The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	215672	279995	5411823	transposase,tRNA,plate	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215672_216968_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217020_217281_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217267_217468_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217633_218179_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218175_218586_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218599_219310_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219509_220334_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220386_222105_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222215_222923_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222919_223324_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223441_224257_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224296_224950_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224942_225974_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226161_226737_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232494_233298_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233294_234209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234449_235250_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235327_236098_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236145_237504_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237575_238331_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238364_239087_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239083_239551_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239615_240347_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240884_241685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242162_242612_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242614_243211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243289_243511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243531_244011_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243976_245386_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245396_248831_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248939_250352_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250356_251100_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251096_253874_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253882_254644_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254648_255980_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255982_256507_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256503_257784_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257808_258891_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258854_260705_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260708_261122_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261212_262604_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262654_262879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262913_263414_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264110_264629_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264838_266980_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509109.1|267055_271288_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271427_272144_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_072618939.1|273836_274532_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275277_276414_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278378_278642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278556_278742_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278822_279995_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	298781	312094	5411823	integrase,transposase,tail	Escherichia_phage(36.36%)	12	293211:293223	313452:313464
293211:293223	attL	AATTTATATTATG	NA	NA	NA	NA
WP_000749881.1|298781_299837_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300124_301228_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301239_302493_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303562_303808_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304134_305348_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000344820.1|305465_305909_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|305880_306474_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001115574.1|306473_306968_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000904979.1|306997_307552_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|307609_308383_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|309206_309950_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|310912_312094_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
313452:313464	attR	CATAATATAAATT	NA	NA	NA	NA
>prophage 3
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	891033	930446	5411823	portal,transposase,holin,integrase,protease,tail,terminase,lysis	Enterobacteria_phage(51.16%)	50	880475:880489	912769:912783
880475:880489	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|891033_892104_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|892081_892300_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|892339_892507_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|892749_893352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|893562_893784_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|893882_894098_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|894174_894366_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|894338_894521_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|894517_895198_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|895895_896078_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|896074_896245_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|896237_896858_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|896854_897520_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|897731_898691_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|899028_899151_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|899165_899855_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|900038_900782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|900867_901026_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|901106_901505_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|901647_901863_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|901862_902360_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|902356_902824_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|902811_902964_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|903638_904130_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|904129_906232_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|906228_906441_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072187152.1|906368_907493_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_127446149.1|907614_907950_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001442366.1|907894_909922_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|910008_910332_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|910324_910600_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|910611_911190_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|911186_911588_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|911598_912342_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|912402_912789_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
912769:912783	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|912797_913127_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_162829202.1|915398_916611_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000447253.1|917476_917806_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|917815_918514_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|918519_919263_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|919199_919808_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|919868_923282_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|923352_923952_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|924011_925328_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|925329_925599_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|925775_926756_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|926789_927809_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|928305_928467_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|928635_929517_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|929747_930446_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	1210134	1279606	5411823	portal,transposase,holin,integrase,protease,tail,terminase,head,capsid	Escherichia_phage(26.19%)	77	1210093:1210152	1249717:1251026
