The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	22257	31178	3935874	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_073203422.1|22257_23532_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.4	1.2e-96
WP_024425758.1|23633_24464_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.1	2.7e-09
WP_003218104.1|24972_25632_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.1e-21
WP_024425759.1|25628_26252_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.9	4.1e-18
WP_073203425.1|26337_27639_-	glycoside hydrolase family 18 protein	NA	A0A2P1CIG4	Microbacterium_phage	36.0	1.2e-08
WP_073203426.1|27684_28239_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_041106248.1|28318_28795_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_041106245.1|29465_31178_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.3	2.6e-54
>prophage 2
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	630090	639986	3935874		Synechococcus_phage(50.0%)	9	NA	NA
WP_008355754.1|630090_631386_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	2.9e-18
WP_073204110.1|631458_632181_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	1.6e-45
WP_003214349.1|632173_632428_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
WP_024424510.1|632424_633108_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_044335226.1|633091_635323_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	2.5e-158
WP_024424615.1|635298_636729_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	4.9e-51
WP_044335228.1|636825_637866_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.6	8.8e-66
WP_024424512.1|637862_638432_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	2.5e-30
WP_024424513.1|638447_639986_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	8.1e-76
>prophage 3
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	1143624	1188115	3935874	integrase,coat,tRNA	Planktothrix_phage(12.5%)	51	1187597:1187640	1190821:1190864
WP_024425046.1|1143624_1144620_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_073204702.1|1145375_1147013_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024426481.1|1147129_1148074_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024425043.1|1148077_1148995_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087975602.1|1148998_1150087_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.7e-14
WP_024425041.1|1150088_1151009_+	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	26.6	1.3e-07
WP_044334753.1|1151113_1151401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024425040.1|1151538_1152117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003211421.1|1152310_1152706_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_073204706.1|1152745_1153411_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	37.5	2.5e-29
WP_024425038.1|1153674_1154340_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_073204709.1|1154427_1155948_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_073204713.1|1156110_1157271_+	competence protein	NA	NA	NA	NA	NA
WP_073204715.1|1157251_1159312_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	25.3	1.2e-58
WP_024425034.1|1159418_1159592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024425033.1|1159887_1160799_-	DsbA family protein	NA	NA	NA	NA	NA
WP_073204718.1|1160795_1161194_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_073204721.1|1161469_1162237_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	61.4	1.1e-36
WP_073204723.1|1162258_1162837_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_073204726.1|1163072_1163438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024425028.1|1163471_1164101_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003211364.1|1164164_1164965_+	NAD kinase	NA	NA	NA	NA	NA
WP_073204729.1|1164973_1165876_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_073204732.1|1165918_1166662_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SF21	Hokovirus	27.0	1.5e-14
WP_073204734.1|1166823_1168665_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_073204737.1|1168912_1169623_+	thiaminase II	NA	NA	NA	NA	NA
WP_073208290.1|1169597_1170215_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_073204739.1|1170198_1171311_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_024426466.1|1171307_1171511_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_025093416.1|1171515_1172283_+	thiazole synthase	NA	NA	NA	NA	NA
WP_073204742.1|1172279_1173293_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_073204745.1|1173309_1174116_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024425017.1|1174266_1175043_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_073204748.1|1175157_1175844_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024425015.1|1175879_1176323_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003211658.1|1176526_1177018_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_025093420.1|1177164_1177659_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024425013.1|1177747_1178083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073204750.1|1178125_1178512_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024426459.1|1178688_1179039_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_025093421.1|1179329_1179551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024426457.1|1179635_1179773_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_008348417.1|1179911_1180169_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_073204753.1|1180185_1182498_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	34.7	6.7e-82
