The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	215669	279998	5370710	transposase,tRNA,plate	uncultured_Caudovirales_phage(40.0%)	54	NA	NA
WP_000176537.1|215669_216965_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217017_217278_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217264_217465_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217630_218176_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218172_218583_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218596_219307_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219506_220331_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220383_222102_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222212_222920_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222916_223321_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223438_224254_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224293_224947_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224939_225971_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226158_226734_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232493_233297_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233293_234208_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234448_235249_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235326_236097_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236144_237503_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237574_238330_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238363_239086_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239082_239550_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239614_240346_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240883_241684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242161_242611_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242613_243210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243288_243510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243530_244010_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243975_245385_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001303798.1|245395_248830_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248966_250379_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250383_251127_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614377.1|251123_253907_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000343292.1|253915_254677_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246414.1|254681_256013_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256015_256540_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256536_257817_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257841_258924_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258887_260738_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260741_261155_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261245_262637_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262687_262912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262946_263447_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264143_264662_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264871_267013_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_115245597.1|267088_271321_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271460_272177_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339420.1|272358_273867_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_001690273.1|273935_274535_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275280_276417_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|276419_278180_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|278381_278645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278559_278745_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278825_279998_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	298777	378018	5370710	tail,transposase,terminase,plate,integrase,holin,capsid,protease,portal,head,lysis	Shigella_phage(42.37%)	96	301316:301332	384846:384862
WP_000749881.1|298777_299833_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300120_301224_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301235_302489_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
301316:301332	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|302693_303857_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|304083_304389_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|304388_304751_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|304741_305278_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000141753.1|305791_306037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020634.1|306527_307220_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|307317_307578_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|307570_308122_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|308297_308477_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|308466_309408_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072131649.1|309404_309899_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_001303054.1|309898_310552_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|310548_310875_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|310871_311261_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|311280_312090_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|312097_313087_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|313100_313853_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|314067_314607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|314750_314984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|315262_315556_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|315692_316028_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|316031_316508_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|316724_316907_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|316997_317291_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135207.1|317816_318167_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000929175.1|318292_318787_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|319020_320517_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000838374.1|320513_320675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923141.1|320664_321891_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|321883_322486_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|322496_323726_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|323804_324128_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|324124_324535_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|324509_325016_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|325012_325573_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|325581_325752_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|325735_327232_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|327231_327588_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|327587_327857_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|327998_329834_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|329894_331223_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|331219_332299_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|332298_332847_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|332846_333272_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|333258_334317_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|334307_334892_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_032195359.1|335162_335558_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_001008234.1|335578_336022_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|335993_336596_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001145352.1|336595_337114_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000905124.1|337144_337699_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|337759_338533_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|339357_340101_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|341063_342245_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|342248_342665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|342637_343255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|343254_343713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|343705_344338_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|344368_344959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|344958_345525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|345934_346207_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|346212_346764_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|346760_347513_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|348446_348707_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|348703_349261_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|349257_349479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|349478_349802_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016225.1|349815_352149_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|352281_353238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|353913_354813_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|354911_355634_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|355800_356079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|356781_357684_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|357929_358988_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|359129_360257_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|360435_361392_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|361401_363600_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|363596_364553_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070685.1|364549_365239_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|365656_366271_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|366518_366848_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|367160_367871_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265657.1|367839_369483_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|369472_371998_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716386.1|372023_372692_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000150123.1|372749_373385_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|373410_373953_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|374777_374969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|375038_375179_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|375178_375442_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|375705_376086_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|376082_376430_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998084.1|376479_378018_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	2.2e-299