1210093:1210152	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|1210134_1211348_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000828648.1|1211523_1211691_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227927.1|1211760_1212279_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156526.1|1212347_1214108_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1214293_1214746_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1214821_1215862_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1216218_1216728_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1216946_1217576_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1217538_1219701_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1219710_1220157_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1220279_1222334_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1222365_1222824_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1222919_1223582_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1223754_1224168_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1224212_1224530_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1224587_1225778_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1225872_1226151_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1226147_1226477_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1226567_1227227_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1227634_1228654_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1228631_1228874_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1228941_1231413_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1231506_1231698_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1231694_1231883_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1232456_1232642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1232828_1233218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1233359_1233515_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1233792_1234080_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1234079_1234271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1234298_1234700_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1234808_1235081_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1235064_1235490_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1235696_1236152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1236230_1237322_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1237328_1238075_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1238096_1238867_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1238882_1239296_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1239647_1240421_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1241025_1241181_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1241348_1241627_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1241628_1242678_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1242690_1243062_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1243051_1243423_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1243574_1244393_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1245013_1245727_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1246494_1248345_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1248520_1249733_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1249938_1250253_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1250780_1250966_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1251187_1251301_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
1249717:1251026	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCATTAATTAATGAAAAATATTCTCAATTTGTACCCAACAAAGACAAACACGACCAGAGCACCTGTTCAGACAGGTTTACTTAAACGACTTATATATGACACAAAAAGCGACCACTAAAGTCGCTTTTTCTTATGGTAACAGGCAATAACGCTCTCAGATATTTTTTAGCATTTTTTTGACCGCGCGTTTCCGGACGTATTCTGTTCTCCTGTCCCTTTATATCGTCGGAATACCCGCCGCTCTTCAAATCCCATTCCCAACTCAGAATGTAGTCTGTTGACCGCTTGTTTTATTTCGGTCAGGTTCACCGGTGAAACCGGAGTCCGGCGCGCCTTACGCAAACACTCTGCTCGTTTCTGTGCCGCCACTTTTCTTTTCTGGTCATCACTTAGCTGTACCATCACTTTTGCCCATCGTTCAGCTGCTCTCCGGTACAGTCCTTTTTTCTCCAGACATTCTGCCACGTGATCATGTAGCATAAGTGACCTCCGATTATCTACAGACTGCCATCCTGAATTTACCTTCCCTTAATGAAATAACAATAAAAAACAAACCACGCAAAAACAATAAAACAACACACAAAAAAAACTAAATAATAAACAAAAATAATCACCTTATTTTATTATTTTTTGAGGGAGCAATTACTGAACAAAAAACGCTGACTATATACTCAAAACCAAACAACTATTCTGCCAATCAGGTATCATGGCAACACACGGAATTACCGTGTTTTTGCCTTCTCTGCCCATACAATACGGGCATATACTTCATTCTCTATTGTAATATTTCTATCCATGTGCCCCACTCCATTTACCTGTAAATAATATTCAAAATATTTATCACAGAAATCGTTTTTGGCCATGAACTGAGCACACTATAAAGTCCGGAACTGACTCTTTGTTAAATTACCTTAACGTTACCAGTAACACCCTCATAACAAAACATCACGGTATACACTGGGTACGGATATATTCCTGTGCTCCTTCCAGTTGCTTCTGCATTGCCATCAGCCGTTCTCTGAGGATGAAATAATCCCGTTCAGCGGTGTCTGCCAGTCGGGGGCCGGTTGCATTATCCACGCCGGAGGTGCCGGTGGCTTCACGCACGGTACCGGAGCAGGTGGCGTTGATCCGCAGGCGCTTACGACCAGCGGCAACATCAGCACGCAGAGTTTCATTTTCAGCTCTCGCATCGGCTAATTCCCTCGAGTATCTGGCATCAAGTGCAGCGACATCACGCTGGCGTATCTGCA	NA	NA	NA	NA
WP_001003118.1|1251521_1252055_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1252214_1252487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1252742_1252949_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235436.1|1253699_1254209_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|1256093_1256300_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1256296_1257889_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1257878_1259384_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1259420_1259768_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1259825_1260092_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1260073_1260814_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1260827_1261259_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1261285_1261699_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_032106087.1|1261679_1264259_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847298.1|1264255_1264585_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|1264584_1265283_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_053893906.1|1265293_1266037_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	1.1e-147
WP_149025606.1|1265982_1266615_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	1.8e-101
WP_000649829.1|1266805_1267333_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072618954.1|1267466_1268642_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_149025607.1|1268593_1270939_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_001230444.1|1271006_1271606_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1271670_1272984_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1272985_1273255_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1275387_1276506_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1276502_1278296_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1278314_1279022_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1279018_1279606_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	1491587	1612598	5411823	portal,tRNA,transposase,holin,integrase,protease,tail,terminase,head,capsid,lysis	Enterobacteria_phage(38.1%)	149	1556179:1556194	1584433:1584448
WP_000952736.1|1491587_1492409_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1492564_1493611_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1493607_1494402_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1494568_1495687_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1495655_1495925_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1495986_1496376_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1496508_1497024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1497138_1497291_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1497606_1498083_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1498207_1498531_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1498514_1498940_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1499008_1500046_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1499957_1500500_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1500533_1501250_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1501282_1501564_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1501560_1501863_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1501852_1502170_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1502123_1502441_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1502427_1502865_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1502866_1503058_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1503060_1503648_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1503763_1503868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1504056_1504269_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1504436_1504715_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1504716_1505766_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|1505778_1506153_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1506149_1506971_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|1508049_1509987_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1510134_1510317_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1510354_1510624_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1510699_1510915_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1510919_1511264_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1511314_1511848_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1512118_1512688_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1512687_1512834_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1513061_1513268_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1513332_1513557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1513913_1514054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032173704.1|1514183_1514369_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000279796.1|1514410_1514776_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1515065_1515629_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_072618957.1|1515625_1517287_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