The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	215669	279929	5516497	transposase,tRNA,plate	uncultured_Caudovirales_phage(40.0%)	53	NA	NA
WP_000176537.1|215669_216965_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217017_217278_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217264_217465_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217630_218176_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218172_218583_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218596_219307_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219506_220331_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220383_222102_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094001.1|222212_222920_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222916_223321_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223438_224254_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224293_224947_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224939_225971_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226158_226734_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232491_233295_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233291_234206_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234446_235247_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235324_236095_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236142_237501_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237572_238328_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238361_239084_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239080_239548_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239612_240344_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240881_241682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242159_242609_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242611_243208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243286_243508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243528_244008_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243973_245383_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001303798.1|245393_248828_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|250380_251124_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251120_253898_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253906_254668_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254672_256004_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256006_256531_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256527_257808_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257832_258915_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258878_260729_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260732_261146_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261236_262628_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262678_262903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262937_263438_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264134_264653_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264862_267004_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267079_271312_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271451_272168_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339420.1|272349_273858_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_001506588.1|273926_274466_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420837.1|275211_276348_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|276350_278111_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|278312_278576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278490_278676_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278756_279929_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	300058	315861	5516497	tail,transposase,integrase	Escherichia_phage(40.0%)	16	304024:304037	321223:321236
WP_001285288.1|300058_301162_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893283.1|301173_302427_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
WP_001303805.1|303496_303742_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
304024:304037	attL	TGAACCGCCCCGGA	NA	NA	NA	NA
WP_162829202.1|304077_305290_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001274756.1|305812_306526_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306626_306827_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306945_307239_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|308190_308502_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000844960.1|308816_309212_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000344820.1|309232_309676_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|309647_310241_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115574.1|310240_310735_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000904979.1|310764_311319_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311376_312150_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312973_313717_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|314679_315861_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
321223:321236	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 3
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	889372	934208	5516497	holin,integrase,lysis,protease,tail,portal,transposase,terminase	Enterobacteria_phage(50.0%)	54	884241:884255	917843:917857
884241:884255	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_162829202.1|889372_890586_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001036471.1|890676_892110_+	anion permease	NA	NA	NA	NA	NA
WP_000593900.1|892292_894554_+	hydratase	NA	NA	NA	NA	NA
WP_001091577.1|894694_895978_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000034810.1|896112_896883_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
WP_001303849.1|897156_897375_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|897414_897582_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|897824_898427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|898637_898859_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|898957_899239_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|899249_899441_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|899413_899596_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|899592_900273_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|900970_901153_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|901149_901320_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|901312_901933_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|901929_902595_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|902806_903766_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|904102_904225_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|904239_904929_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|905112_905856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|905941_906100_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|906180_906579_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|906721_906937_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|906936_907434_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|907430_907898_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|907885_908038_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|908712_909204_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|909203_911306_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|911302_911515_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|911442_912567_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|912688_913024_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|912968_914996_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|915082_915406_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|915398_915674_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|915685_916264_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|916260_916662_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|916672_917416_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|917476_917863_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
917843:917857	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|917871_918201_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|918172_921238_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|921237_921567_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|921576_922275_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|922280_923024_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|922960_923569_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|923629_927043_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|927113_927713_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|927772_929089_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|929090_929360_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|929536_930517_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|930550_931570_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|932066_932228_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|932397_933279_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|933509_934208_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	1056330	1067387	5516497	capsid,integrase,terminase	uncultured_Caudovirales_phage(25.0%)	18	1050792:1050806	1063538:1063552
1050792:1050806	attL	AATAACTTTTAACGC	NA	NA	NA	NA
WP_000188190.1|1056330_1058277_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1058349_1058574_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032360566.1|1058978_1060202_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.2e-127
WP_000775337.1|1060198_1060972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1061063_1061288_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000190566.1|1061422_1061602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368837.1|1061792_1061996_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920689.1|1061988_1062174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|1062173_1062365_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_001302929.1|1062354_1062597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770151.1|1062602_1062902_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761782.1|1062898_1064653_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
1063538:1063552	attR	GCGTTAAAAGTTATT	NA	NA	NA	NA
WP_000557482.1|1064939_1065191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|1065321_1065516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1065519_1065681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1065812_1066301_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000006076.1|1066312_1066474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562896.1|1066463_1067387_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
>prophage 5
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	1160269	1228656	5516497	holin,integrase,protease,tail,capsid,portal,transposase,head	Escherichia_phage(23.26%)	76	1168757:1168772	1190123:1190138