384846:384862	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	921154	960563	5370710	transposase,tail,terminase,integrase,holin,protease,portal,lysis	Enterobacteria_phage(51.16%)	50	910596:910610	944199:944213
910596:910610	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000034810.1|921154_921925_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
WP_001303849.1|922198_922417_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|922456_922624_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|922866_923469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|923679_923901_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|923999_924281_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|924291_924483_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|924455_924638_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|924634_925315_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|926012_926195_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|926191_926362_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|926354_926975_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|926971_927637_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|927848_928808_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|929145_929268_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|929282_929972_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|930155_930899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|930984_931143_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|931223_931622_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|931764_931980_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|931979_932477_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|932473_932941_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|932928_933081_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_162829202.1|934100_935313_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000934137.1|935559_937662_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|937658_937871_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|937798_938923_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|939044_939380_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|939324_941352_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|941438_941762_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|941754_942030_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|942041_942620_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|942616_943018_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|943028_943772_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|943832_944219_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
944199:944213	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|944227_944557_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|944528_947594_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|947593_947923_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|947932_948631_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|948636_949380_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|949316_949925_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000881110.1|951893_953399_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.4	3.5e-281
WP_001233141.1|953469_954069_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|954128_955445_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|955446_955716_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|955892_956873_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|956906_957926_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|958422_958584_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|958752_959634_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|959864_960563_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	1177276	1246859	5370710	transposase,tail,integrase,holin,capsid,protease,portal,head	Escherichia_phage(27.27%)	77	1185764:1185779	1207148:1207163
WP_000156526.1|1177276_1179037_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1179222_1179675_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1179750_1180791_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1181147_1181657_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1181875_1182505_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1182467_1184630_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1184639_1185086_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1185208_1187263_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1185764:1185779	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1187294_1187753_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1187848_1188511_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1188683_1189097_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1189141_1189459_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1189516_1190707_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1190801_1191080_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1191076_1191406_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1191496_1192156_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1192563_1193583_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1193560_1193803_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1193870_1196342_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1196435_1196627_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1196623_1196812_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1197385_1197571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1197757_1198147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1198288_1198444_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1198721_1199009_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1199008_1199200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1199227_1199629_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1199737_1200010_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1199993_1200419_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1200625_1201081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021499850.1|1201159_1202269_+	putative primosomal protein I	NA	V5URT9	Shigella_phage	68.9	2.6e-132
WP_000788751.1|1202275_1203022_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1203043_1203814_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1203829_1204243_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1204594_1205368_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1205733_1205871_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813263.1|1205972_1206128_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1206295_1206574_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1206575_1207625_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1207148:1207163	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1207637_1208009_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1207998_1208370_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1208521_1209340_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1209960_1210674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1211440_1213291_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1213466_1214679_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1214884_1215199_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1215726_1215912_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1216133_1216247_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1216467_1217001_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1217160_1217433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1217688_1217895_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1218645_1218921_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1218996_1219377_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1219373_1219721_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1219770_1221309_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1223485_1223692_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831795.1|1223688_1225281_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
WP_001254002.1|1225270_1226776_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1226812_1227160_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1227217_1227484_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1227465_1228206_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1228219_1228651_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1228677_1229091_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1229071_1231651_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1231647_1231977_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1231976_1232675_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1232685_1233429_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1233374_1234007_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1234197_1234725_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_072619007.1|1234858_1238332_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1238399_1238999_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1239063_1240377_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1240378_1240648_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1242640_1243759_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1243755_1245549_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1245567_1246275_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1246271_1246859_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	1508625	1628612	5370710	tail,transposase,terminase,integrase,holin,capsid,tRNA,protease,portal,head,lysis	Enterobacteria_phage(37.5%)	148	1574544:1574559	1602227:1602242
WP_000952736.1|1508625_1509447_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1509602_1510649_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1510645_1511440_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1511606_1512725_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1512693_1512963_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1513024_1513414_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1513546_1514062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1514176_1514329_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1514644_1515121_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1515245_1515569_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|1515552_1515978_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1516046_1517084_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1516995_1517538_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451014.1|1517571_1518288_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.2	6.9e-70