1517350_1519288_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1519332_1519554_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1519499_1522001_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1522080_1522407_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1522416_1522767_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1522763_1523210_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1523206_1523551_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1523609_1524326_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1524331_1524706_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1524801_1525011_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|1525063_1528306_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|1528298_1528640_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1528639_1529338_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1529354_1529609_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1529718_1529829_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1530131_1531010_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1531063_1531801_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1531746_1531983_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1531995_1532085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1532104_1534453_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1535043_1538445_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1540753_1541029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1541089_1542451_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1542814_1543678_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1543661_1544798_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1545047_1546274_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1546322_1547444_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1547692_1548922_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1549286_1549475_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1550279_1550477_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1550469_1550682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1550671_1551136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1551128_1551362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1551367_1551667_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1551663_1553064_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1553264_1553516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1553512_1553923_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1553933_1554206_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1554332_1554557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1554808_1555015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1555014_1556070_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1556082_1556418_+|head	head decoration protein	head	NA	NA	NA	NA
1556179:1556194	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1556430_1556844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1557049_1557592_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1557847_1558129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1558729_1560190_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1560189_1560861_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1561029_1562400_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1562403_1563045_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1563080_1564187_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1564240_1564702_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1564711_1565365_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1565536_1566787_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1566900_1568043_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1568032_1568269_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1569193_1569895_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1569891_1570194_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1570261_1570594_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1570658_1570781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1570838_1572365_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1572866_1573322_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1573321_1573492_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1573484_1573775_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1573771_1574134_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1574130_1574271_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1574267_1574957_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1575278_1575584_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1575570_1576047_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1576263_1576446_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1576536_1576830_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1577121_1577532_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1577817_1578024_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1578188_1578383_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1578771_1579317_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1579291_1581217_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1581213_1581420_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1581416_1583018_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1582998_1584318_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1584327_1584660_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1584433:1584448	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1584715_1585741_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1585782_1586181_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1586192_1586546_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000683120.1|1587131_1587527_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001143002.1|1587534_1588275_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1588290_1588713_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1588694_1589129_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1589121_1591671_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1591667_1591997_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1591996_1592695_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1592700_1593444_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1593380_1594013_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1594073_1597472_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1597538_1598138_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1598202_1601118_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1601117_1601699_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1601818_1602709_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1602727_1603234_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1603270_1603771_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1603849_1604032_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1604529_1605198_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1605254_1605503_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|1605578_1605959_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1605955_1606303_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1606352_1607891_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1608193_1609678_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1609864_1610818_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_162829202.1|1611384_1612598_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	1710152	1761119	5411823	portal,holin,integrase,tail,terminase,head,capsid,lysis	Escherichia_phage(36.21%)	68	1709081:1709094	1723671:1723684
1709081:1709094	attL	TCACGGTATACGGA	NA	NA	NA	NA
WP_000113674.1|1710152_1711283_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1711260_1711509_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1711573_1714045_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1714137_1714329_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1714325_1714514_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1715072_1715306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1715283_1715691_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1715713_1715932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1716004_1716304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1716567_1716975_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1717051_1717279_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1717262_1717814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140425393.1|1717785_1718826_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	83.5	2.6e-86
WP_072130322.1|1718737_1719280_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450627.1|1719313_1720030_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|1720062_1720344_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1720340_1720568_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1720560_1720872_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|1720999_1721218_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1721219_1721777_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1722010_1722223_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1722342_1722687_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1722808_1723081_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1723082_1724132_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