WP_073204755.1|1182624_1182882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044334815.1|1182965_1183400_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_073204759.1|1183406_1183922_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_073204762.1|1183974_1184715_-	esterase family protein	NA	NA	NA	NA	NA
WP_073204764.1|1185140_1186259_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.9	6.2e-17
WP_044334821.1|1186255_1187434_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
1187597:1187640	attL	CTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
WP_081372061.1|1187779_1188115_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081372061.1|1187779_1188115_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1190821:1190864	attR	CTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 4
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	1671984	1737297	3935874	coat,tRNA,integrase,tail,holin	Bacillus_phage(64.86%)	65	1680424:1680440	1733453:1733469
WP_034281907.1|1671984_1673511_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_008358013.1|1673512_1673947_+	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_024424105.1|1674202_1674748_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_073205247.1|1674872_1677449_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.2e-40
WP_073205249.1|1677470_1679369_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	1.5e-66
WP_024424102.1|1679406_1679931_-	DUF1016 domain-containing protein	NA	NA	NA	NA	NA
WP_024427030.1|1680054_1680459_-	hypothetical protein	NA	NA	NA	NA	NA
1680424:1680440	attL	GTGATAATGATTCATTT	NA	NA	NA	NA
WP_024424099.1|1681029_1681503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205251.1|1681813_1682563_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	47.2	1.9e-38
WP_073205254.1|1682724_1683873_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	39.4	5.2e-67
WP_073205255.1|1683962_1685288_-	S8 family peptidase	NA	A0A2P0VP02	Tetraselmis_virus	28.8	1.8e-15
WP_025093280.1|1685873_1686608_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	48.8	1.1e-43
WP_024424094.1|1686684_1687134_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024424093.1|1687180_1687549_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024424092.1|1687564_1687882_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_073205258.1|1687884_1688427_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073205261.1|1688539_1688830_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_044330437.1|1688934_1689336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044330435.1|1689406_1690363_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_024424088.1|1690388_1690610_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_024424087.1|1690772_1691093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003212415.1|1691172_1691385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008360380.1|1691650_1692043_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	54.2	6.1e-28
WP_044330425.1|1692002_1694105_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	83.5	0.0e+00
WP_024424085.1|1694122_1695103_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.2	3.2e-150
WP_024424084.1|1695191_1695809_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	45.3	5.1e-45
WP_024427042.1|1695876_1696635_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	6.9e-52
WP_073205264.1|1696946_1697519_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	39.4	3.7e-26
WP_073208316.1|1697617_1697899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205268.1|1698085_1699450_+	hypothetical protein	NA	G3MA65	Bacillus_virus	20.7	2.9e-08
WP_073205271.1|1699470_1699893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205274.1|1700105_1701215_+	RapH N-terminal domain-containing protein	NA	A0A1P8CWN8	Bacillus_phage	28.7	1.6e-36
WP_073205277.1|1701439_1703365_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	40.2	1.1e-82
WP_073205280.1|1703370_1703850_+	TIGR01741 family protein	NA	NA	NA	NA	NA
WP_073205282.1|1704046_1705057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205285.1|1705205_1705535_+	YolD-like family protein	NA	O64030	Bacillus_phage	48.6	3.1e-25
WP_073205287.1|1705527_1706796_+	DNA polymerase IV	NA	O64031	Bacillus_phage	74.9	1.0e-180
WP_073205290.1|1707156_1708008_-	hypothetical protein	NA	G3MAB4	Bacillus_virus	30.8	3.4e-31
WP_024428162.1|1708007_1708280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205293.1|1708279_1709131_-	hypothetical protein	NA	G3MAB4	Bacillus_virus	31.2	3.2e-29
WP_073205295.1|1709133_1709982_-	hypothetical protein	NA	G3MAB2	Bacillus_virus	39.5	1.7e-54
WP_073205297.1|1709992_1712095_-	hypothetical protein	NA	G3MAB0	Bacillus_virus	35.9	2.1e-82
WP_073205301.1|1712364_1712649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205304.1|1712695_1712962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056704611.1|1712961_1713213_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	76.5	3.5e-29
WP_073208319.1|1713222_1713612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167364610.1|1713722_1715084_-	peptidoglycan-binding protein	NA	A0A1P8CWN6	Bacillus_phage	77.6	4.1e-55
WP_073205306.1|1715213_1717331_-|tail	tail fiber domain-containing protein	tail	A0A1S5R3Z4	Pseudomonas_phage	43.1	3.9e-28
WP_073205309.1|1717355_1718174_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	68.6	1.6e-94
WP_073205311.1|1718191_1720882_-|tail	phage tail protein	tail	O64044	Bacillus_phage	56.6	1.8e-275
WP_073205313.1|1720892_1721684_-|tail	phage tail family protein	tail	O64045	Bacillus_phage	52.3	2.1e-80
WP_073205316.1|1721729_1728578_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	47.5	0.0e+00