WP_000156526.1|1160269_1162030_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1162215_1162668_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1162743_1163784_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1164140_1164650_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1164868_1165498_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1165460_1167623_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1167632_1168079_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1168201_1170256_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1168757:1168772	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1170287_1170746_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1170841_1171504_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1171676_1172090_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1172134_1172452_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1172509_1173700_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1173794_1174073_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1174069_1174399_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1174489_1175149_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1175556_1176576_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1176553_1176796_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1176863_1179335_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1179428_1179620_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1179616_1179805_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1180378_1180564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1180750_1181140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1181281_1181437_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1181714_1182002_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1182001_1182193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1182220_1182622_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1182730_1183003_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1182986_1183412_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1183618_1184074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1184152_1185244_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1185250_1185997_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1186018_1186789_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1186804_1187218_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1187569_1188343_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1188708_1188846_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000813263.1|1188947_1189103_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1189270_1189549_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1189550_1190600_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1190123:1190138	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1190612_1190984_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1190973_1191345_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1191496_1192315_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1192935_1193649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1194416_1196267_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001303878.1|1196542_1196857_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1197383_1197569_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1197790_1197904_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1198124_1198658_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1198817_1199090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1199345_1199552_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1200302_1200578_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1200653_1201034_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1201030_1201378_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1201427_1202966_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1205142_1205349_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1205345_1206938_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1206927_1208433_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1208469_1208817_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1208874_1209141_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1209122_1209863_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1209876_1210308_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1210334_1210748_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_072643143.1|1210728_1213308_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
WP_000847298.1|1213304_1213634_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1213633_1214332_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194760.1|1214342_1215086_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1215031_1215664_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1215854_1216382_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515110.1|1216515_1219989_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230444.1|1220056_1220656_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|1220720_1222034_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|1222035_1222305_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1224437_1225556_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1225552_1227346_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1227364_1228072_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1228068_1228656_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	1478584	1597828	5516497	holin,integrase,lysis,protease,tail,capsid,portal,tRNA,transposase,terminase,head	Enterobacteria_phage(35.85%)	150	1543188:1543203	1571442:1571457
WP_000952736.1|1478584_1479406_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1479561_1480608_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1480604_1481399_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1481565_1482684_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1482652_1482922_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1482983_1483373_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1483505_1484021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1484135_1484288_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1484603_1485080_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1485204_1485528_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1485511_1485937_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1486005_1487043_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1486954_1487497_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1487530_1488247_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1488279_1488561_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1488557_1488860_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1488849_1489167_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1489120_1489438_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1489424_1489862_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1489863_1490055_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1490057_1490645_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1490760_1490865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1491053_1491266_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1491433_1491712_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1491713_1492763_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1492775_1493150_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1493146_1493968_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1494564_1494732_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|1495046_1496984_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1497131_1497314_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1497351_1497621_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1497696_1497912_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731240.1|1497916_1498261_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
WP_000992148.1|1498311_1498845_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1499115_1499685_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1499684_1499831_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1500058_1500265_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1500329_1500554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1500910_1501051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1501180_1501366_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1501407_1501773_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1502062_1502626_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|1502622_1504284_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1504347_1506285_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1506329_1506551_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072612732.1|1506496_1509076_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125988.1|1509078_1509405_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1509414_1509765_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1509761_1510208_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1510204_1510549_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1510614_1511331_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1511345_1511720_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1511815_1512025_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1512072_1515315_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807950.1|1515307_1515649_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|1515648_1516347_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|1516363_1516618_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1516727_1516838_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1517140_1518019_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1518072_1518810_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1518755_1518992_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1519004_1519094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1519113_1521462_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1522052_1525454_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1527762_1528038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1528098_1529460_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1529823_1530687_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1530670_1531807_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1532056_1533283_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1533331_1534453_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1534701_1535931_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1536295_1536484_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1537288_1537486_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1537478_1537691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1537680_1538145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1538137_1538371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1538376_1538676_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1538672_1540073_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1540273_1540525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1540521_1540932_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1540942_1541215_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1541341_1541566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1541817_1542024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907466.1|1542023_1543079_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.9	1.6e-67