1723671:1723684	attR	TCCGTATACCGTGA	NA	NA	NA	NA
WP_001217444.1|1724144_1724450_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|1724512_1725067_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1725291_1725489_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1725624_1726338_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|1726788_1727220_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|1727697_1729548_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|1729986_1730202_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|1730206_1730551_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1730601_1731135_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1731405_1731975_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1731974_1732121_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_072618960.1|1732128_1732596_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	90.9	2.6e-70
WP_001302717.1|1733059_1733374_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1733455_1733680_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1734066_1734612_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001692162.1|1734586_1736512_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198153.1|1736508_1736715_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1736711_1738313_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1738293_1739613_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1739622_1739955_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1740010_1741036_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1741077_1741476_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1741487_1741841_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1741855_1742389_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1742385_1742781_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1742788_1743541_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1743554_1743977_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1744003_1744417_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|1744397_1747010_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|1747006_1747336_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|1747335_1748034_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|1748044_1748788_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_071601640.1|1748733_1749363_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_072618961.1|1749603_1750779_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.7	7.5e-231
WP_149025608.1|1750730_1753082_+	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_001230508.1|1753149_1753749_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_046671432.1|1753813_1755127_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|1755128_1755398_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|1755511_1756087_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1756159_1756789_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1756870_1757512_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|1757673_1757916_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|1759419_1760880_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1760915_1761119_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2030417	2098025	5411823	portal,transposase,holin,protease,tail,head,terminase,capsid	Stx2-converting_phage(40.74%)	72	NA	NA
WP_000422055.1|2030417_2031467_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2031686_2032445_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2032441_2033032_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2033071_2033944_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2034156_2035740_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2035767_2036388_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2036384_2037266_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2037403_2037448_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2037539_2039102_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2039101_2040697_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983858.1|2040697_2042059_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2042070_2043264_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2043263_2044070_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2044450_2044630_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2044715_2045216_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2045261_2045768_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_187661344.1|2047081_2047732_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	31.9	4.3e-26
WP_001144877.1|2049238_2049829_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2050012_2050660_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2050796_2050943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2051370_2051649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2051988_2052369_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2052365_2052713_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072618941.1|2052762_2054301_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000938103.1|2055266_2055836_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2055901_2056813_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2056919_2057042_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2058639_2059965_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2060992_2061262_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2061263_2062577_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2062728_2063328_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2063395_2065741_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2065692_2066868_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2067210_2067843_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2067788_2068532_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001152184.1|2068542_2069241_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2069240_2069582_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212915.1|2069574_2072817_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2072869_2073079_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2073174_2073549_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2073554_2074271_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2074329_2074674_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2074670_2075117_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2075113_2075464_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2075473_2075800_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_149025604.1|2075879_2078381_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_001063099.1|2078326_2078548_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2078592_2080530_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2080593_2082255_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2082251_2082815_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|2083105_2083471_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2083512_2083740_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2084164_2084350_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2084577_2084724_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2084723_2085293_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2085563_2086097_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2086147_2086492_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2086496_2086712_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_072618963.1|2087151_2089002_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001303509.1|2089480_2089909_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2090545_2091235_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2091231_2091591_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2091603_2092653_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2092654_2092933_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2093100_2093313_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2093501_2093606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2093721_2094306_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2094362_2094758_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2095568_2096309_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2096315_2097278_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2097300_2097726_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2097722_2098025_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2411592	2462714	5411823	integrase,transposase,tRNA,tail	Enterobacteria_phage(60.0%)	59	2404816:2404831	2462793:2462808