WP_073205319.1|1728677_1729370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205321.1|1729555_1729903_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	37.6	5.2e-07
WP_073205323.1|1730046_1731072_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	34.8	2.1e-48
WP_073205325.1|1731086_1731518_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	47.8	5.3e-33
WP_073205327.1|1731517_1731997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205331.1|1732067_1732217_-	XkdX family protein	NA	M4ZS22	Bacillus_phage	53.3	8.5e-07
WP_073205334.1|1732217_1732490_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	39.6	1.0e-10
WP_073205337.1|1732504_1733587_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	35.9	2.4e-13
1733453:1733469	attR	AAATGAATCATTATCAC	NA	NA	NA	NA
WP_051150002.1|1733586_1733952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081372068.1|1733992_1734568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205339.1|1734587_1735364_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	54.8	4.9e-45
WP_073205341.1|1735397_1736117_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	51.3	5.9e-69
WP_073205347.1|1736634_1737297_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	49.4	1.5e-39
>prophage 5
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	1742560	1751823	3935874		Bacillus_phage(50.0%)	8	NA	NA
WP_073205359.1|1742560_1744309_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.1	1.3e-64
WP_073205362.1|1744308_1745325_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	26.1	2.4e-07
WP_073205365.1|1745387_1745816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205367.1|1745859_1746240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205370.1|1746285_1747506_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	79.8	1.8e-187
WP_044141768.1|1747520_1747712_-	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	67.2	1.2e-13
WP_073205373.1|1748813_1749089_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	70.0	5.8e-25
WP_073205376.1|1749312_1751823_-	hypothetical protein	NA	O64076	Bacillus_phage	67.9	0.0e+00
>prophage 6
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	1766168	1783662	3935874	integrase	Bacillus_phage(87.5%)	32	1763735:1763751	1775745:1775761
1763735:1763751	attL	AACAAATTACATATATT	NA	NA	NA	NA
WP_073205425.1|1766168_1767251_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	45.2	2.7e-78
WP_073205427.1|1767337_1768726_+	hypothetical protein	NA	O64100	Bacillus_phage	37.6	2.1e-75
WP_073205430.1|1768728_1769718_+	hypothetical protein	NA	O64101	Bacillus_phage	39.4	1.0e-55
WP_056704490.1|1769872_1770091_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	43.2	1.0e-08
WP_073205433.1|1770277_1770499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167364614.1|1770900_1771071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081372069.1|1771171_1771429_+	hypothetical protein	NA	O64118	Bacillus_phage	46.0	6.4e-10
WP_073205438.1|1771403_1772600_+	AAA family ATPase	NA	A0A172JHS6	Bacillus_phage	41.4	9.8e-69
WP_073205441.1|1772615_1773077_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	61.8	9.6e-49
WP_073205444.1|1773073_1773466_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	71.7	3.7e-49
WP_073208332.1|1773715_1774249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073208335.1|1774425_1775079_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	65.0	1.1e-79
WP_073205447.1|1775114_1775399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205449.1|1775533_1775728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925711.1|1775893_1776085_+	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	48.4	8.6e-12
1775745:1775761	attR	AACAAATTACATATATT	NA	NA	NA	NA
WP_167364615.1|1776111_1776267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205454.1|1776328_1776643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167364616.1|1776685_1776850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205456.1|1776864_1777176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205458.1|1777275_1778088_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	83.6	7.7e-134
WP_167364617.1|1778222_1778393_+	hypothetical protein	NA	A0A0S2MV96	Bacillus_phage	49.0	2.8e-06
WP_073205461.1|1778415_1778631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205464.1|1778681_1778864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205466.1|1779221_1779755_+	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	52.0	6.5e-41
WP_073205468.1|1779751_1780057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205472.1|1780059_1780350_+	hypothetical protein	NA	A0A0A7AQ93	Bacillus_phage	45.7	6.7e-16
WP_073205475.1|1780403_1781183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167364618.1|1781194_1781341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925713.1|1781508_1781700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205482.1|1781983_1782424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073205484.1|1782545_1783259_+	serine/threonine protein phosphatase	NA	A0A059T829	Listeria_phage	38.2	1.8e-41
WP_073205486.1|1783269_1783662_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	48.0	4.5e-31
>prophage 7
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	1790916	1811951	3935874		Bacillus_phage(64.71%)	31	NA	NA
WP_073205503.1|1790916_1791975_+	DNA primase	NA	A0A0K2FM97	Brevibacillus_phage	36.3	5.4e-55
WP_073205506.1|1791985_1793686_+	DHH family phosphoesterase	NA	A0A1P8CX07	Bacillus_phage	56.2	2.5e-171
WP_073205509.1|1793701_1795996_+	DNA polymerase I	NA	A0A0K0N6N8	Gordonia_phage	28.0	5.9e-06
