The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018304	Mycobacterium tuberculosis strain M0002959-6, complete genome	4386447	2930070	2968342	4386447	integrase,head,capsid,protease,terminase,tRNA	Mycobacterium_phage(30.0%)	48	2958871:2958898	2968495:2968522
WP_003413486.1|2930070_2932149_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2932257_2932485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2932481_2933867_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2934211_2934712_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2934728_2935169_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2935315_2935993_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2935977_2936331_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2936343_2936769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2936765_2937440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2937517_2938339_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2938474_2939368_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2939370_2940189_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2940203_2941385_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2941443_2941875_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2942388_2943630_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2943939_2944302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2944648_2945773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2945774_2946314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2946453_2947752_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2947790_2948072_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2948216_2948702_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2948728_2948986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2948986_2951323_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2951351_2951594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2951594_2952272_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2952467_2953124_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2953286_2953733_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2953907_2954240_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2954359_2954719_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2954820_2955279_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2955414_2955795_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2955791_2957288_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2957477_2957714_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2957786_2957960_+	hypothetical protein	NA	NA	NA	NA	NA
2958871:2958898	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2959004_2959436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2959432_2960431_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2960444_2960909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2960896_2961148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899411.1|2961318_2962758_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2962765_2963299_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2963451_2964078_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_052635321.1|2964109_2964433_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2964512_2964758_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2964754_2966182_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2966183_2966576_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2966572_2966833_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2966849_2967212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2967214_2968342_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2968495:2968522	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