WP_072140318.1|1518320_1518602_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1518598_1518901_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1518890_1519208_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1519161_1519479_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1519465_1519903_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1519904_1520096_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1520098_1520686_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1520801_1520906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1521094_1521307_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1521474_1521753_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1521754_1522804_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_072619009.1|1522816_1523191_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	6.6e-32
WP_000762929.1|1523187_1524009_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1524605_1524773_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|1525087_1527025_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1527172_1527355_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1527392_1527662_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1527737_1527953_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1527957_1528302_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1528352_1528886_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1529156_1529726_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1529725_1529872_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1530099_1530306_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1530370_1530595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1530951_1531092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1531221_1531407_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|1531448_1531814_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1532105_1532669_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1532665_1534327_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_072619010.1|1534390_1536328_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|1536372_1536594_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072619011.1|1536539_1539125_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125988.1|1539121_1539448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1539457_1539808_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1539804_1540251_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1540247_1540592_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1540657_1541374_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1541388_1541763_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1541858_1542068_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1542115_1545358_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1545350_1545692_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1545691_1546390_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1546406_1546661_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1546770_1546881_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1547183_1548062_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1548115_1548853_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1548798_1549035_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1549047_1549137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1549156_1551505_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1552095_1555497_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1557805_1558081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1558141_1559503_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1559866_1560730_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1560713_1561850_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1562099_1563326_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1563374_1564496_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|1564857_1566071_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_000953272.1|1567651_1567840_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1568644_1568842_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1568834_1569047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1569036_1569501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1569493_1569727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1569732_1570032_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|1570028_1571429_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|1571629_1571881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1571877_1572288_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1572298_1572571_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1572697_1572922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1573173_1573380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1573379_1574435_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1574447_1574783_+|head	head decoration protein	head	NA	NA	NA	NA
1574544:1574559	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1574795_1575209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1575414_1575957_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1576212_1576494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1577094_1578555_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1578554_1579226_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1579394_1580765_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1580768_1581410_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1581445_1582552_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1582605_1583067_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1583076_1583730_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1583901_1585152_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1585265_1586408_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1586397_1586634_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1587558_1588260_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1588256_1588559_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1588626_1588959_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1589023_1589146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1589203_1590730_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1591231_1591687_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1591686_1591857_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_072619012.1|1591849_1592122_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.0	9.7e-41
WP_072619062.1|1592073_1592751_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.8	2.5e-53
WP_000544528.1|1593072_1593378_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1593364_1593841_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1594057_1594240_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1594330_1594624_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1594915_1595326_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1595611_1595818_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1595982_1596177_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1596565_1597111_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1597085_1599011_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1599007_1599214_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1599210_1600812_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1600792_1602112_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1602121_1602454_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1602227:1602242	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|1602508_1603534_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|1603575_1603974_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1603985_1604339_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1604350_1604929_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1604925_1605321_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1605328_1606069_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1606084_1606507_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1606488_1606923_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1606915_1609465_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1609461_1609791_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1609790_1610489_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1610494_1611238_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1611174_1611807_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1611867_1615266_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1615332_1615932_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1615996_1618912_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1618911_1619493_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1619612_1620503_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1620521_1621028_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1621064_1621565_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1621643_1621826_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1622323_1622992_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1623048_1623297_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1623372_1623753_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1623749_1624097_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1624146_1625685_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1625987_1627472_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1627658_1628612_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 6
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	1713196	1787339	5370710	tail,transposase,terminase,integrase,holin,capsid,protease,portal,head	Stx2-converting_phage(36.36%)	82	1713033:1713060	1771811:1771838
1713033:1713060	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_072619013.1|1713196_1714327_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|1714304_1714553_-	excisionase	NA	NA	NA	NA	NA