WP_081372070.1|1796002_1796683_+	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	46.3	9.6e-13
WP_156376657.1|1796700_1796856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205512.1|1797015_1797522_+	deoxynucleoside kinase	NA	A0A1P8CX28	Bacillus_phage	53.1	4.6e-44
WP_073205515.1|1797555_1797837_+	hypothetical protein	NA	A0A0H3V0R5	Geobacillus_virus	36.5	5.0e-08
WP_081372071.1|1798087_1798819_+	site-specific DNA-methyltransferase	NA	A0A1D8KTH4	Synechococcus_phage	52.2	9.2e-70
WP_073205518.1|1798848_1799058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205522.1|1799054_1799426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205524.1|1799440_1799758_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_073205531.1|1800468_1800726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205534.1|1800765_1800993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167364619.1|1801051_1801228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205538.1|1801352_1801823_+	hypothetical protein	NA	O64162	Bacillus_phage	49.4	8.3e-40
WP_145925715.1|1801849_1802158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205543.1|1802302_1802563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205546.1|1802603_1803152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205548.1|1803188_1803380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144498185.1|1803393_1803615_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	67.1	6.7e-24
WP_073205553.1|1803934_1804201_+	hypothetical protein	NA	O64167	Bacillus_phage	65.2	2.5e-25
WP_073205555.1|1804240_1804597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205557.1|1804596_1804983_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	57.9	8.6e-35
WP_073205560.1|1804954_1805686_+	ribonucleotide-diphosphate reductase subunit alpha	NA	S6B1K0	Bacillus_phage	84.0	1.1e-110
WP_073205563.1|1805784_1806468_+	HNH endonuclease	NA	L0LCB9	Bacillus_phage	55.1	1.2e-47
WP_081372072.1|1806619_1809157_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	80.1	0.0e+00
WP_073205567.1|1809236_1809686_+	hypothetical protein	NA	K7PL52	Enterobacteria_phage	43.2	3.5e-11
WP_073205570.1|1809673_1810675_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A076G7U1	Bacillus_phage	81.7	8.5e-151
WP_073205574.1|1810915_1811134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205577.1|1811133_1811493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073205580.1|1811522_1811951_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	83.1	1.6e-66
>prophage 8
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2187210	2194919	3935874		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
WP_073206105.1|2187210_2188302_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.3	3.7e-22
WP_024422806.1|2188301_2189474_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.4	2.6e-42
WP_073206108.1|2189547_2190327_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024422808.1|2190472_2190919_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.3	2.0e-27
WP_024422809.1|2191048_2192011_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	25.6	2.9e-07
WP_024422810.1|2192035_2192740_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_024422811.1|2192743_2193511_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008344541.1|2193625_2193856_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_073206111.1|2193880_2194450_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	3.1e-49
WP_003215863.1|2194640_2194919_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 9
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2233102	2239490	3935874		Staphylococcus_phage(50.0%)	10	NA	NA
WP_039179629.1|2233102_2234254_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	4.1e-24
WP_073206152.1|2234367_2234847_-	YpuI family protein	NA	NA	NA	NA	NA
WP_024422847.1|2234960_2235554_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.0e-15
WP_024422848.1|2235543_2236302_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	39.2	1.3e-10
WP_012010430.1|2236511_2236604_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_044332821.1|2236694_2237219_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_044332819.1|2237243_2237597_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029706184.1|2237710_2238175_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	68.3	3.6e-43
WP_073206157.1|2238201_2238828_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	57.4	1.9e-55
WP_073206159.1|2238839_2239490_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.3	2.3e-40
>prophage 10
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2537885	2672186	3935874	protease,coat,head,tRNA,plate,terminase,capsid,tail,portal,holin	Bacillus_phage(49.02%)	117	NA	NA
WP_073206493.1|2537885_2538329_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_024427858.1|2538347_2540558_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	35.5	2.9e-10
WP_024423133.1|2540700_2541213_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.5e-29
WP_073206496.1|2541236_2543561_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.1	9.4e-92
WP_024423135.1|2543642_2543993_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_024423136.1|2544094_2544583_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_073206500.1|2544770_2546999_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.8	1.0e-31
WP_003216788.1|2547040_2547337_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_056767987.1|2547453_2549004_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_024423139.1|2549005_2549668_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_024423140.1|2549820_2550198_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_008360993.1|2550246_2550513_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_073206504.1|2550560_2551706_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	2.5e-85
