The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	254697	306558	5474890	transposase,integrase,plate,tail	Escherichia_phage(31.25%)	49	271945:271959	306974:306988
WP_000246434.1|254697_256029_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256031_256556_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256552_257833_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257857_258940_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258903_260754_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260757_261171_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261261_262653_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262703_262928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262962_263463_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264159_264678_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264887_267029_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_053920115.1|267104_271328_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|271529_271793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|271707_271893_-	protein YncO	NA	NA	NA	NA	NA
271945:271959	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|271973_273146_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|273263_274034_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|274187_274661_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|274703_277148_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|277387_277966_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|278070_278838_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|278808_279549_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|279704_279965_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|279983_280244_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|280429_281203_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|282020_283760_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|283704_284490_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|284560_285616_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|285667_285961_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|285963_286362_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_072640241.1|286371_286824_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|287130_287397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|287329_287866_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|287922_289380_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|289640_290099_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|290190_291435_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|291492_291894_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|291932_292988_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|293275_294379_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|294390_295644_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|296713_296959_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_085948178.1|297285_298499_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000344820.1|298616_299060_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|299031_299625_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115574.1|299624_300119_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000904979.1|300148_300703_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_072640262.1|300760_301543_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.6	7.3e-49
WP_085948178.1|301580_302793_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000246059.1|303670_304414_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|305376_306558_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
306974:306988	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	885486	924899	5474890	protease,lysis,portal,integrase,terminase,holin,transposase,tail	Enterobacteria_phage(52.27%)	51	874928:874942	907222:907236
874928:874942	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|885486_886557_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|886534_886753_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|886792_886960_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|887202_887805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|888015_888237_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|888335_888617_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|888627_888819_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|888791_888974_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|888970_889651_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|890348_890531_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|890527_890698_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|890690_891311_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|891307_891973_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|892184_893144_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|893481_893604_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|893618_894308_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|894491_895235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|895320_895479_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|895559_895958_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|896100_896316_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|896315_896813_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|896809_897277_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|897264_897417_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|898091_898583_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|898582_900685_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|900681_900894_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072187152.1|900821_901946_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_127446149.1|902067_902403_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|902347_904375_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|904461_904785_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|904777_905053_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|905064_905643_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|905639_906041_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|906051_906795_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|906855_907242_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
907222:907236	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|907250_907580_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_085948178.1|909851_911064_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001417032.1|911048_911930_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	94.9	1.2e-137
WP_000447253.1|911929_912259_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|912268_912967_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|912972_913716_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|913652_914261_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|914321_917735_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|917805_918405_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|918464_919781_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|919782_920052_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|920228_921209_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|921242_922262_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|922758_922920_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|923088_923970_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|924200_924899_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	1200931	1270635	5474890	protease,portal,integrase,terminase,holin,head,transposase,tail	Enterobacteria_phage(25.53%)	81	1209419:1209434	1230785:1230800
WP_000156526.1|1200931_1202692_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1202877_1203330_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1203405_1204446_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1204802_1205312_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1205530_1206160_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1206122_1208285_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1208294_1208741_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1208863_1210918_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1209419:1209434	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1210949_1211408_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1211503_1212166_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1212338_1212752_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1212796_1213114_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1213171_1214362_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1214456_1214735_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1214731_1215061_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1215151_1215811_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1216218_1217238_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1217215_1217458_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1217525_1219997_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1220090_1220282_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1220278_1220467_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1221040_1221226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1221412_1221802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1221943_1222099_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1222376_1222664_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1222663_1222855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1222882_1223284_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1223392_1223665_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1223648_1224074_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1224280_1224736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1224814_1225906_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1225912_1226659_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1226680_1227451_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1227466_1227880_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1228231_1229005_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1229370_1229508_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1229552_1229765_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1229932_1230211_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1230212_1231262_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1230785:1230800	