556972_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
WP_002297346.1|2556990_2557995_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297347.1|2557991_2560115_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297348.1|2560119_2562567_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297349.1|2562553_2562943_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297350.1|2563002_2563506_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_033658092.1|2563518_2563743_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002286940.1|2563846_2565757_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002317225.1|2566502_2566640_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002297353.1|2566636_2567821_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002297354.1|2568079_2568370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073120106.1|2568359_2569502_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	61.5	7.5e-127
WP_002297358.1|2569734_2570409_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002297360.1|2570486_2570726_-	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297361.1|2570819_2572679_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002343904.1|2573393_2574539_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002311649.1|2574621_2574966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297365.1|2574966_2575341_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297366.1|2575353_2575668_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
>prophage 17
NZ_CP018071	Enterococcus faecium strain VRE001, complete genome	2933966	2862545	2913390	2933966	bacteriocin,transposase,tRNA	Bacillus_virus(18.18%)	52	NA	NA
WP_002296623.1|2862545_2863841_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289850.1|2863930_2864608_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289849.1|2864725_2865301_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289848.1|2865431_2866136_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|2866113_2866911_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|2866912_2867812_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|2867829_2869191_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002294560.1|2869252_2869894_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|2870002_2870869_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002304784.1|2871086_2871593_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002289593.1|2871641_2872301_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289594.1|2872320_2874909_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|2875011_2875239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289597.1|2875348_2875978_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289599.1|2875974_2877054_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002324227.1|2877170_2878103_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.2	5.9e-21
WP_002294551.1|2878116_2879262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296167.1|2879248_2880421_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002294549.1|2880519_2881485_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|2882081_2882585_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|2882640_2883285_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|2883446_2883599_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|2883622_2883793_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|2883893_2884439_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002294581.1|2884515_2885403_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294583.1|2885575_2886595_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002294584.1|2886685_2887558_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|2887570_2888239_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|2888581_2889004_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|2889107_2889797_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|2890206_2890710_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|2890762_2891131_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002296327.1|2891236_2891926_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002295743.1|2893150_2894059_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002290558.1|2894448_2895981_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|2896214_2896916_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|2897169_2897883_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287791.1|2898191_2899331_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|2899419_2900385_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287793.1|2900434_2902594_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287795.1|2902752_2902977_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|2903377_2903851_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|2903847_2905980_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|2905981_2906116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|2906209_2906854_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|2907040_2908234_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|2908226_2909954_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000195429.1|2910392_2911565_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002304799.1|2911679_2911877_+	enterocin	NA	NA	NA	NA	NA
WP_002287810.1|2911878_2912190_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002321654.1|2912293_2912440_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_000222572.1|2912436_2913390_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018070	Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence	78626	20674	69542	78626	holin,protease,transposase	Streptococcus_phage(50.0%)	56	NA	NA
WP_059355959.1|20674_21853_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_000026576.1|22057_22348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|22719_23406_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002347149.1|23483_24299_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002347150.1|24412_24781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303412.1|24954_25263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349053.1|25525_25846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303414.1|25976_26186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303415.1|26175_26448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347151.1|26495_26714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127821124.1|26761_27448_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.0e-126
WP_002303114.1|27504_27855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303115.1|27847_29173_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.4	7.7e-99
WP_002299575.1|29543_30128_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002299573.1|30338_30542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303116.1|30551_30974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|31211_31826_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_001809248.1|31990_32815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000588503.1|33452_33710_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000388479.1|33702_33972_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001120991.1|34102_34282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|34662_35370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|35362_35800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|35814_36066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347218.1|36065_36272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295623.1|36708_36969_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002316074.1|37043_37247_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303313.1|37387_37873_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002303312.1|37875_38775_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_073119917.1|38787_39381_-	abortive infection protein	NA	NA	NA	NA	NA
WP_002305772.1|39621_41826_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002347152.1|41836_43297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305801.1|43357_45730_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002297404.1|46139_47390_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002302840.1|47525_47720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|47865_48201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|48221_49814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|49833_50256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|50297_50573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305788.1|50848_51118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582323.1|51161_52097_-	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002302851.1|52507_53314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302852.1|53324_53969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|53984_55184_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302854.1|55183_57208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|57229_57823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|57823_58156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|58233_58776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302858.1|58836_61215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|61211_63824_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_073119920.1|63823_65878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302862.1|65946_66249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|66266_66509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|66505_66961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300033.1|67148_67340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300034.1|67484_69542_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP018072	Enterococcus faecium strain VRE001 plasmid unnamed2, complete sequence	59226	17565	25513	59226	transposase	Streptococcus_phage(87.5%)	10	NA	NA
WP_002354485.1|17565_18252_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002347171.1|18307_18565_+	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	9.1e-41
WP_001835296.1|18656_18872_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_000301765.1|18888_19161_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|19162_20026_+	toxin zeta	NA	NA	NA	NA	NA
WP_023843711.1|20203_20344_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001038796.1|20288_21026_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|21150_21234_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|21775_22570_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_086953915.1|24173_25513_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
>prophage 2
NZ_CP018072	Enterococcus faecium strain VRE001 plasmid unnamed2, complete sequence	59226	36304	49545	59226	transposase	Bacillus_phage(30.0%)	17	NA	NA