WP_072619014.1|1714617_1717089_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|1717181_1717373_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1717369_1717558_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1717955_1718123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1718116_1718350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1718327_1718735_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1718757_1718976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1719048_1719348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1719611_1720019_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1720095_1720323_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_053912387.1|1720306_1720858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1720829_1721870_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1721781_1722324_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1722510_1723092_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1723088_1723253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1723951_1724710_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1724988_1725201_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1725421_1725679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1725748_1726027_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1726028_1727075_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1727087_1727447_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1727455_1727986_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1728227_1728425_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1728575_1729634_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143071.1|1730430_1732281_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024180155.1|1732720_1732936_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|1732940_1733285_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1733335_1733869_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1734139_1734709_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1734708_1734855_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1735082_1735268_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1735692_1735920_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1735961_1736327_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|1736616_1737180_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1737176_1738838_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1738901_1740839_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1740883_1741105_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_115245565.1|1741050_1743552_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.0	0.0e+00
WP_000126019.1|1743631_1743958_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1743967_1744318_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1744314_1744761_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1744757_1745102_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1745160_1745877_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1745882_1746257_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1746352_1746562_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072619015.1|1746614_1749857_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1749849_1750191_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072619016.1|1750190_1750889_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|1750899_1751643_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1751588_1752221_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1752563_1753739_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1753690_1756036_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1756103_1756703_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1756854_1758168_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1758169_1758439_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1759465_1760791_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|1763455_1764994_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1765043_1765391_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1765387_1765768_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1766107_1766386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1766813_1766960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1767096_1767744_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1767927_1768518_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|1770024_1770675_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|1771988_1772495_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1771811:1771838	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1772540_1773041_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1773126_1773306_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1773686_1774493_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1774492_1775686_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|1775697_1777059_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763520.1|1777059_1778655_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|1778654_1780217_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1780308_1780353_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1780490_1781372_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1781368_1781989_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1782016_1783600_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1783812_1784685_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1784724_1785315_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1785311_1786070_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1786289_1787339_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	2053183	2104355	5370710	tail,terminase,holin,capsid,portal,head	Escherichia_phage(35.59%)	65	NA	NA
WP_000214712.1|2053183_2053387_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2053422_2054883_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2056385_2056628_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2056789_2057431_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_072140863.1|2057512_2058142_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001131658.1|2058214_2058790_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2058903_2059173_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072619019.1|2059174_2060488_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230508.1|2060552_2061152_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072619020.1|2061219_2064699_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_134791867.1|2064947_2065580_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_072619021.1|2065525_2066269_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	2.5e-147
WP_032256908.1|2066279_2066978_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2066977_2067307_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081803.1|2067303_2069916_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000533440.1|2069896_2070310_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2070336_2070759_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2070772_2071525_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2071532_2071928_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2071924_2072458_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2072472_2072826_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2072837_2073236_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2073277_2074303_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2074358_2074691_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2074700_2076020_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2076000_2077602_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2077598_2077805_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2077801_2079727_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2079701_2080247_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2080633_2080858_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2080939_2081254_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2081779_2081965_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2082187_2082334_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2082333_2082903_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2083173_2083707_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2083757_2084102_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2084106_2084322_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_064234946.1|2084761_2086612_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001302123.1|2087089_2087521_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2087971_2088685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2088820_2089018_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2089242_2089797_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2089859_2090165_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2090177_2091227_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2091228_2091501_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2091622_2091967_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2092086_2092299_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2092532_2093090_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2093091_2093310_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2093437_2093749_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2093741_2093969_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2093965_2094247_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000139447.1|2094988_2095450_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2095442_2096486_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2096554_2096980_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2096963_2097206_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2097597_2097936_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2098228_2098381_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2098392_2099031_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2099031_2099241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2099805_2099994_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2099990_2100179_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102182.1|2100271_2102716_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	1.4e-175
WP_000005552.1|2102788_2103040_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001302046.1|2104028_2104355_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 8
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	2410847	2463283	5370710	integrase,tRNA,transposase,tail	Enterobacteria_phage(58.06%)	61	2404071:2404086	2463362:2463377