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1231274_1231646_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1231635_1232007_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1232158_1232977_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1233263_1233503_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1233597_1234311_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1235078_1236929_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1237104_1238317_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1238522_1238837_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1239364_1239550_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1239771_1239885_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1240105_1240639_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1240798_1241071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1241326_1241533_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1242283_1242559_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1242634_1243015_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1243011_1243359_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1243408_1244947_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1244996_1245239_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_001302857.1|1245210_1247139_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1247122_1247329_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1247325_1248918_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1248907_1250413_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1250449_1250797_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1250854_1251121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1251102_1251843_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1251856_1252288_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1252314_1252728_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_072640321.1|1252708_1255288_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_000847298.1|1255284_1255614_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|1255613_1256312_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|1256322_1257066_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_162779756.1|1257011_1257644_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.9e-101
WP_000649829.1|1257834_1258362_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072618954.1|1258495_1259671_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_149025607.1|1259622_1261968_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_001230508.1|1262035_1262635_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268962.1|1262699_1264013_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1264014_1264284_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1266416_1267535_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1267531_1269325_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1269343_1270051_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1270047_1270635_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	1363079	1402959	5474890	transposase,protease,integrase	Stx2-converting_phage(41.67%)	36	1357249:1357264	1375149:1375164
1357249:1357264	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|1363079_1364282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282209.1|1364468_1366286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1367397_1367694_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1367920_1368118_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335698.1|1368336_1369722_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1370542_1371106_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1371260_1373621_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998048.1|1374377_1375916_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
1375149:1375164	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_000612591.1|1375965_1376313_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1376309_1376690_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_032210650.1|1377180_1378035_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	7.0e-69
WP_064759902.1|1378081_1378675_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_085948178.1|1378726_1379939_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303891.1|1380047_1380299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1380322_1380613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024297.1|1381298_1381658_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591997.1|1381750_1383370_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1383594_1383870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010904558.1|1384250_1384949_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1385039_1385342_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1385350_1385671_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065682.1|1385663_1387367_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966485.1|1387376_1387841_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1387841_1388516_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021389.1|1388527_1389145_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1390356_1390620_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1390921_1391062_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397129.1|1391933_1392605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1394942_1395368_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1395364_1395715_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1395745_1397359_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957248.1|1398301_1398643_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001176766.1|1399219_1399687_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1399704_1400913_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1400923_1401880_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1401879_1402959_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 5
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	1533716	1654728	5474890	protease,transposase,tRNA,portal,lysis,integrase,terminase,holin,head,capsid,tail	Enterobacteria_phage(37.61%)	154	1598309:1598324	1626563:1626578
WP_000952736.1|1533716_1534538_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1534693_1535740_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1535736_1536531_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1536697_1537816_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1537784_1538054_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1538115_1538505_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1538637_1539153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1539267_1539420_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1539735_1540212_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1540336_1540660_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1540643_1541069_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1541137_1542175_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1542086_1542629_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1542662_1543379_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1543375_1543693_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1543689_1543992_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1543981_1544299_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1544252_1544570_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1544556_1544994_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1544995_1545187_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1545189_1545777_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1545892_1545997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1546185_1546398_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1546565_1546844_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1546845_1547895_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1547907_1548282_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1548278_1549100_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1549696_1549864_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|1550178_1552116_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1552263_1552446_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1552483_1552753_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1552828_1553044_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1553048_1553393_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1553443_1553977_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1554247_1554817_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1554816_1554963_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1555190_1555397_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1555461_1555686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1556042_1556183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032173704.1|1556312_1556498_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000279796.1|1556539_1556905_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1557195_1557759_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1557755_1559417_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1559480_1561418_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1561462_1561684_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1561629_1564131_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1564210_1564537_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1564546_1564897_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1564893_1565340_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1565336_1565681_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1565739_1566456_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1566461_1566836_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1566931_1567141_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|1567193_1570436_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|1570428_1570770_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1570769_1571468_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1571484_1571739_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1571848_1571959_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1572261_1573140_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1573193_1573931_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1573876_1574113_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1574125_1574215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1574234_1576583_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1577173_1580575_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1582678_1582804_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1582883_1583159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1583219_1584581_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1584944_1585808_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1585791_1586928_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1587177_1588404_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1588452_1589574_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1589822_1591052_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1591416_1591605_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1591654_1591981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1592105_1592279_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1592409_1592607_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1592599_1592812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1592801_1593266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1593258_1593492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1593497_1593797_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1593793_1595194_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1595394_1595646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1595642_1596053_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1596063_1596336_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1596462_1596687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1596938_1597145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1597144_1598200_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1598212_1598548_+|head	head decoration protein	head	NA	NA	NA	NA