WP_000380883.1|1543091_1543427_+|head	head decoration protein	head	NA	NA	NA	NA
1543188:1543203	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1543439_1543853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1544058_1544601_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1544856_1545138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1545738_1547199_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1547198_1547870_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1548038_1549409_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1549412_1550054_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1550089_1551196_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1551249_1551711_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1551720_1552374_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1552545_1553796_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1553909_1555052_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1555041_1555278_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1556202_1556904_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1556900_1557203_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1557270_1557603_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1557667_1557790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1557847_1559374_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1559875_1560331_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1560330_1560501_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1560493_1560784_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1560780_1561143_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1561139_1561280_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1561276_1561966_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1562287_1562593_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1562579_1563056_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1563272_1563455_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738501.1|1563545_1563839_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	99.0	2.0e-47
WP_000079504.1|1564130_1564541_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1564826_1565033_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1565197_1565392_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1565780_1566326_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1566300_1568226_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1568222_1568429_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1568425_1570027_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1570007_1571327_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1571336_1571669_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1571442:1571457	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1571724_1572750_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1572791_1573190_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753014.1|1573201_1573555_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000975100.1|1573566_1574145_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1574141_1574537_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1574544_1575285_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1575300_1575723_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1575704_1576139_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1576131_1578681_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1578677_1579007_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1579006_1579705_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1579710_1580454_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1580390_1581023_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1581083_1584482_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|1584548_1585148_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|1585212_1588128_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885630.1|1588127_1588709_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1588828_1589719_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1589737_1590244_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1590280_1590781_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1590859_1591042_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1591539_1592208_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1592264_1592513_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1592588_1592969_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1592965_1593313_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1593362_1594901_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1595203_1596688_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1596874_1597828_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	1693245	1767523	5516497	holin,integrase,protease,tail,capsid,portal,transposase,terminase,head	Stx2-converting_phage(39.29%)	83	1693082:1693109	1751995:1752022
1693082:1693109	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1693245_1694376_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1694353_1694602_-	excisionase	NA	NA	NA	NA	NA
WP_072612735.1|1694666_1697138_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.9	9.4e-58
WP_001090200.1|1697230_1697422_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1697418_1697607_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1698007_1698172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1698175_1698394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|1698465_1698765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1699117_1699396_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1699397_1699589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|1699609_1699981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1700078_1700381_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|1700377_1700803_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|1700825_1701788_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|1701794_1702535_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|1703345_1703741_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|1703797_1704382_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|1704497_1704602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1704790_1705003_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|1705170_1705449_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|1705450_1706500_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|1706512_1706872_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|1706868_1707558_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|1708195_1708624_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|1709102_1710953_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|1711392_1711608_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|1711612_1711957_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1712007_1712541_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1712811_1713381_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1713380_1713527_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1713754_1713940_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1714364_1714592_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1714633_1714999_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1715288_1715852_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|1715848_1717510_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1717573_1719511_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1719555_1719777_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1719722_1722224_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1722303_1722630_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1722639_1722990_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1722986_1723433_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1723429_1723774_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1723832_1724549_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1724554_1724929_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1725024_1725234_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072612737.1|1725286_1728367_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_000807954.1|1728359_1728701_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|1728700_1729399_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|1729409_1730153_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1730098_1730731_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1731073_1732249_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1732200_1734546_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1734613_1735213_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1735364_1736678_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1736679_1736949_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1737975_1739301_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1740898_1741021_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1741127_1742039_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1742104_1742674_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1743639_1745178_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1745227_1745575_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1745571_1745952_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1746291_1746570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1746997_1747144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1747280_1747928_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1748111_1748702_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_170760845.1|1750208_1750859_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.4	1.5e-26
WP_001079499.1|1752172_1752679_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1751995:1752022	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1752724_1753225_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1753310_1753490_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1753870_1754677_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1754676_1755870_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1755881_1757243_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1757243_1758839_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1758838_1760401_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1760492_1760537_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1760674_1761556_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1761552_1762173_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1762200_1763784_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1763996_1764869_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1764908_1765499_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1765495_1766254_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1766473_1767523_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	2036235	2174899	5516497	holin,protease,tail,capsid,portal,transposase,terminase,head	Escherichia_phage(31.51%)	170	NA	NA