2404816:2404831	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2411592_2413326_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001684587.1|2413502_2413991_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2414110_2414503_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2414502_2416581_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2416573_2417722_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2417923_2418568_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2418578_2418968_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2418982_2420032_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2420034_2420895_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2420913_2422515_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2422560_2424222_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2424364_2424868_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2424888_2426853_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795629.1|2426857_2427784_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2427780_2428668_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2428794_2429373_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2429375_2429726_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2430505_2430934_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2430940_2432365_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2432339_2433140_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2433306_2434293_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2434307_2435822_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2435891_2436881_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2437677_2438181_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2438260_2438512_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2438626_2438713_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2438974_2439298_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2439468_2439966_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2440002_2440242_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2440433_2441645_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2441706_2442372_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2442728_2443730_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2443735_2444083_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2444112_2444763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2444778_2445183_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2445272_2445410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2445481_2445685_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2445706_2446057_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2446067_2446346_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2446357_2446600_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2446596_2446710_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2446802_2447219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2447242_2447446_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2447442_2447709_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2447705_2448005_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2448016_2448634_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2448630_2448996_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2449002_2451825_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2451901_2452861_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2452865_2453180_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2454271_2454802_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2454845_2455418_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2455574_2456063_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2458865_2459021_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2459029_2459395_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2459449_2459962_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2459961_2461146_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2461303_2461627_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2461577_2462714_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2462793:2462808	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2520293	2588833	5411823	portal,transposase,holin,integrase,tail,terminase,head,capsid	Escherichia_phage(34.09%)	67	2536090:2536105	2594492:2594507
WP_001023445.1|2520293_2520563_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_000268876.1|2520564_2521878_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_072618965.1|2521942_2522542_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	1.7e-109
WP_122995769.1|2526327_2526957_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	2.1e-102
WP_072618966.1|2526902_2527646_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	8.6e-148
WP_001151105.1|2527656_2528355_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2528354_2528684_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032106087.1|2528680_2531260_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000533402.1|2531240_2531654_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2531680_2532112_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2532125_2532866_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2532847_2533114_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2533171_2533519_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2533555_2535061_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2535050_2536643_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2536090:2536105	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2536639_2536846_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2538730_2539240_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2539634_2539859_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2539940_2540255_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2540789_2540975_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_162829202.1|2541239_2542453_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001280929.1|2542515_2542647_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2542659_2542842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2542997_2543531_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2543581_2543926_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2543930_2544146_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2544456_2545669_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2545751_2547602_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2549142_2549832_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2549828_2550188_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2550200_2551250_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2551251_2551530_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2551697_2551910_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2552096_2552201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2552310_2552874_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2553000_2553312_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2553308_2553461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2553493_2553850_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2553846_2554071_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2554092_2554791_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2554825_2555368_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2555279_2556317_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2556385_2556811_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2556807_2557035_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2557132_2557777_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2558051_2558204_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2558684_2558873_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2558869_2559058_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|2559153_2561625_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2561683_2561887_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2561886_2562909_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2563144_2563942_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2564431_2572414_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2572675_2573728_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2574041_2575358_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2575459_2576914_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2577256_2577973_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2578598_2580242_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2580359_2581310_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2581411_2582329_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2582785_2583721_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2583782_2584862_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2584873_2585617_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2585613_2586159_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2586520_2586901_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2586897_2587245_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072618941.1|2587294_2588833_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
2594492:2594507	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 10
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2592799	2660490	5411823	portal,transposase,holin,integrase,protease,tail,head,terminase,capsid,lysis	Stx2-converting_phage(53.95%)	89	2646512:2646526	2662642:2662656