1598309:1598324	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1598560_1598974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1599179_1599722_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1599977_1600259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1600859_1602320_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1602319_1602991_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1603159_1604530_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1604533_1605175_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1605210_1606317_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1606370_1606832_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1606841_1607495_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1607666_1608917_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1609030_1610173_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1610162_1610399_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1610502_1611327_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1611323_1612025_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1612021_1612324_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1612391_1612724_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1612788_1612911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1612968_1614495_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1614996_1615452_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1615451_1615622_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1615614_1615905_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1615901_1616264_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1616260_1616401_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1616397_1617087_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1617408_1617714_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1617700_1618177_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1618393_1618576_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1618666_1618960_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1619251_1619662_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1619947_1620154_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1620318_1620513_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1620901_1621447_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1621421_1623347_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1623343_1623550_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1623546_1625148_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1625128_1626448_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1626457_1626790_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1626563:1626578	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1626845_1627871_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1627912_1628311_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1628322_1628676_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000683120.1|1629261_1629657_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001143002.1|1629664_1630405_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1630420_1630843_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1630824_1631259_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1631251_1633801_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1633797_1634127_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1634126_1634825_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1634830_1635574_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1635510_1636143_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1636203_1639602_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1639668_1640268_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1640332_1643248_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1643247_1643829_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1643948_1644839_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1644857_1645364_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1645400_1645901_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1645979_1646162_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1646659_1647328_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1647384_1647633_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1647708_1648089_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1648085_1648433_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1648482_1650021_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1650323_1651808_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1651994_1652948_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_085948178.1|1653514_1654728_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	1752282	1851561	5474890	transposase,portal,integrase,terminase,holin,head,capsid,tail	Escherichia_phage(31.13%)	125	1745008:1745021	1761829:1761842
1745008:1745021	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|1752282_1753413_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1753390_1753639_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1753703_1756175_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1756267_1756459_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1756455_1756644_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1757041_1757209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1757202_1757436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1757413_1757821_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1757843_1758062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1758134_1758434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1758697_1759105_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1759181_1759409_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1759392_1759944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1759915_1760956_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1760867_1761410_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1761596_1762178_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
1761829:1761842	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|1762174_1762339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1763037_1763796_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1764074_1764287_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1764507_1764765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1764834_1765113_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1765114_1766161_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1766173_1766533_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1766541_1767072_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1767313_1767511_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1767661_1768720_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1769516_1771370_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1771519_1771735_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1771739_1772084_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1772134_1772668_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1772938_1773508_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1773507_1773654_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1773881_1774067_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1774491_1774719_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1774760_1775126_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1775416_1775980_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1775976_1777638_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1777701_1779639_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1779683_1779905_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1782368_1782695_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1782704_1783055_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1783051_1783498_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1783494_1783839_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1783897_1784614_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1784619_1784994_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1785089_1785299_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|1785351_1788594_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|1788586_1788928_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|1788927_1789365_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_064234950.1|1789552_1792813_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|1792815_1793031_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|1793098_1793698_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234952.1|1793762_1794977_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.5	3.9e-81
WP_001023362.1|1794978_1795248_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|1796424_1797075_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|1797657_1799196_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1799245_1799593_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1799589_1799970_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|1800932_1801247_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|1801885_1803130_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|1803222_1803411_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1803407_1803596_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|1804160_1804370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1804370_1805009_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|1805020_1805173_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|1805465_1805804_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1806195_1806438_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|1806421_1806847_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|1806915_1807959_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|1807951_1808413_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|1808446_1809163_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_072640384.1|1809195_1809465_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.0	6.9e-23