WP_001023407.1|2036235_2036505_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072643146.1|2036506_2037820_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001230514.1|2037884_2038484_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072147834.1|2042272_2042902_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2042847_2043591_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2043601_2044300_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2044299_2044629_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643147.1|2044625_2047271_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	97.8	0.0e+00
WP_000532073.1|2047314_2047623_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2047649_2048072_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2048085_2048838_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2048845_2049244_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2049256_2049880_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2049882_2050164_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2050156_2050483_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_136803053.1|2050570_2052595_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.1	0.0e+00
WP_000974568.1|2052539_2054042_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|2054041_2054254_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077609.1|2054250_2056374_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.2	0.0e+00
WP_000373407.1|2056370_2056847_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_000735654.1|2057265_2057490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2057575_2057761_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_038819357.1|2058279_2058813_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.3	7.4e-101
WP_001072901.1|2058817_2059033_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2059110_2059356_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2059396_2059576_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_072643148.1|2059713_2061660_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000935553.1|2062163_2063222_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	2.2e-205
WP_000917735.1|2063372_2063570_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2063796_2064618_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2064614_2064989_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_072643149.1|2065001_2066051_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.1e-108
WP_071990241.1|2066052_2066325_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.1e-11
WP_001012717.1|2066495_2067374_-	type II restriction endonuclease NgoMIV	NA	NA	NA	NA	NA
WP_001427299.1|2067387_2068506_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	1.7e-35
WP_000150294.1|2068690_2069356_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001029560.1|2069530_2069956_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
WP_000450998.1|2069971_2070742_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_072643150.1|2070763_2071510_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_072643169.1|2071516_2072479_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.5	2.1e-69
WP_000693888.1|2072501_2072927_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|2072910_2073192_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2073292_2073712_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379589.1|2073977_2074133_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171930.1|2074292_2074511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394532.1|2074533_2074908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2075427_2075616_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_072643151.1|2075895_2078292_+	exonuclease	NA	V5UQJ3	Shigella_phage	44.4	7.1e-127
WP_000005551.1|2078364_2078616_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206148.1|2078635_2079931_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001120551.1|2080108_2080351_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2080512_2081154_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2081235_2081865_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2081937_2082513_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2082626_2082896_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268960.1|2082897_2084121_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.5	4.3e-80
WP_001230514.1|2084185_2084785_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643152.1|2084852_2088332_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_072147834.1|2088572_2089202_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2089147_2089891_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2089901_2090600_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2090599_2090929_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072643153.1|2090925_2093538_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000533440.1|2093518_2093932_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2093958_2094381_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2094394_2095147_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2095154_2095550_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2095546_2096080_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2096094_2096448_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2096459_2096858_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2096899_2097925_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2097980_2098313_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2098322_2099642_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2099622_2101224_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2101220_2101427_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|2101423_2103349_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2103323_2103869_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2104255_2104480_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2104561_2104876_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2105401_2105587_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2105809_2105956_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2105955_2106525_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2106796_2107330_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731259.1|2107380_2107725_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2107729_2107945_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_001302123.1|2110711_2111143_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2111593_2112307_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2112442_2112640_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2112864_2113419_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2113481_2113787_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2113799_2114849_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2114850_2115123_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2115244_2115589_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2115708_2115921_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2116154_2116712_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2116713_2116932_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2117059_2117371_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2117363_2117591_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2117587_2117869_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2117901_2118618_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2118651_2119113_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2119105_2120149_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2120217_2120643_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2120626_2120869_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2121260_2121599_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2121891_2122044_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2122055_2122694_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2122694_2122904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2123468_2123657_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2123653_2123842_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2123934_2125179_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2125889_2126132_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2127094_2127475_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2127471_2127819_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2127868_2129407_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2129989_2130640_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2131350_2131926_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2132039_2132309_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_024183355.1|2132310_2133624_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001230508.1|2133688_2134288_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|2134355_2134571_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_105626756.1|2134573_2137834_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001152128.1|2138021_2138459_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2138458_2138800_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072612737.1|2138792_2141873_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_001453698.1|2141925_2142135_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2142230_2142605_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2142610_2143327_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2143385_2143730_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2143726_2144173_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2144169_2144520_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2144529_2144856_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2144935_2147437_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2147382_2147604_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2147648_2149586_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2149649_2151311_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2151307_2151871_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2152160_2152526_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2152567_2152795_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2153219_2153405_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2153632_2153779_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_162829202.1|2154125_2155338_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000992137.1|2155931_2156465_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2156515_2156860_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2156864_2157080_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2157229_2159083_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2159879_2160938_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2161088_2161286_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2161527_2162058_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2162066_2162426_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2162438_2163485_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2163486_2163765_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2163834_2164092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2164312_2164525_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2164803_2165562_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2166260_2166425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2166421_2167003_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2167189_2167732_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2167643_2168684_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2168655_2169207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2169190_2169418_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2169494_2169902_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2170165_2170465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2170537_2170756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2170778_2171186_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2171163_2171397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122990716.1|2171390_2171558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2171958_2172147_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2172143_2172335_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048458.1|2172427_2174899_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