2404071:2404086	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2410847_2412581_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2412757_2413246_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2413365_2413758_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2413757_2415836_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2415828_2416977_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2417178_2417823_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2417833_2418223_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2418237_2419287_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2419289_2420150_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2420168_2421770_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2421815_2423477_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2423619_2424123_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2424143_2426108_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2426112_2427039_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2427035_2427923_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2428049_2428628_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2428630_2428981_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2429760_2430189_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2430195_2431620_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2431594_2432395_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2432561_2433548_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2433562_2435077_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2435146_2436136_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2436932_2437436_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2437515_2437767_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2437881_2437968_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2438229_2438553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2438723_2439221_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2439257_2439497_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2439688_2440900_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2440961_2441627_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2441983_2442985_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2442990_2443338_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2443367_2444018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2444033_2444438_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2444527_2444665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2444736_2444940_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2444961_2445312_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2445322_2445601_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2445612_2445855_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2445851_2445965_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2446057_2446474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2446497_2446701_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2446697_2446964_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2446960_2447260_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2447271_2447889_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2447885_2448251_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2448257_2451080_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2451156_2452116_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2452120_2452435_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2453526_2454057_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2454100_2454673_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2454829_2455318_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2458120_2458276_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2458284_2458650_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2458704_2459217_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2459216_2460401_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_158002267.1|2460397_2460604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|2460679_2461893_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_072619063.1|2461959_2462196_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.3	2.0e-26
WP_032161583.1|2462146_2463283_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2463362:2463377	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	2520822	2587110	5370710	tail,transposase,terminase,integrase,holin,capsid,portal,head	Escherichia_phage(34.09%)	66	2536488:2536503	2591454:2591469
WP_001023407.1|2520822_2521092_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072619025.1|2521093_2522263_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|2522327_2522927_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000514788.1|2522994_2526474_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_149026291.1|2526722_2527355_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	2.7e-102
WP_000194801.1|2527300_2528044_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2528054_2528753_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2528752_2529082_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072619027.1|2529078_2531658_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.7	0.0e+00
WP_000533402.1|2531638_2532052_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2532078_2532510_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2532523_2533264_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2533245_2533512_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2533569_2533917_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2533953_2535459_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831795.1|2535448_2537041_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	8.7e-182
2536488:2536503	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2537037_2537244_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2539129_2539639_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2540033_2540258_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2540339_2540654_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2541180_2541366_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2541593_2541725_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2541737_2541920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2542075_2542609_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2542659_2543004_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2543008_2543224_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162832371.1|2543534_2544747_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2544829_2546680_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2548219_2548909_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2548905_2549265_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2549277_2550327_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2550328_2550607_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2550774_2550987_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2551173_2551278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2551387_2551951_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2552077_2552389_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2552385_2552538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2552570_2552927_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2552923_2553148_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2553169_2553868_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2553902_2554445_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2554356_2555394_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2555462_2555888_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2555884_2556112_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2556209_2556854_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2557128_2557281_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2557760_2557949_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2557945_2558134_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2558229_2560701_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2560759_2560963_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2560962_2561985_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2562220_2563018_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480501.1|2570952_2572005_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2572318_2573635_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2573736_2575191_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2575533_2576250_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2576875_2578519_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2578636_2579587_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2579688_2580606_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2581062_2581998_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2582059_2583139_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2583150_2583894_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2583890_2584436_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2584797_2585178_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2585174_2585522_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2585571_2587110_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2591454:2591469	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 10
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	2601774	2662969	5370710	tail,transposase,terminase,integrase,holin,capsid,protease,head,lysis	Stx2-converting_phage(60.0%)	75	2612194:2612209	2666032:2666047
WP_001303036.1|2601774_2602941_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2604264_2604915_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2605139_2606015_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|2606155_2606425_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_072619029.1|2606426_2607749_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	1.2e-83
WP_001230314.1|2607813_2608413_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_072619030.1|2608479_2611959_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	99.7	0.0e+00
2612194:2612209	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_149026291.1|2612207_2612840_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	2.7e-102
WP_072619031.1|2612785_2613523_-|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	97.1	3.2e-147