WP_085948178.1|1809470_1810683_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000699809.1|1810786_1811014_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1811006_1811318_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|1811445_1811664_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1811665_1812223_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1812456_1812669_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1812788_1813133_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1813254_1813527_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1813528_1814578_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|1814590_1814896_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|1814958_1815513_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1815737_1815935_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1816070_1816784_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|1817234_1817666_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|1818143_1819994_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|1820441_1820648_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731241.1|1820652_1820997_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1821047_1821581_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1821851_1822421_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|1822420_1822567_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|1822789_1822975_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1823500_1823815_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1823896_1824121_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1824507_1825053_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|1825027_1826953_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|1826949_1827156_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1827152_1828754_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1828734_1830054_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1830063_1830396_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1830451_1831477_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1831518_1831917_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1831928_1832282_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1832296_1832830_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1832826_1833222_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1833229_1833982_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1833995_1834418_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1834444_1834858_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|1834838_1837451_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|1837447_1837777_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|1837776_1838475_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|1838485_1839229_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_071601640.1|1839174_1839804_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_064234939.1|1840044_1843524_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230508.1|1843591_1844191_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_046671432.1|1844255_1845569_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|1845570_1845840_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|1845953_1846529_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1846601_1847231_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1847312_1847954_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|1848115_1848430_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1848489_1849773_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1849861_1851322_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1851357_1851561_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	2120851	2188460	5474890	capsid,protease,portal,head,terminase,holin,transposase,tail	Stx2-converting_phage(41.51%)	72	NA	NA
WP_000422055.1|2120851_2121901_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2122120_2122879_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2122875_2123466_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2123505_2124378_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2124590_2126174_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2126201_2126822_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2126818_2127700_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2127837_2127882_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2127973_2129536_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2129535_2131131_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001417165.1|2131134_2132493_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000209521.1|2132504_2133698_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2133697_2134504_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2134884_2135064_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2135149_2135650_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2135695_2136202_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|2136703_2136922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|2139672_2140263_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2140446_2141094_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2141230_2141377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2141804_2142083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2142422_2142803_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2142799_2143147_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2143196_2144735_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2145700_2146270_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2146335_2147247_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2147353_2147476_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2149073_2150399_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2151426_2151696_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2151697_2153011_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2153162_2153762_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2153829_2156175_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2156126_2157302_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2157644_2158277_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2158222_2158966_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001152184.1|2158976_2159675_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2159674_2160016_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072617014.1|2160008_2163251_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.5	0.0e+00
WP_001453698.1|2163303_2163513_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2163608_2163983_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2163988_2164705_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2164763_2165108_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2165104_2165551_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2165547_2165898_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2165907_2166234_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2166313_2168815_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2168760_2168982_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2169026_2170964_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2171027_2172689_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2172685_2173249_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|2173539_2173905_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2173946_2174174_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2174598_2174784_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2175011_2175158_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2175157_2175727_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2175997_2176531_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2176581_2176926_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2176930_2177137_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|2177585_2179436_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2179914_2180343_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2180980_2181670_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2181666_2182026_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2182038_2183088_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2183089_2183368_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2183535_2183748_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2183936_2184041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2184156_2184741_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2184797_2185193_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2186003_2186744_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2186750_2187713_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2187735_2188161_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2188157_2188460_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	2502026	2553148	5474890	transposase,integrase,tail,tRNA	Enterobacteria_phage(60.0%)	59	2495250:2495265	2553227:2553242