WP_162829204.1|2592799_2594012_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000638172.1|2593996_2594878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|2594874_2595780_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|2595776_2596847_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|2596982_2597666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2597681_2598092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|2598312_2599134_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|2599215_2599695_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|2599709_2600186_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2600248_2600470_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|2600543_2600912_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2601370_2601565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2601577_2601691_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|2602177_2602360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2602460_2602790_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|2602961_2604020_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2604218_2604692_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|2604810_2605977_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2607301_2607952_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2608176_2609052_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023353.1|2609192_2609462_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_072618967.1|2609463_2610777_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	2.4e-76
WP_001230508.1|2610841_2611441_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234929.1|2611507_2614987_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_050546863.1|2615246_2615879_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2615824_2616562_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2616615_2617539_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2617609_2617783_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2617890_2618211_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|2618227_2618926_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|2618925_2619267_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2619259_2622502_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2622549_2622759_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2622854_2623229_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2623243_2623960_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2624025_2624370_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2624366_2624813_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2624809_2625160_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2625169_2625496_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_072618968.1|2625498_2628564_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	84.1	0.0e+00
WP_001063099.1|2628509_2628731_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2628775_2630713_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2630776_2632438_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2632434_2632998_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_000279809.1|2633289_2633655_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000095749.1|2633696_2633924_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2634386_2634644_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2634640_2635138_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|2635340_2635778_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|2635774_2636272_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000284515.1|2636271_2636487_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2636563_2636836_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143464.1|2636876_2637056_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_072618969.1|2637192_2639130_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2639373_2639697_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2639993_2640263_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2640274_2641234_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2641883_2642372_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2642362_2643034_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2643030_2643636_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004033.1|2643635_2644358_-	phage antirepressor protein	NA	Q4A1A3	Enterobacteria_phage	98.8	1.7e-129
WP_000178725.1|2644432_2645107_-	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	95.1	1.8e-120
WP_000211415.1|2645368_2645704_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	96.4	3.0e-52
WP_001254240.1|2645969_2646161_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	2.9e-31
WP_000814616.1|2646157_2646568_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
2646512:2646526	attL	GGCATTTATTGCAGC	NA	NA	NA	NA
WP_001442362.1|2646564_2646897_-	hypothetical protein	NA	A0A0P0ZCZ1	Stx2-converting_phage	100.0	5.7e-59
WP_149025605.1|2647360_2647963_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	1.8e-108
WP_162829202.1|2648000_2649213_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000067727.1|2649360_2649576_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2649650_2650346_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2650847_2651369_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2651937_2652120_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2652097_2652370_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2652428_2652680_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2652862_2653231_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2653303_2653468_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2653436_2653580_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2653654_2653951_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2653956_2654742_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|2654738_2655419_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|2655415_2655598_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2655570_2655762_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000188870.1|2655838_2656054_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2656152_2656374_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2656370_2657318_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2658179_2658530_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2658717_2659062_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2659139_2659331_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2659311_2660490_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2662642:2662656	attR	GCTGCAATAAATGCC	NA	NA	NA	NA
>prophage 11
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2743714	2781769	5411823	portal,tRNA,plate,holin,integrase,tail,head,terminase,capsid,lysis	Escherichia_phage(62.22%)	50	2748014:2748041	2779962:2779989
WP_000675144.1|2743714_2745118_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2745114_2745837_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2746027_2746360_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2746507_2747869_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2748014:2748041	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2748142_2748361_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2748442_2749606_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2749605_2750085_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2750099_2752547_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2752539_2752659_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2752691_2752967_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2753023_2753542_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001684736.1|2753554_2754745_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.0e-223
WP_072618971.1|2754804_2755386_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	94.9	2.6e-99
WP_000983068.1|2755413_2755947_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_001057694.1|2755946_2756549_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|2756520_2756964_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_000217053.1|2756984_2758184_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001285352.1|2758180_2758792_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2758784_2759693_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2759697_2760045_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2760041_2760677_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001809.1|2760743_2761196_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_000917144.1|2761188_2761656_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2761618_2761792_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2761763_2762189_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2762176_2762602_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2762616_2763114_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2763113_2763395_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2763398_2763602_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2763601_2764111_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2764210_2764954_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2764957_2766031_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2766089_2766944_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2767117_2768890_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2768889_2769924_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2770241_2772209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2772208_2772661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2772707_2773931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2774020_2776303_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2776292_2776568_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2776564_2776789_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2776791_2777091_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2777090_2777315_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2777378_2777879_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2777875_2778046_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2778056_2778332_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2778453_2778753_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2778868_2779882_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2780146_2780464_-	hypothetical protein	NA	NA	NA	NA	NA