WP_001416667.1|2613576_2614500_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2614570_2614744_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2614851_2615172_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179515.1|2615188_2615887_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|2615886_2616228_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_162829202.1|2618176_2619390_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001453698.1|2620827_2621037_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2621132_2621507_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2621512_2622229_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2622287_2622632_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2622628_2623075_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2623071_2623422_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2623431_2623758_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|2626284_2626506_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173024.1|2626550_2628488_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001301491.1|2628551_2630213_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2630209_2630773_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|2631064_2631430_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2631471_2631699_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2632161_2632419_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2632415_2632913_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2633115_2633553_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2633549_2634047_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2634046_2634262_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290230.1|2634339_2634585_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2634625_2634805_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_021503541.1|2634942_2636880_-	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_001303568.1|2637123_2637447_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2637743_2638013_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2638024_2638984_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2639633_2640122_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_162829202.1|2640496_2641709_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001108004.1|2642093_2642699_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2642698_2643421_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|2643495_2644260_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|2644534_2644717_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2644713_2645241_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2645237_2645684_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2645640_2645877_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2645887_2646103_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_000344569.1|2646235_2646568_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_001220560.1|2647031_2647643_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000539354.1|2649093_2649915_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_162829202.1|2650042_2651256_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000442612.1|2651408_2651705_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2651846_2652062_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2652136_2652832_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2653333_2653855_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2654423_2654606_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2654583_2654856_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2654914_2655166_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2655348_2655717_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2655789_2655954_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2655922_2656066_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2656140_2656437_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2656442_2657228_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_072165019.1|2657397_2657898_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.4	4.8e-94
WP_000682306.1|2657894_2658077_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2658049_2658241_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|2658251_2658533_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2658631_2658853_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2658849_2659797_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2660658_2661009_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2661196_2661541_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2661618_2661810_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2661790_2662969_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2666032:2666047	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 11
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	2748986	2848973	5370710	tail,terminase,holin,tRNA,protease,portal	Enterobacteria_phage(52.11%)	107	NA	NA
WP_000476014.1|2748986_2750348_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|2750677_2750995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2751400_2752300_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|2752381_2753161_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2753260_2754301_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|2754348_2755704_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2755707_2755992_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2756022_2756475_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|2756484_2757747_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|2757775_2758630_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2758928_2759981_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|2760237_2761515_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|2761511_2762516_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|2762512_2763478_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2763451_2764198_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|2764249_2765068_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|2765132_2765933_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|2765929_2766718_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2767051_2767291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2768341_2768689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2768698_2769013_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|2769122_2769395_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134630.1|2769515_2770361_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|2770578_2770917_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|2770998_2772033_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|2772043_2774524_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000682830.1|2775302_2775845_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|2776136_2776418_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|2776679_2777789_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|2777920_2779954_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2786910_2790540_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2790601_2790919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2792159_2793248_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2793258_2794788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2794806_2795538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2795530_2796667_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2796663_2798667_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2798791_2799253_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2799294_2799765_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2799811_2800531_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2800527_2802213_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2802727_2802976_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2803343_2803613_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268979.1|2803614_2804928_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001228302.1|2804992_2805592_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_072619034.1|2805659_2809133_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_047085665.1|2809373_2810003_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	3.9e-101
WP_072619036.1|2809948_2810692_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.3e-148
WP_024239943.1|2810702_2811401_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	7.6e-130
WP_000847298.1|2811400_2811730_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918243.1|2811726_2814372_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|2814415_2814724_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2814750_2815173_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2815186_2815939_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2815946_2816345_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_057716711.1|2816357_2816981_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	4.3e-100
WP_001281350.1|2816983_2817265_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2817257_2817584_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2817671_2819696_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2819640_2821143_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2821142_2821355_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_072619037.1|2821351_2823475_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_072619038.1|2823471_2823948_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	98.7	8.9e-82
WP_012816791.1|2824465_2824651_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2824878_2825025_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2825024_2825594_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2825864_2826398_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2826402_2826618_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2826695_2826941_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_072619039.1|2826981_2827161_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	6.4e-25