2495250:2495265	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2502026_2503760_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2503936_2504425_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2504544_2504937_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2504936_2507015_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2507007_2508156_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2508357_2509002_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2509012_2509402_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2509416_2510466_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2510468_2511329_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2511347_2512949_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2512994_2514656_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2514798_2515302_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_072640356.1|2515322_2517287_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795629.1|2517291_2518218_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2518214_2519102_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2519228_2519807_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2519809_2520160_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2520939_2521368_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2521374_2522799_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2522773_2523574_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987892.1|2523740_2524730_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2524741_2526256_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2526325_2527315_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2528111_2528615_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2528694_2528946_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2529060_2529147_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2529408_2529732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2529902_2530400_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2530436_2530676_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2530867_2532079_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2532140_2532806_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2533162_2534164_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2534169_2534517_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2534546_2535197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2535212_2535617_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2535706_2535844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2535915_2536119_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2536140_2536491_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2536501_2536780_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2536791_2537034_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2537030_2537144_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2537236_2537653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2537676_2537880_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2537876_2538143_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2538139_2538439_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2538450_2539068_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2539064_2539430_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2539436_2542259_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2542335_2543295_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2543299_2543614_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2544819_2545236_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2545279_2545852_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2546008_2546497_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2549299_2549428_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2549463_2549829_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2549883_2550396_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2550395_2551580_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2551737_2552061_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2552011_2553148_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2553227:2553242	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	2610727	2679604	5474890	portal,integrase,holin,terminase,head,transposase,tail	Escherichia_phage(34.78%)	68	2626525:2626540	2682209:2682224
WP_001023445.1|2610727_2610997_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_064234941.1|2610998_2612312_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001230509.1|2612376_2612976_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_072640358.1|2613043_2616523_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_077775224.1|2616763_2617393_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_000194760.1|2617338_2618082_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_060722696.1|2618092_2618791_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000847304.1|2618790_2619120_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_134790849.1|2619116_2619881_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_001455418.1|2619832_2621695_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_000533402.1|2621675_2622089_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2622115_2622547_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2622560_2623301_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2623282_2623549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2623606_2623954_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2623990_2625496_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2625485_2627078_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2626525:2626540	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2627074_2627281_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2629166_2629676_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2630070_2630295_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2630376_2630691_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2631225_2631411_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2631638_2631770_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2631782_2631965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2632120_2632654_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2632704_2633049_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2633053_2633260_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2633579_2634792_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2634874_2636725_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2638264_2638954_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2638950_2639310_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2639322_2640372_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2640373_2640652_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2640819_2641032_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2641218_2641323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2641432_2641996_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2642122_2642434_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2642430_2642583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2642615_2642972_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2642968_2643193_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2643214_2643913_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2643947_2644490_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2644401_2645439_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2645507_2645933_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2645929_2646157_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2646254_2646899_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2647173_2647326_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2647806_2647995_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2647991_2648180_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|2648275_2650747_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2650805_2651009_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2651008_2652031_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2652266_2653064_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_085948178.1|2656821_2658034_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000480501.1|2663446_2664499_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2664812_2666129_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2666230_2667685_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2668027_2668744_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2669369_2671013_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_053920127.1|2671130_2672081_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2672182_2673100_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2673556_2674492_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2674553_2675633_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2675644_2676388_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2676384_2676930_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|2677291_2677672_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2677668_2678016_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2678065_2679604_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2682209:2682224	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 10
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	2776620	2814687	5474890	plate,tRNA,lysis,portal,integrase,holin,head,terminase,capsid,tail	Escherichia_phage(63.64%)	49	2780920:2780947	2812880:2812907
WP_000675144.1|2776620_2778024_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2778020_2778743_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2778933_2779266_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2779413_2780775_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2780920:2780947	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2781048_2781267_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2781348_2782512_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2782511_2782991_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2783005_2785453_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2785445_2785565_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2785597_2785873_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2785929_2786448_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001684736.1|2786460_2787651_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.0e-223
WP_000905094.1|2787710_2788304_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001145594.1|2788334_2788865_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.7e-100
WP_001057694.1|2788864_2789467_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|2789438_2789882_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_000217053.1|2789902_2791102_-|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001285352.1|2791098_2791710_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2791702_2792611_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2792615_2792963_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2792959_2793595_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001809.1|2793661_2794114_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_000917144.1|2794106_2794574_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2794536_2794710_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2794681_2795107_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2795094_2795520_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2795534_2796032_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2796031_2796313_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2796316_2796520_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2796519_2797029_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2797128_2797872_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2797875_2798949_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2799007_2799862_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2800035_2801808_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2801807_2802842_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2803159_2805127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2805126_2805579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2805625_2806849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2806938_2809221_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2809210_2809486_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2809482_2809707_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2809709_2810009_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2810008_2810233_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2810296_2810797_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|2810974_2811250_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2811371_2811671_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2811786_2812800_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2813064_2813382_-	hypothetical protein	NA	NA	NA	NA	NA