2779962:2779989	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2780869_2781769_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 12
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	2807388	2884596	5411823	portal,tRNA,holin,tail,head,terminase,capsid,lysis	Enterobacteria_phage(41.33%)	86	NA	NA
WP_001301615.1|2807388_2809422_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2816379_2820009_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2820070_2820388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2821628_2822717_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2822727_2824257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2824275_2825007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2824999_2826136_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2826132_2828136_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2828260_2828722_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2828763_2829234_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2829280_2830000_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2829996_2831682_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|2832196_2832445_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|2832606_2833248_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|2833329_2833746_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023445.1|2833906_2834176_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_000268876.1|2834177_2835491_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001230508.1|2835555_2836155_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234929.1|2836221_2839701_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_050546863.1|2839960_2840593_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2840538_2841276_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2841329_2842253_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2842323_2842497_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2842604_2842925_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|2842941_2843640_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|2843639_2843981_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2843973_2847216_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2847263_2847473_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2847568_2847943_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2847957_2848674_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2848739_2849084_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2849080_2849527_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2849523_2849874_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2849883_2850210_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_072618968.1|2850212_2853278_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	84.1	0.0e+00
WP_001063099.1|2853223_2853445_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2853489_2855427_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2855490_2857152_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2857148_2857712_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_000279809.1|2858002_2858368_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000095749.1|2858409_2858637_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2859099_2859357_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2859353_2859851_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|2860053_2860491_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|2860487_2860985_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000284515.1|2860984_2861200_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2861276_2861549_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143464.1|2861589_2861769_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_064234927.1|2861905_2863843_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000752026.1|2864342_2864612_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2864621_2865569_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204769.1|2866075_2866510_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2866595_2866736_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2866732_2867095_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|2867091_2867382_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2867374_2867545_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|2867544_2868000_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|2867996_2868098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|2868188_2868470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|2868513_2868711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|2868938_2869223_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|2869219_2869921_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000147884.1|2869917_2870937_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_001182876.1|2870933_2871473_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|2871836_2872529_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|2872635_2874243_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|2874746_2875037_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|2875112_2875409_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2875414_2876200_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2876196_2876874_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2876873_2877056_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2877028_2877220_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2877296_2877512_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2877610_2877832_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2877828_2878776_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2878777_2878954_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2879287_2879644_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2879640_2880003_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2880090_2880333_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2880336_2880471_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2880489_2880744_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2880777_2882064_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2882084_2882786_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2882845_2882953_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2882933_2883665_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2883669_2884596_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	3130285	3135711	5411823	integrase	Enterobacteria_phage(50.0%)	6	3120736:3120752	3132700:3132716
3120736:3120752	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3130285_3131218_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3131529_3132687_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3132861_3133998_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3132700:3132716	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_072618973.1|3134007_3134688_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	70.5	3.4e-58
WP_000403517.1|3134674_3135142_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3135141_3135711_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 14
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	3377688	3438622	5411823	transposase,tRNA,holin,integrase,tail	Enterobacteria_phage(30.0%)	59	3418958:3419017	3437356:3438666