>prophage 9
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	2483055	2534171	5516497	tail,tRNA,integrase,transposase	Enterobacteria_phage(60.0%)	59	2476279:2476294	2534250:2534265
2476279:2476294	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2483055_2484789_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2484965_2485454_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_024218408.1|2485573_2485966_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2485965_2488044_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2488036_2489185_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2489386_2490031_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2490041_2490431_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2490445_2491495_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2491497_2492358_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2492376_2493978_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2494023_2495685_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2495827_2496331_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2496351_2498316_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2498320_2499247_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2499243_2500131_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2500257_2500836_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2500838_2501189_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2501968_2502397_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2502403_2503828_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2503802_2504603_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2504769_2505756_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2505770_2507285_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2507354_2508344_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2509140_2509644_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2509723_2509975_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2510089_2510176_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2510437_2510761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2510931_2511429_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2511465_2511705_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2511896_2513108_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2513169_2513835_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2514191_2515193_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2515198_2515546_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2515575_2516226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2516241_2516646_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2516735_2516873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2516944_2517148_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2517169_2517520_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2517530_2517809_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2517820_2518063_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2518059_2518173_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2518265_2518682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2518705_2518909_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2518905_2519172_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2519168_2519468_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2519479_2520097_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2520093_2520459_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2520465_2523288_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2523364_2524324_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2524328_2524643_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2525734_2526265_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2526308_2526881_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2527037_2527526_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2530328_2530484_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2530492_2530858_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2530912_2531425_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2531424_2532609_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2532766_2533090_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_072612814.1|2533040_2534171_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	4.8e-41
2534250:2534265	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	2591687	2639956	5516497	holin,integrase,tail,capsid,portal,transposase,terminase,head	Escherichia_phage(38.64%)	55	2596407:2596421	2638948:2638962
WP_001023352.1|2591687_2591957_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_072612778.1|2591958_2593272_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	6.9e-84
WP_001230514.1|2593336_2593936_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643156.1|2594003_2597483_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
2596407:2596421	attL	GAACGTCAGCGTCTG	NA	NA	NA	NA
WP_127446151.1|2597723_2598353_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2598298_2599042_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001151078.1|2599052_2599751_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|2599750_2600080_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_072643157.1|2600076_2602656_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.3	0.0e+00
WP_000533402.1|2602636_2603050_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2603076_2603508_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2603521_2604262_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2604243_2604510_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2604567_2604915_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2604951_2606457_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2606446_2608039_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2608035_2608242_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2608225_2610154_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2610125_2610635_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2611029_2611254_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2611335_2611650_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2612176_2612362_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2612589_2612721_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2612733_2612916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2613071_2613605_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2613655_2614000_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2614004_2614220_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2614530_2615743_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2615825_2617676_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2618153_2618582_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2619215_2619905_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2619901_2620261_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2620273_2621323_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2621324_2621603_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2621770_2621983_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2622169_2622274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2622383_2622947_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2623073_2623385_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2623381_2623534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2623566_2623923_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2623919_2624144_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2624165_2624864_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2624898_2625441_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2625352_2626390_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2626458_2626884_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2626880_2627108_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2627205_2627850_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2628124_2628277_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2628757_2628946_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2628942_2629131_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2629226_2631698_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2631756_2631960_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2631959_2632982_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2633217_2634015_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_162829348.1|2638743_2639956_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
2638948:2638962	attR	GAACGTCAGCGTCTG	NA	NA	NA	NA
>prophage 11
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	2658680	2732607	5516497	lysis,holin,protease,tail,capsid,portal,transposase,terminase,head	Stx2-converting_phage(45.57%)	93	NA	NA