WP_139896901.1|36304_36990_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	3.5e-127
WP_002349227.1|37192_37405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|37566_38085_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|38091_38604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|38874_39498_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_002354485.1|39587_40274_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|40471_41077_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|41092_41665_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|42137_42710_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|42810_43973_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_077828739.1|44013_44397_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	45.5	1.6e-12
WP_000199136.1|44378_44633_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|44825_45101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|45072_46026_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|46637_48131_+	replication protein RepR	NA	NA	NA	NA	NA
WP_073120189.1|48265_48562_+	type III secretion system protein PrgN	NA	NA	NA	NA	NA
WP_002287225.1|48585_49545_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	3.4e-32
>prophage 1
NZ_CP018073	Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence	170854	5493	132608	170854	bacteriocin,transposase,integrase,holin	Streptococcus_phage(27.91%)	119	22719:22778	131263:131508
WP_002302440.1|5493_6795_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002301591.1|9673_10759_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|10866_11820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|11950_13201_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|13219_14146_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|14224_15220_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|15235_16405_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|16420_17155_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|17925_19088_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|19656_20949_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|21222_21483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|21733_22912_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
22719:22778	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_000195429.1|23087_24260_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
22719:22778	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_077828678.1|24553_24892_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEB1	Paenibacillus_phage	57.1	6.6e-23
WP_002287876.1|25840_26236_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|26245_27094_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|27108_27936_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002287872.1|27947_28793_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002285758.1|29006_29201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|29190_29544_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|29645_31193_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002354485.1|31986_32673_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000195429.1|33296_34469_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303110.1|36299_37337_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002304895.1|37333_37855_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002304894.1|37903_38170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000202380.1|38589_39909_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002303113.1|40528_41080_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|41624_42305_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002304893.1|42332_42896_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	2.2e-18
WP_000824191.1|42940_43108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|43141_43441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073120208.1|43481_44099_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	6.7e-13
WP_002304891.1|44423_44819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|44898_47250_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|47374_48064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|48077_48530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|48660_49341_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|49442_50762_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|50758_51412_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|52121_52838_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002302256.1|52887_53097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|54753_55785_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|55791_56622_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|56618_57425_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|57430_58255_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002347701.1|58244_59345_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|59522_60308_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|60340_60724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|60799_60931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|60899_61136_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|61213_62185_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|62836_64459_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002301195.1|64744_66121_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|66120_66777_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|66786_68064_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|68313_69475_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002330699.1|69505_69955_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_010706480.1|70110_70461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745858.1|70926_72088_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	1.2e-79
WP_002349250.1|72713_73238_-	hypothetical protein	NA	NA	NA	NA	NA
72217:72449	attR	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGCAGTTTCAAAATGAAGAATCACTAGAACGCTTTCTAGTCAGCATTTTTGATACATACAATCAAAAATTTCTAAACAGAAGCCATAAAGGTTTTCAACAGGTAACCGATACATTAGTTTCAATGTTTACTGAGTAACTAATTATTTTGCAGGAGGACAATTTATTTACACAAAAT	NA	NA	NA	NA
WP_002326839.1|73262_74171_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
72217:72449	attR	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGCAGTTTCAAAATGAAGAATCACTAGAACGCTTTCTAGTCAGCATTTTTGATACATACAATCAAAAATTTCTAAACAGAAGCCATAAAGGTTTTCAACAGGTAACCGATACATTAGTTTCAATGTTTACTGAGTAACTAATTATTTTGCAGGAGGACAATTTATTTACACAAAAT	NA	NA	NA	NA
WP_002301108.1|74846_75401_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002307497.1|77035_77848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002316137.1|78521_79694_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	98.4	1.1e-133
WP_002303163.1|80973_81837_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_002305953.1|81829_82387_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_002303161.1|82383_83943_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_002303160.1|83935_84841_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_002303159.1|84845_85139_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_002303158.1|85142_86156_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_002303157.1|86181_87486_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002303156.1|87466_88654_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002303155.1|88841_89789_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002292681.1|90085_90634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|90634_91492_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|91777_92065_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|92054_92384_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002305108.1|92460_92733_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002303154.1|92732_92996_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002303153.1|93101_93518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729614.1|93523_94204_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	1.6e-108
WP_002314359.1|94744_95935_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.2	3.5e-26
WP_073120210.1|96675_97035_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002303335.1|97107_97926_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002324485.1|98339_98690_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010729620.1|98759_99713_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	4.8e-34
WP_002293041.1|99908_100106_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.9e-23
WP_002302440.1|100212_101514_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002303603.1|102728_103013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326174.1|104622_105531_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002290394.1|106164_106482_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002303208.1|106482_106737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|107095_107500_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|107516_108665_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002348857.1|109371_109566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303636.1|110917_111958_+	replication protein RepA	NA	NA	NA	NA	NA
WP_002323647.1|112781_113114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295674.1|113732_114074_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002297404.1|114310_115561_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|115970_118343_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|118403_119873_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|119883_121893_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002303484.1|122238_122835_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002303483.1|122847_123747_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|123749_123881_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|123902_124235_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|124279_124513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|124671_124794_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|124983_125208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|125650_125857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|125856_126108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|126288_126561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|127005_127185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|127243_127600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|128568_129522_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|129642_129906_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|130277_131456_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002326066.1|131654_132608_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	2.1e-34