WP_000138184.1|3377688_3378387_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082974.1|3378418_3381079_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3381192_3382548_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3382593_3382917_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3382913_3384212_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3389987_3392561_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3392690_3393422_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3393418_3394399_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3394533_3395271_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3395541_3395883_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3395986_3396034_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200120.1|3396132_3397293_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3397335_3398457_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3398467_3399538_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3399747_3400113_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3400262_3400781_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3400770_3401997_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3402012_3402495_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3402571_3402919_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3402960_3403728_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3403758_3404307_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3404325_3404574_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3404710_3406072_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3406238_3407030_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3407051_3408338_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3408392_3408986_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3409108_3409987_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3410072_3411734_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3411882_3412224_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3412285_3412576_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3412565_3413042_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3413173_3413656_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3414501_3414750_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3415251_3415842_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3416024_3416675_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3416753_3417812_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3417941_3418364_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3418524_3418794_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
3418958:3419017	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|3419011_3420224_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3420725_3421073_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3421069_3421450_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3421806_3422151_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3422155_3422371_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3422520_3424374_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3424781_3424949_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3425034_3425778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3426030_3426654_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3426650_3427316_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3427312_3427924_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3427898_3428465_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001418122.1|3429582_3429918_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150583.1|3429993_3431196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3431591_3432005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3432102_3432501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3432501_3434133_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_072618975.1|3434129_3435443_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3435444_3436650_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001071599.1|3436972_3437179_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_162829202.1|3437409_3438622_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
3437356:3438666	attR	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAGCGGGCGATTCGTATGGTTCTGGAAAGTCAGGATGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGTGGGCTCACCAGCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCACGACGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAG	NA	NA	NA	NA
>prophage 15
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	5016487	5031152	5411823	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	19	5017768:5017783	5035297:5035312
WP_000956557.1|5016487_5017021_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5017217_5017391_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5017438_5017720_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5017768:5017783	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5018064_5018262_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5018597_5018882_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5018878_5019229_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5019219_5019756_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230302.1|5021077_5021677_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_064234994.1|5021741_5023055_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001023355.1|5023056_5023326_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5023437_5024010_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5024082_5024712_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143817.1|5024793_5025435_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_001217542.1|5025595_5025844_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5025905_5027003_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5027091_5028129_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5028262_5028505_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5028670_5029654_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5029736_5031152_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5035297:5035312	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 16
NZ_CP018243	Escherichia coli strain 350 chromosome, complete genome	5411823	5168031	5227042	5411823	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5168031_5169291_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5169293_5170298_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5170379_5170577_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5170680_5171979_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5172183_5172609_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5172647_5175089_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5175269_5176001_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5176127_5176529_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5176547_5177246_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5177296_5177956_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5177973_5178372_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5178381_5179020_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5179022_5180186_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_077892111.1|5180269_5181895_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5182011_5182287_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5182435_5182765_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569692.1|5182946_5183696_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5183692_5184448_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5185974_5187372_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5187387_5187693_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5187702_5188167_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5188180_5188831_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5188840_5189695_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5189694_5190381_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5190509_5190785_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5191111_5191507_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5191513_5191828_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5191832_5192060_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5192101_5192551_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5192621_5193416_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5194038_5194470_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5194477_5195686_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5195820_5196459_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5196676_5197297_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5197605_5199018_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5199062_5199725_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5199832_5200798_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5200905_5201766_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5201854_5202235_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5202352_5204296_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5204485_5205226_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5205437_5206376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5206438_5206993_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5207317_5207524_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5207602_5208946_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5209268_5209907_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5210112_5211846_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5211842_5215622_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5215624_5215966_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5216177_5216429_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5216422_5216773_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5216852_5217383_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5217692_5218649_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5218788_5220291_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5220304_5221327_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5221313_5222309_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5222341_5223340_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5223515_5224889_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5225044_5225596_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5225689_5227042_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