WP_024423142.1|2551737_2552766_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_012010741.1|2552800_2553001_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_024423143.1|2552993_2553998_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.0	1.1e-07
WP_024423144.1|2554009_2554615_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_044331597.1|2554763_2555276_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_034279877.1|2555503_2556148_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_019743430.1|2556180_2556360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167364625.1|2556555_2556702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073206507.1|2556737_2558498_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_024423148.1|2558966_2559599_+	LysE family transporter	NA	NA	NA	NA	NA
WP_024423149.1|2559644_2560262_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_073206510.1|2560395_2561667_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_073206513.1|2561798_2562908_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_034621107.1|2562894_2563758_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_073206516.1|2563739_2565314_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_081372088.1|2565399_2566551_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	31.0	1.1e-29
WP_024423154.1|2566554_2567097_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_024427846.1|2567120_2567999_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_008342790.1|2568017_2568461_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_024423156.1|2568516_2569803_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_024423157.1|2569824_2570418_-	sporulation initiation phosphotransferase B	NA	NA	NA	NA	NA
WP_003216586.1|2570674_2570959_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_073206522.1|2570971_2571310_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003216781.1|2571324_2571633_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_024423159.1|2571784_2572654_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_073206525.1|2572646_2573438_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_017358134.1|2573657_2574461_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024423161.1|2574463_2575147_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_073206528.1|2575201_2575720_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_024423163.1|2575716_2576616_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_007501538.1|2576643_2577663_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_034325207.1|2578178_2578331_+	hypothetical protein	NA	M5ABW1	Bacillus_phage	76.7	1.6e-05
WP_073206534.1|2578353_2578542_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	75.8	7.7e-21
WP_073206538.1|2578610_2578790_+	Arm DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_073206541.1|2578943_2580071_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	40.6	2.1e-68
WP_073206544.1|2580167_2580599_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_073206550.1|2580617_2581037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206553.1|2581314_2582115_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	54.1	8.3e-64
WP_073206557.1|2582174_2582438_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	4.8e-29
WP_073206560.1|2582457_2582670_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	54.5	1.1e-12
WP_073206564.1|2582703_2582844_-	XkdX family protein	NA	NA	NA	NA	NA
WP_073206567.1|2582840_2583113_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	39.8	3.2e-12
WP_073206570.1|2583127_2584729_-|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	46.0	4.8e-47
WP_081372089.1|2584740_2586516_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K1Y5U2	Streptomyces_phage	27.7	2.1e-35
WP_073206573.1|2586654_2588556_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	28.8	1.2e-47
WP_073206576.1|2588564_2589392_-|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	27.5	2.1e-14
WP_073206579.1|2589388_2593051_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	40.7	7.8e-125
WP_073206582.1|2593279_2593603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206585.1|2593677_2594286_-	hypothetical protein	NA	A0A2H4J5N7	uncultured_Caudovirales_phage	33.1	5.2e-10
WP_073206587.1|2594300_2594693_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_073206589.1|2594689_2595073_-	HK97 gp10 family phage protein	NA	A0A0M5M1E5	Enterococcus_phage	39.8	7.8e-12
WP_073206592.1|2595072_2595405_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_073206596.1|2595386_2595689_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_073206599.1|2595701_2596862_-|capsid	phage major capsid protein	capsid	A0A2H4J312	uncultured_Caudovirales_phage	49.6	4.1e-72
WP_073206602.1|2596914_2597505_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0MFL1	Staphylococcus_phage	49.7	2.2e-45
WP_073206605.1|2597482_2598718_-|portal	phage portal protein	portal	A0A1J0MFU3	Staphylococcus_phage	36.5	9.8e-64
WP_073206609.1|2598724_2598925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206612.1|2598939_2600667_-|terminase	terminase large subunit	terminase	A0A1Q1PW18	Staphylococcus_phage	47.0	7.3e-142
WP_073206615.1|2600653_2601142_-|terminase	phage terminase small subunit P27 family	terminase	D2JLE3	Staphylococcus_phage	33.6	2.4e-13
WP_073206619.1|2601404_2601782_-	HNH endonuclease	NA	H9A108	Staphylococcus_phage	37.4	5.2e-08