2812880:2812907	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2813787_2814687_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 11
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	2840312	2917031	5474890	tRNA,portal,lysis,integrase,head,terminase,holin,capsid,tail	Stx2-converting_phage(43.24%)	87	2864875:2864895	2914537:2914557
WP_001301615.1|2840312_2842346_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|2846308_2847589_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|2847752_2849294_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|2849303_2852933_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2852994_2853312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053920124.1|2854552_2855641_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2855651_2857181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2857199_2857931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2857923_2859060_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2859056_2861060_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2861184_2861646_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2861687_2862158_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2862204_2862924_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2862920_2864606_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2864875:2864895	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|2865120_2865369_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|2865530_2866172_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|2866253_2866670_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023353.1|2866830_2867100_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_064234935.1|2867101_2868415_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	2.4e-76
WP_001230508.1|2868479_2869079_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050546863.1|2872886_2873519_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2873464_2874202_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2874255_2875179_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2875249_2875423_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2875530_2875851_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|2875867_2876566_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|2876565_2876907_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2876899_2880142_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2880189_2880399_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2880494_2880869_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_072640363.1|2880883_2881600_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	98.7	4.0e-126
WP_000133388.1|2881658_2882003_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2881999_2882446_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007889.1|2882442_2882793_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125984.1|2882803_2883130_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_072640365.1|2883126_2885712_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.7	0.0e+00
WP_001063099.1|2885657_2885879_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2885923_2887861_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2887924_2889586_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2889582_2890146_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_000279809.1|2890437_2890803_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000095749.1|2890844_2891072_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2891534_2891792_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2891788_2892286_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|2892488_2892926_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|2892922_2893420_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000284515.1|2893419_2893635_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2893711_2893984_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143464.1|2894024_2894204_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_064234927.1|2894340_2896278_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000752026.1|2896777_2897047_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2897056_2898004_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204769.1|2898510_2898945_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2899030_2899171_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2899167_2899530_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|2899526_2899817_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2899809_2899980_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|2899979_2900435_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|2900431_2900533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|2900623_2900905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|2900948_2901146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|2901373_2901658_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|2901654_2902356_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|2902352_2903282_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|2903368_2903908_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|2904271_2904964_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|2905070_2906678_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|2907181_2907472_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|2907547_2907844_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2907849_2908635_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2908631_2909309_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2909308_2909491_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2909463_2909655_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2909665_2909947_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2910045_2910267_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2910263_2911211_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2911212_2911389_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2911722_2912079_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2912075_2912438_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2912525_2912768_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2912771_2912906_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2912924_2913179_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2913212_2914499_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2914519_2915221_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2914537:2914557	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2915280_2915388_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2915368_2916100_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2916104_2917031_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	3161408	3166795	5474890	integrase	Enterobacteria_phage(50.0%)	6	3151859:3151875	3163823:3163839
3151859:3151875	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3161408_3162341_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3162652_3163810_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3163984_3165121_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3163823:3163839	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3165130_3165811_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3165797_3166265_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3166264_3166795_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 13
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	3406967	3466329	5474890	tRNA,integrase,holin,transposase,tail	Enterobacteria_phage(31.58%)	60	3424415:3424429	3471289:3471303
WP_000997403.1|3406967_3408005_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3408211_3408631_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3408699_3409398_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3409429_3412090_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3412203_3413559_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464871.1|3413583_3413928_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3413924_3415223_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3420998_3423572_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3423701_3424433_-	polyphenol oxidase	NA	NA	NA	NA	NA
3424415:3424429	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|3424429_3425410_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3425544_3426282_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3426552_3426894_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3426997_3427045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3427143_3428304_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3428346_3429468_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3429478_3430549_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3430758_3431124_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3431273_3431792_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3431781_3433008_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3433023_3433506_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3433582_3433930_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3433971_3434739_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3434769_3435318_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3435336_3435585_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3435721_3437083_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3437174_3438041_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3438062_3439349_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3439403_3439997_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3440119_3440998_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3441083_3442745_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3442893_3443235_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3443296_3443587_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3443576_3444053_