WP_000998048.1|2658680_2660219_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000966626.1|2661666_2663814_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162829204.1|2664185_2665398_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000638172.1|2665382_2666264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|2666260_2667166_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102658.1|2667162_2668233_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|2668368_2669052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2669067_2669478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|2669698_2670520_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|2670601_2671081_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|2671095_2671572_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2671634_2671856_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|2671929_2672298_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2672756_2672951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2672963_2673077_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|2673565_2673748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2673848_2674178_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|2674349_2675408_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2675606_2676080_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|2676198_2677365_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2678688_2679339_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2679563_2680439_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|2680579_2680849_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_072643158.1|2680850_2682164_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001230429.1|2682228_2682828_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_072643159.1|2682894_2686371_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.5	0.0e+00
WP_126446229.1|2686616_2687249_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	99.5	5.7e-100
WP_000194810.1|2687194_2687938_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_072643160.1|2687948_2688647_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	99.6	2.8e-132
WP_000807950.1|2688646_2688988_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212827.1|2688980_2692223_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2692270_2692480_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2692575_2692950_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2692964_2693681_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2693746_2694091_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2694087_2694534_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2694530_2694881_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2694890_2695217_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_072612732.1|2695219_2697799_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_001063099.1|2697744_2697966_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2698010_2699948_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2700011_2701673_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2701669_2702233_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2702526_2702892_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2702933_2703161_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|2703623_2703881_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2703877_2704375_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2704577_2705015_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2705011_2705509_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2705508_2705724_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2705800_2706073_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2706113_2706293_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143087.1|2706429_2708367_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_001303568.1|2708610_2708934_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2709230_2709500_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2709511_2710471_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2711120_2711609_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2711599_2712271_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2712267_2712873_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2712872_2713595_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2713669_2714350_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2714605_2715364_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2715638_2715821_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2715817_2716345_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2716341_2716788_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2716744_2716981_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2716991_2717207_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2717339_2717618_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2717688_2719065_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2719061_2719883_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2719869_2720031_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2720063_2720360_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2720501_2720717_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2720792_2721488_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2721989_2722511_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2723079_2723262_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2723239_2723512_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2723570_2723822_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2724004_2724373_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2724445_2724610_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2724578_2724722_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2724796_2725093_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2725098_2725884_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|2725880_2726561_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|2726557_2726740_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2726712_2726904_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|2726914_2727196_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2727294_2727516_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2727512_2728460_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2729321_2729672_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2729859_2730204_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2730281_2730473_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_162829202.1|2731394_2732607_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 12
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	2818962	2920963	5516497	holin,protease,tail,portal,tRNA,terminase	Enterobacteria_phage(53.52%)	109	NA	NA
WP_000476014.1|2818962_2820324_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|2820653_2820971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2821376_2822276_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|2822357_2823137_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2823236_2824277_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2824324_2825680_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2825683_2825968_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2825998_2826451_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|2826460_2827723_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|2827751_2828606_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2828904_2829957_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|2830213_2831491_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|2831487_2832492_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|2832488_2833454_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2833427_2834174_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|2834225_2835044_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|2835108_2835909_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|2835905_2836694_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2837027_2837267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2838317_2838665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2838674_2838989_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|2839098_2839371_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|2839491_2840343_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|2840560_2840899_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|2840980_2842015_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|2844521_2845196_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|2845283_2845826_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|2846117_2846399_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|2846660_2847770_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|2847901_2849935_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2856892_2860522_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2860583_2860901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2862141_2863230_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2863240_2864770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2864788_2865520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2865512_2866649_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2866645_2868649_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2868773_2869235_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2869276_2869747_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2869793_2870513_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2870509_2872195_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2872709_2872958_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023455.1|2873325_2873595_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268980.1|2873596_2874910_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001228289.1|2874974_2875574_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_072612782.1|2875641_2879115_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_127446151.1|2879355_2879985_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	1.3e-101
WP_000194798.1|2879930_2880674_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072612784.1|2880684_2881383_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2881382_2881712_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072612785.1|2881708_2884354_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|2884397_2884706_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2884732_2885155_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2885168_2885921_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2885928_2886327_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2886339_2886963_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2886965_2887247_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2887239_2887566_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_149025290.1|2887653_2889678_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2889622_2891125_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2891124_2891337_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2891333_2893457_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2893453_2893930_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2893962_2894235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2894446_2894632_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2894859_2895006_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2895005_2895575_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2895845_2896379_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2896383_2896599_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2896676_2896922_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2896962_2897142_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142933.1|2897278_2899225_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_001356551.1|2900028_2900181_