WP_073206625.1|2602092_2602437_-	structural protein	NA	Q38579	Bacillus_phage	55.3	4.5e-27
WP_073206629.1|2602611_2603046_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	49.3	5.3e-33
WP_167364626.1|2603062_2603209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073208380.1|2603314_2603506_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	41.5	1.6e-05
WP_073206633.1|2603593_2603830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081372091.1|2603857_2604073_-	hypothetical protein	NA	Q38589	Bacillus_phage	78.8	3.6e-22
WP_073206636.1|2604072_2604597_-	hypothetical protein	NA	D6R425	Bacillus_phage	81.0	9.2e-80
WP_073206640.1|2604599_2604770_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	1.0e-08
WP_073206643.1|2604766_2605306_-	ERCC4 domain-containing protein	NA	Q9ZXC2	Bacillus_phage	91.1	2.2e-89
WP_073206647.1|2605302_2605740_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	76.6	3.8e-63
WP_073206650.1|2606009_2608442_-	DNA primase	NA	D6R422	Bacillus_phage	81.6	0.0e+00
WP_073206653.1|2608502_2608940_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	86.2	1.6e-69
WP_073206656.1|2608961_2609159_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	75.0	8.6e-15
WP_073206658.1|2609148_2610096_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	90.1	3.0e-161
WP_073206661.1|2610099_2610648_-	host-nuclease inhibitor Gam family protein	NA	Q9ZXC8	Bacillus_phage	74.5	8.7e-73
WP_073206664.1|2610847_2611117_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	59.8	3.3e-25
WP_167364627.1|2611113_2611269_-	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	50.0	1.2e-06
WP_073206667.1|2611337_2611610_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	85.6	5.0e-37
WP_073206670.1|2611863_2612292_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	75.4	1.2e-50
WP_073206673.1|2612309_2612747_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	68.9	2.0e-48
WP_073206676.1|2612793_2614212_+	recombinase family protein	NA	Q9T200	Bacillus_phage	70.9	8.3e-192
WP_073206682.1|2614658_2615228_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_051170125.1|2615405_2616614_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_073206684.1|2616579_2617311_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_035390988.1|2618371_2618617_-	DUF3951 domain-containing protein	NA	NA	NA	NA	NA
WP_073206687.1|2618649_2619861_-	cytochrome P450	NA	NA	NA	NA	NA
WP_073206690.1|2619958_2630191_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.2	2.3e-190
WP_073206693.1|2630187_2650149_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.1	1.2e-200
WP_073206697.1|2651606_2652911_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_073206700.1|2652976_2655619_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.6	2.4e-160
WP_003216497.1|2656076_2656265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073206704.1|2656316_2657348_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_073206706.1|2657385_2658714_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039180405.1|2658848_2660141_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029706177.1|2660168_2661137_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_073206709.1|2661136_2661928_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_024423173.1|2661924_2662857_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024423174.1|2662894_2663725_-	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_024423175.1|2663732_2665100_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_034279808.1|2665342_2665828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024423177.1|2666042_2666630_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_073206712.1|2666626_2668951_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	5.9e-179
WP_073206715.1|2669122_2670784_-|protease	ATP-dependent protease LonB	protease	NA	NA	NA	NA
WP_024423180.1|2670920_2672186_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.0	8.6e-148
>prophage 11
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2703520	2728705	3935874	protease,head,plate,terminase,tail,capsid,portal,holin	Bacillus_phage(60.0%)	26	NA	NA
WP_035701812.1|2703520_2705044_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	51.1	1.4e-141
WP_073206738.1|2705203_2706145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035701814.1|2706218_2706407_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	80.6	4.1e-22
WP_073206741.1|2706551_2707043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073206744.1|2707317_2708115_-	N-acetylmuramoyl-L-alanine amidase	NA	M4ZRP4	Bacillus_phage	64.2	5.9e-86
WP_060596919.1|2708161_2708581_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	75.8	4.8e-47
WP_059375570.1|2708624_2708804_-	XkdX family protein	NA	NA	NA	NA	NA
WP_073206747.1|2708800_2709100_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	40.2	4.5e-07
WP_073206750.1|2709117_2710476_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	55.7	1.2e-51
WP_073206753.1|2710489_2712364_-	right-handed parallel beta-helix repeat-containing protein	NA	Q9ZXE2	Bacillus_phage	48.3	6.3e-22
WP_073206756.1|2712401_2714156_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	67.9	9.8e-219
WP_073206759.1|2714167_2715004_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	66.1	1.2e-102
WP_073206762.1|2715004_2719450_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	51.3	1.5e-77
WP_017358183.1|2719626_2719989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358184.1|2720045_2720657_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	39.4	2.1e-11