WP_000142932.1|2827298_2829245_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|2830048_2830201_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2830452_2830887_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2830972_2831113_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2831109_2831472_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|2831468_2831759_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2831751_2831922_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|2831921_2832377_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|2832373_2832475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|2832565_2832847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|2832890_2833088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|2833315_2833600_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|2833596_2834298_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000147884.1|2834294_2835314_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_001182876.1|2835310_2835850_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|2836213_2836906_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|2837012_2838620_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|2839123_2839414_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|2839489_2839786_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2839791_2840577_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2840573_2841251_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|2841250_2841433_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|2841405_2841597_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2841607_2841889_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2841987_2842209_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2842205_2843153_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2843154_2843331_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2843664_2844021_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2844017_2844380_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2844467_2844710_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2844713_2844848_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2844866_2845121_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2845154_2846441_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2846461_2847163_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2847222_2847330_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2847310_2848042_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2848046_2848973_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	3093371	3098797	5370710	integrase	Enterobacteria_phage(50.0%)	6	3083822:3083838	3095786:3095802
3083822:3083838	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3093371_3094304_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3094615_3095773_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3095947_3097084_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3095786:3095802	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3097093_3097774_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3097760_3098228_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3098227_3098797_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 13
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	3376376	3389813	5370710	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_000162574.1|3376376_3376859_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3377704_3377953_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3378454_3379045_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3379227_3379878_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3379956_3381015_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3381144_3381567_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3381727_3381997_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000612591.1|3382614_3382962_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3382958_3383339_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3383695_3384040_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3384044_3384260_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3384409_3386263_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3386670_3386838_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3386923_3387667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3387919_3388543_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3388539_3389205_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3389201_3389813_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 14
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	4975054	4989719	5370710	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	4976335:4976350	4993864:4993879
WP_000956557.1|4975054_4975588_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|4975784_4975958_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|4976005_4976287_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
4976335:4976350	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|4976631_4976829_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|4977164_4977449_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|4977445_4977796_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|4977786_4978323_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|4979644_4980244_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|4980308_4981622_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|4981623_4981893_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|4982004_4982577_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|4982649_4983279_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|4983360_4984002_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|4984162_4984411_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|4984472_4985570_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|4985658_4986696_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|4986829_4987072_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|4987237_4988221_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|4988303_4989719_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
4993864:4993879	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 15
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	5126599	5185625	5370710	transposase,protease	Pectobacterium_phage(11.11%)	58	NA	NA
WP_000312488.1|5126599_5127859_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5127861_5128866_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5128947_5129145_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5129248_5130547_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5130751_5131177_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5131215_5133657_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5133837_5134569_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5134695_5135097_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5135115_5135814_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5135864_5136524_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5136541_5136940_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5136949_5137588_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5137590_5138754_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5138837_5140463_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5140579_5140855_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5141003_5141333_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000133631.1|5142259_5143015_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5144541_5145939_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5145954_5146260_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5146269_5146734_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5146747_5147398_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5147407_5148262_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5148261_5148948_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5149076_5149352_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5149678_5150074_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5150080_5150395_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5150399_5150627_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5150668_5151118_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5151188_5151983_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5152605_5153037_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5153044_5154253_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5154387_5155026_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5155243_5155864_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5156172_5157585_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5157629_5158292_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5158399_5159365_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5159472_5160333_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000589487.1|5160918_5162862_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5163051_5163792_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5164003_5164942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5165004_5165559_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5165883_5166090_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5166185_5167529_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5167851_5168490_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269308.1|5168695_5170429_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5170425_5174205_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5174207_5174549_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5174760_5175012_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5175005_5175356_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5175435_5175966_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_072619058.1|5176275_5177232_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5177371_5178874_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5178887_5179910_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5179896_5180892_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5180924_5181923_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5182098_5183472_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5183627_5184179_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5184272_5185625_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 16
NZ_CP018247	Escherichia coli strain 7784 chromosome, complete genome	5370710	5218045	5230621	5370710	integrase	Enterobacteria_phage(81.82%)	15	5213078:5213093	5231573:5231588
5213078:5213093	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|5218045_5219320_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|5219487_5219793_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|5219869_5220604_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|5220641_5221886_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|5222211_5222784_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|5222857_5223358_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283021.1|5223354_5224089_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|5224640_5224907_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|5224903_5225494_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|5225486_5225774_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|5225766_5226222_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|5226357_5226678_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|5226692_5229026_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|5229381_5229576_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|5229793_5230621_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5231573:5231588	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