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2900429_2900864_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2900949_2901090_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2901086_2901449_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2901445_2901736_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2901728_2901899_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|2901898_2902354_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|2902350_2902452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2902575_2902977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2902955_2903372_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|2903671_2904280_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|2905032_2905380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788902.1|2905584_2906286_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001415152.1|2906282_2907212_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182877.1|2907300_2907840_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000712399.1|2908203_2908896_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|2909002_2910610_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|2911113_2911404_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|2911479_2911776_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2911781_2912567_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2912563_2913241_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2913240_2913423_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2913395_2913587_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2913597_2913879_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2913977_2914199_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2914195_2915143_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2915144_2915321_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2915654_2916011_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2916007_2916370_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2916457_2916700_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2916703_2916838_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2916856_2917111_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2917144_2918431_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2918451_2919153_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2919212_2919320_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2919300_2920032_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2920036_2920963_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	3134629	3235122	5516497	holin,integrase,bacteriocin,protease,tail,capsid,portal,tRNA,transposase,terminase	Escherichia_phage(53.49%)	113	3228131:3228147	3234907:3234923
WP_001283590.1|3134629_3135442_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3135441_3136455_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3136520_3137657_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615801.1|3137755_3138751_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3138747_3139926_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3140200_3141421_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3141579_3143586_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3143706_3143985_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3144018_3144567_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3144566_3145376_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|3145375_3146200_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3146203_3147289_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3147323_3148256_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3148421_3148973_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3149143_3149986_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3149987_3150509_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3150505_3150976_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3150972_3151473_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3151483_3152242_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3152264_3154904_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3154985_3155549_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195817.1|3156195_3156681_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3156883_3159028_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3159027_3160338_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3160517_3160802_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3161173_3162514_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3162878_3163910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3164304_3165060_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3165353_3166286_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331695.1|3166508_3174890_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	99.4	0.0e+00
WP_000012450.1|3174959_3176225_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3176235_3176487_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3176496_3176943_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3176945_3177602_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3177695_3178097_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3178153_3178294_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3178526_3179261_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3179351_3179969_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3179974_3180253_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3180267_3181536_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001303606.1|3183451_3183640_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3183779_3184049_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_032269552.1|3184050_3185988_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207923.1|3185984_3186635_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3186634_3187198_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3187181_3187643_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3187692_3188082_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3188137_3189352_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3189375_3190383_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3190540_3192685_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3192684_3194391_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3194371_3195178_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3195233_3195437_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3195586_3195880_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3195970_3196156_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3196383_3196530_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3196529_3197099_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3197369_3197903_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3197907_3198123_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3198199_3198472_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3198512_3198692_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|3198826_3200764_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|3201250_3201520_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000998048.1|3201944_3203483_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3203532_3203880_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3203876_3204257_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001204880.1|3205724_3206159_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3206151_3206346_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3206342_3206948_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004009.1|3206947_3207670_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
WP_000290549.1|3207744_3208422_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	100.0	4.3e-130
WP_001254256.1|3208696_3208879_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3208875_3209403_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3209399_3209846_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3209802_3210039_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3210049_3210265_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001036036.1|3210350_3210620_-	hypothetical protein	NA	A0A0P0ZCF7	Stx2-converting_phage	100.0	4.9e-45
WP_001444365.1|3210620_3213527_-	toprim domain-containing protein	NA	A0A0P0ZC72	Stx2-converting_phage	100.0	0.0e+00
WP_000062360.1|3213637_3214414_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	100.0	1.9e-137
WP_000438537.1|3214576_3214876_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001180318.1|3215014_3215242_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3215320_3216028_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3216088_3216430_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3216497_3216959_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3216952_3217999_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3218001_3218166_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198444.1|3218654_3219038_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167593.1|3219096_3219540_+	hypothetical protein	NA	G9L670	Escherichia_phage	100.0	8.9e-76
WP_162829202.1|3219565_3220778_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001198858.1|3221071_3221212_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|3221204_3221318_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|3221314_3221503_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|3221511_3222192_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073098.1|3222188_3222776_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_033806283.1|3222799_3223096_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	99.0	4.7e-49
WP_000773125.1|3223115_3223397_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	1.9e-44
WP_016242508.1|3223393_3223561_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	96.4	1.9e-23
WP_038819281.1|3223557_3224202_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.1	3.7e-131
WP_051045473.1|3224198_3224660_+	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	84.4	6.0e-43
WP_051045470.1|3224656_3225223_+	ead/Ea22-like family protein	NA	A0A222YWM9	Escherichia_phage	60.1	9.7e-43
WP_038819279.1|3225197_3225383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038819278.1|3225382_3225931_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	55.6	6.1e-50
WP_162829202.1|3226083_3227297_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000609349.1|3227569_3228238_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
3228131:3228147	attL	GCTAACAAGGTTGGTCG	NA	NA	NA	NA
WP_001291844.1|3228478_3228691_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994802.1|3228726_3229095_+	hypothetical protein	NA	A0A0P0ZCA9	Stx2-converting_phage	99.2	5.7e-52
WP_000453637.1|3229173_3229356_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3229339_3230509_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3230940_3232098_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3232272_3233409_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000960724.1|3233418_3234099_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3234085_3234553_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3234552_3235122_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