WP_073206765.1|2720638_2721058_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_073206768.1|2721054_2721459_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_017358187.1|2721458_2721773_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	35.3	5.4e-11
WP_073206770.1|2721762_2722071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	4.8e-12
WP_017358189.1|2722083_2722482_-	hypothetical protein	NA	D6R3Z0	Bacillus_phage	49.7	4.8e-12
WP_073206772.1|2722509_2723805_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.7	1.9e-94
WP_073206775.1|2723844_2724465_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	71.1	4.6e-78
WP_073206778.1|2724427_2725708_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	60.4	1.3e-143
WP_073208386.1|2725891_2727583_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.5	7.1e-206
WP_073206784.1|2727597_2728113_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	45.2	6.3e-33
WP_073206787.1|2728339_2728705_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	1.5e-28
>prophage 12
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2732439	2741908	3935874	integrase	Bacillus_phage(46.67%)	22	2730254:2730266	2734689:2734701
2730254:2730266	attL	GTTTAACTGTTTT	NA	NA	NA	NA
WP_017358204.1|2732439_2732982_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.1	8.1e-55
WP_073206808.1|2732978_2733428_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	52.9	9.1e-36
WP_073206812.1|2733654_2734092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206815.1|2734181_2734607_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	92.9	2.7e-69
WP_073206818.1|2734603_2734882_-	hypothetical protein	NA	A0A222Z5X2	Bacillus_phage	60.0	2.0e-25
2734689:2734701	attR	AAAACAGTTAAAC	NA	NA	NA	NA
WP_073206821.1|2734884_2735112_-	hypothetical protein	NA	A0A0A0RMF3	Bacillus_phage	43.2	3.7e-09
WP_081372094.1|2735108_2735591_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	90.6	3.4e-73
WP_073206827.1|2735587_2735980_-	hypothetical protein	NA	A0A2I7QM24	Vibrio_phage	43.5	1.1e-08
WP_073206830.1|2735979_2736360_-	hypothetical protein	NA	E5DV92	Deep-sea_thermophilic_phage	38.0	4.0e-16
WP_073206833.1|2736359_2736548_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	73.5	2.4e-06
WP_073206836.1|2736544_2736991_-	hypothetical protein	NA	O64129	Bacillus_phage	82.0	2.4e-60
WP_073206839.1|2737022_2737862_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0S2SXP3	Bacillus_phage	56.8	8.1e-86
WP_073206842.1|2737858_2738107_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	74.1	4.7e-26
WP_073206845.1|2738103_2738340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017358222.1|2738760_2738970_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.2	1.5e-09
WP_167364630.1|2739036_2739210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117590493.1|2739225_2739360_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_167364631.1|2739359_2739500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206849.1|2739468_2739999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167364632.1|2739995_2740151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073206851.1|2740257_2741079_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	39.2	1.3e-51
WP_073206855.1|2741062_2741908_-	conserved phage C-terminal domain-containing protein	NA	A0A0U3TZZ4	Bacillus_phage	53.7	6.1e-65
>prophage 13
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	2953466	3022069	3935874	plate,terminase,tail,capsid,portal,holin	uncultured_Caudovirales_phage(24.24%)	77	NA	NA
WP_034279395.1|2953466_2953871_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_024424925.1|2954024_2954216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024424926.1|2954343_2954781_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	64.1	9.1e-49
WP_003217544.1|2954912_2955059_+	YtzI protein	NA	NA	NA	NA	NA
WP_024424927.1|2955067_2955505_-	FixH family protein	NA	NA	NA	NA	NA
WP_003217624.1|2955623_2956097_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_024424928.1|2956223_2956448_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	71.6	9.5e-26
WP_024424929.1|2956449_2957016_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_024424930.1|2957230_2958214_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024424931.1|2958290_2958533_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_024424932.1|2958709_2960041_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_073207125.1|2960057_2961110_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_008360682.1|2961178_2961337_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_024424934.1|2961362_2961554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073207128.1|2961660_2962785_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_073207130.1|2962771_2964232_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	36.4	2.2e-83
WP_024424937.1|2964303_2965122_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_044332232.1|2965142_2965964_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	A0A2D1G8C7	Mycobacterium_phage	32.0	3.1e-05
WP_073207133.1|2965945_2967691_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_073207136.1|2967683_2969102_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_073207138.1|2969482_2970421_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_056766975.1|2970539_2971274_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_024424942.1|2971360_2971837_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_056765981.1|2979833_2980409_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_024423229.1|2980501_2980690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073207141.1|2980649_2981204_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024423231.1|2981375_2982014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024423232.1|2982028_2983183_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_081372127.1|2983188_2984322_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_024423234.1|2984352_2985900_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.9	9.5e-08