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3444184_3444667_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3445512_3445761_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3446262_3446853_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3447035_3447686_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3447764_3448823_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3448952_3449375_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3449535_3449805_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|3449806_3450373_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|3450422_3450770_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3450766_3451147_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3451503_3451848_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3451852_3452068_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072640370.1|3452217_3454071_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000499458.1|3454478_3454646_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3454731_3455475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3455727_3456351_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3456347_3457013_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3457009_3457621_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3457595_3458162_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3458515_3459271_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|3459306_3459609_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150585.1|3459684_3460875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3461270_3461684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052046.1|3461781_3462180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3462180_3463812_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|3463808_3465122_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3465123_3466329_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3471289:3471303	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 14
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	4536250	4566215	5474890	transposase,integrase,tRNA	Escherichia_phage(41.67%)	26	NA	NA
WP_001070177.1|4536250_4536940_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000147776.1|4536945_4539027_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747329.1|4539011_4539878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|4539880_4541086_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4541365_4542757_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001301814.1|4542877_4544587_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702966.1|4544639_4546958_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834456.1|4546967_4548350_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001067855.1|4549474_4550179_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|4550763_4551624_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|4551773_4552175_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|4552221_4552926_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240537.1|4553681_4554653_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|4554840_4555656_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4555716_4556520_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001067855.1|4557250_4557955_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4558105_4558921_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4559110_4559815_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000144779.1|4559851_4560508_-	hypothetical protein	NA	A0A2H4P756	Pseudomonas_phage	43.7	7.0e-45
WP_000571065.1|4560504_4561014_-	trimethoprim-resistant dihydrofolate reductase DfrA8	NA	A0A1B2IBQ4	Erwinia_phage	35.0	6.5e-14
WP_064234909.1|4561109_4561814_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_000935452.1|4561860_4563165_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001300294.1|4563203_4563872_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|4563907_4564144_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|4564140_4564503_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|4564520_4566215_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
>prophage 15
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	5080889	5095556	5474890	tRNA,integrase,tail	Enterobacteria_phage(40.0%)	18	5082170:5082185	5099701:5099716
WP_000956557.1|5080889_5081423_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|5081840_5082122_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5082170:5082185	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5082466_5082664_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5082999_5083284_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5083280_5083631_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5083621_5084158_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230302.1|5085481_5086081_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_064234994.1|5086145_5087459_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001023355.1|5087460_5087730_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5087841_5088414_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5088486_5089116_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143817.1|5089197_5089839_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_001217542.1|5089999_5090248_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5090309_5091407_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5091495_5092533_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5092666_5092909_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5093074_5094058_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5094140_5095556_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5099701:5099716	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 16
NZ_CP018241	Escherichia coli strain 319 chromosome, complete genome	5474890	5232435	5291446	5474890	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5232435_5233695_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5233697_5234702_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5234783_5234981_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5235084_5236383_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5236587_5237013_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5237051_5239493_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5239673_5240405_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5240531_5240933_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5240951_5241650_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5241700_5242360_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5242377_5242776_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5242785_5243424_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5243426_5244590_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_053920121.1|5244673_5246299_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5246415_5246691_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5246839_5247169_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569692.1|5247350_5248100_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5248096_5248852_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5250378_5251776_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5251791_5252097_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5252106_5252571_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5252584_5253235_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5253244_5254099_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5254098_5254785_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5254913_5255189_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5255515_5255911_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5255917_5256232_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5256236_5256464_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5256505_5256955_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5257025_5257820_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5258442_5258874_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5258881_5260090_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5260224_5260863_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5261080_5261701_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5262009_5263422_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5263466_5264129_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5264236_5265202_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5265309_5266170_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5266258_5266639_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5266756_5268700_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5268889_5269630_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5269841_5270780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5270842_5271397_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5271721_5271928_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5272006_5273350_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5273672_5274311_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5274516_5276250_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5276246_5280026_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5280028_5280370_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5280581_5280833_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5280826_5281177_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5281256_5281787_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5282096_5283053_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5283192_5284695_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5284708_5285731_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5285717_5286713_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5286745_5287744_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5287919_5289293_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5289448_5290000_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5290093_5291446_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP018242	Escherichia coli strain 319 plasmid pO157, complete sequence	92495	29207	37415	92495	integrase,transposase	Macacine_betaherpesvirus(50.0%)	8	25777:25790	32139:32152
25777:25790	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|30690_30771_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000772446.1|32611_33778_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
32139:32152	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|33777_34749_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|35443_36346_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|36349_36655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|36731_37415_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