3234907:3234923	attR	GCTAACAAGGTTGGTCG	NA	NA	NA	NA
>prophage 14
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	3477937	3538665	5516497	holin,integrase,tail,tRNA,transposase	Enterobacteria_phage(31.58%)	60	3514268:3514282	3544071:3544085
WP_000997403.1|3477937_3478975_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3479181_3479601_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3479669_3480368_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3480399_3483060_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3483173_3484529_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3484574_3484898_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3484894_3486193_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3491966_3494540_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3494669_3495401_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3495397_3496378_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3496512_3497250_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3497520_3497862_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3497965_3498013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3498111_3499272_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3499314_3500436_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3500446_3501517_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3501726_3502092_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3502241_3502760_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3502749_3503976_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3503991_3504474_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3504550_3504898_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3504939_3505707_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3505737_3506286_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3506304_3506553_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3506689_3508051_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3508217_3509009_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3509030_3510317_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3510371_3510965_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3511087_3511966_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3512051_3513713_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3513861_3514203_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3514264_3514555_-	RnfH family protein	NA	NA	NA	NA	NA
3514268:3514282	attL	TTTATTCGCTGATTT	NA	NA	NA	NA
WP_000600190.1|3514544_3515021_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3515152_3515635_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3516480_3516729_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3517230_3517821_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3518003_3518654_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3518732_3519791_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3519920_3520343_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3520503_3520773_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3520990_3522203_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3522704_3523052_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3523048_3523429_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3523785_3524130_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3524134_3524350_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3524499_3526353_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3526760_3526928_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3527013_3527757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3528009_3528633_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3528629_3529295_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3529291_3529903_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3529877_3530444_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|3530797_3531553_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001418122.1|3531555_3531891_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150578.1|3531966_3533211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3533606_3534020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3534117_3534516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3534516_3536148_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|3536144_3537458_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3537459_3538665_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3544071:3544085	attR	TTTATTCGCTGATTT	NA	NA	NA	NA
>prophage 15
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	4619693	4633252	5516497	transposase,integrase	Enterobacteria_phage(66.67%)	15	4614909:4614922	4630236:4630249
4614909:4614922	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218979.1|4619693_4620863_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4620882_4622742_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4622738_4623164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446146.1|4623491_4624064_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4624137_4624638_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283029.1|4624634_4625369_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|4625920_4626187_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980245.1|4626183_4626774_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001244665.1|4626766_4627054_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459321.1|4627046_4627502_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.4e-63
WP_000856729.1|4627637_4627958_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783682.1|4627972_4630306_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
4630236:4630249	attR	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001171554.1|4630939_4631320_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4631316_4631664_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|4631713_4633252_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
>prophage 16
NZ_CP018252	Escherichia coli strain 9000 chromosome, complete genome	5516497	5121180	5135845	5516497	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5122461:5122476	5139990:5140005
WP_000956557.1|5121180_5121714_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5121910_5122084_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5122131_5122413_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5122461:5122476	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5122757_5122955_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5123290_5123575_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5123571_5123922_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5123912_5124449_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5125770_5126370_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643171.1|5126434_5127748_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.1e-76
WP_001023355.1|5127749_5128019_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5128130_5128703_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5128775_5129405_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5129486_5130128_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5130288_5130537_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5130598_5131696_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5131784_5132822_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5132955_5133198_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5133363_5134347_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5134429_5135845_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5139990:5140005	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 1
NZ_CP018253	Escherichia coli strain 9000 plasmid pO157, complete sequence	95229	8213	62711	95229	integrase,protease,transposase	Stx2-converting_phage(37.5%)	45	41595:41609	62436:62450
WP_001034100.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|14293_15115_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15114_16221_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16310_18032_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18105_19104_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000998048.1|19394_20933_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|20982_21330_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|21326_21707_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001171554.1|22128_22509_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|22505_22853_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|22902_24441_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001358886.1|24875_27572_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|27658_28534_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|28534_30502_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|30501_32007_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|32008_33232_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|33262_33697_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|33693_34248_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|34262_34610_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|34606_35206_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|35202_36180_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|36218_37391_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|37377_37890_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|37947_38781_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|38872_39274_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|41164_41680_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
41595:41609	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|41681_44678_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|44727_46848_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|46851_48291_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|49034_49265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|49385_50126_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|50410_51388_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|51795_51996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|51992_52613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|52609_53293_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|53751_53970_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|53971_54277_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|54277_55084_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|55806_57020_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|56981_57320_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|57907_59074_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|59073_60045_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|60739_61642_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|61645_61951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|62027_62711_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
62436:62450	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