WP_024423235.1|2985911_2986442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073207143.1|2987169_2988378_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_073207145.1|2988405_2989875_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_034284303.1|2990082_2990640_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073207150.1|2991591_2992341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073207156.1|2993451_2993820_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	35.2	2.5e-15
WP_073207159.1|2994218_2994401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024423241.1|2994517_2995321_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.1	5.4e-63
WP_019743388.1|2995340_2995604_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	7.7e-27
WP_017367922.1|2995615_2995828_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	5.1e-13
WP_080652903.1|2995864_2996005_-	XkdX family protein	NA	NA	NA	NA	NA
WP_024425888.1|2996004_2996325_-	hypothetical protein	NA	O64053	Bacillus_phage	53.7	1.4e-19
WP_073207162.1|2996337_2997723_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	31.1	1.5e-25
WP_073207165.1|2997771_2998899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073207168.1|2998906_2999080_-|portal	phage portal protein	portal	A0A2H4JAA1	uncultured_Caudovirales_phage	51.0	1.4e-08
WP_073207171.1|2999076_2999406_-	XkdW family protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	35.6	1.8e-09
WP_073207174.1|2999416_3000295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024423249.1|3000310_3000694_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_073207176.1|3000705_3001629_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.2	9.4e-11
WP_024423251.1|3001612_3002662_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	2.5e-68
WP_024423252.1|3002654_3003077_-	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	34.1	4.6e-05
WP_073207179.1|3003091_3003358_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	6.2e-08
WP_073207182.1|3003354_3004365_-|portal	phage portal protein	portal	H7BV96	unidentified_phage	28.4	7.8e-35
WP_041085438.1|3004376_3005045_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	30.1	2.7e-23
WP_073207183.1|3005037_3009120_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.2e-44
WP_095357030.1|3009120_3009258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012011040.1|3009299_3009740_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	9.9e-11
WP_073207186.1|3009891_3009981_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_024423257.1|3010264_3010708_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	5.8e-27
WP_044332541.1|3010709_3012056_-|tail	phage tail sheath family protein	tail	A0A0A7S087	Clostridium_phage	40.8	1.6e-80
WP_003212736.1|3012059_3012272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073207189.1|3012258_3012714_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_073207192.1|3012718_3013216_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	1.2e-36
WP_073207194.1|3013212_3013569_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_024423261.1|3013565_3013949_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_024425904.1|3013962_3014886_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.6	1.2e-109
WP_073207197.1|3014908_3015997_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	41.8	2.5e-63
WP_034624554.1|3016035_3017493_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.5	5.4e-138
WP_167364638.1|3017489_3018791_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.8	2.9e-151
WP_024423266.1|3018799_3019444_-	helix-turn-helix domain-containing protein	NA	A0A2P1JTW4	Anoxybacillus_phage	44.7	2.9e-43
WP_073207201.1|3019596_3020115_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	46.9	2.3e-35
WP_024423268.1|3020244_3020451_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	2.6e-14
WP_024423269.1|3020447_3020849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024423270.1|3020899_3021130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162860191.1|3021119_3021272_-	hypothetical protein	NA	A0A2H4J4L6	uncultured_Caudovirales_phage	58.3	5.6e-06
WP_034624558.1|3021268_3021532_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024425910.1|3021691_3022069_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.5	6.1e-17
>prophage 14
NZ_CP018197	Bacillus safensis strain KCTC 12796BP chromosome, complete genome	3935874	3329305	3338319	3935874		Streptococcus_phage(33.33%)	9	NA	NA
WP_073207521.1|3329305_3330283_+	D-glycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	27.8	5.4e-17
WP_044334262.1|3330460_3330949_+	ribonuclease	NA	NA	NA	NA	NA
WP_073207523.1|3331002_3331746_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_024423549.1|3331784_3332042_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003213321.1|3332068_3333019_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.5	1.6e-50
WP_024423551.1|3333036_3333996_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.4	3.8e-63
WP_073208416.1|3333996_3334884_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	3.3e-05
WP_145925736.1|3335745_3336696_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	4.1e-86
WP_024423554.1|3336930_3338319_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	54.3	2.8e-27
