The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	215671	279926	5513531	tRNA,plate,transposase	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215671_216967_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217019_217280_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217266_217467_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217632_218178_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218174_218585_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218598_219309_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219508_220333_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220385_222104_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222214_222922_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222918_223323_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223440_224256_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224295_224949_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224941_225973_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226160_226736_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232493_233297_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233293_234208_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234448_235249_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235326_236097_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236144_237503_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237574_238330_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238363_239086_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239082_239550_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239614_240346_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240883_241684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242161_242611_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242613_243210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243288_243510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243530_244010_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243975_245385_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245395_248830_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248966_250379_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250383_251127_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|251123_253901_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|253909_254671_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254675_256007_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256009_256534_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256530_257811_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257835_258918_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258881_260732_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260735_261149_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261239_262631_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262681_262906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262940_263441_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264137_264656_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264865_267007_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_149026308.1|267082_271315_+	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271454_272171_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001452927.1|273929_274463_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275208_276345_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278309_278573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278487_278673_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278753_279926_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	300054	312642	5513531	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_001285288.1|300054_301158_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301169_302423_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303492_303738_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304064_305278_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001274756.1|306383_307097_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|307197_307398_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251067.1|307516_307810_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000788819.1|308761_309073_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000904979.1|311256_311811_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311868_312642_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
>prophage 3
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	896373	935786	5513531	lysis,tail,portal,holin,transposase,terminase,integrase,protease	Enterobacteria_phage(50.0%)	51	885815:885829	919422:919436
885815:885829	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_089625990.1|896373_897312_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
WP_162829202.1|897437_898650_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303849.1|898734_898953_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|898992_899160_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|899402_900005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|900215_900437_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|900535_900751_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|900827_901019_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|900991_901174_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|901170_901851_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|902548_902731_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|902727_902898_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|902890_903511_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|903507_904173_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|904384_905344_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|905681_905804_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|905818_906508_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|906691_907435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|907520_907679_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|907759_908158_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|908300_908516_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|908515_909013_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|909009_909477_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|909464_909617_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|910291_910783_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|910782_912885_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|912881_913094_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|913021_914146_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|914267_914603_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|914547_916575_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|916661_916985_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|916977_917253_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|917264_917843_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|917839_918241_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|918251_918995_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|919055_919442_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
919422:919436	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|919450_919780_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|919751_922817_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|922816_923146_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|923155_923854_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|923859_924603_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|924539_925148_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_072616970.1|925208_928622_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001233141.1|928692_929292_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|929351_930668_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|930669_930939_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|931115_932096_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|932129_933149_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|933645_933807_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|933975_934857_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|935087_935786_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	1162019	1231849	5513531	tail,head,portal,holin,transposase,capsid,integrase,protease	Escherichia_phage(25.58%)	76	1170507:1170522	1191873:1191888
WP_000156526.1|1162019_1163780_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1163965_1164418_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1164493_1165534_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1165890_1166400_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1166618_1167248_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1167210_1169373_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1169382_1169829_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1169951_1172006_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1170507:1170522	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1172037_1172496_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1172591_1173254_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1173426_1173840_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1173884_1174202_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1174259_1175450_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1175544_1175823_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1175819_1176149_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1176239_1176899_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1177306_1178326_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1178303_1178546_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1178613_1181085_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1181178_1181370_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1181366_1181555_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1182128_1182314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1182500_1182890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1183031_1183187_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1183464_1183752_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1183751_1183943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1183970_1184372_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1184480_1184753_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1184736_1185162_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1185368_1185824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1185902_1186994_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1187000_1187747_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1187768_1188539_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1188554_1188968_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1189319_1190093_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1190697_1190853_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1191020_1191299_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1191300_1192350_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1191873:1191888	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1192362_1192734_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1192723_1193095_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1193246_1194065_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1194685_1195399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1196166_1198017_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1198192_1199405_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1199610_1199925_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1200452_1200638_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1200859_1200973_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1201193_1201727_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1201886_1202159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1202414_1202621_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1203371_1203647_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171540.1|1203722_1204103_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1204099_1204447_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1204496_1206035_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1208196_1208403_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1208399_1209992_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1209981_1211487_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1211523_1211871_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1211928_1212195_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1212176_1212917_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1212930_1213362_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1213388_1213802_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|1213782_1215645_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_134790849.1|1215596_1216361_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|1216357_1216687_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1216686_1217385_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1217395_1218139_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_000649829.1|1218906_1219434_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515110.1|1219567_1223041_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230444.1|1223108_1223708_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1223772_1225086_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1225087_1225357_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1227630_1228749_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1228745_1230539_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1230557_1231265_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1231261_1231849_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	1494906	1566384	5513531	tail,head,holin,transposase,capsid,terminase,protease	Stx2-converting_phage(30.65%)	83	NA	NA
WP_077699040.1|1494906_1495296_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1495428_1495944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1496058_1496211_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1496526_1497003_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1497127_1497451_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1497434_1497860_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001457513.1|1497928_1498966_+	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_072143019.1|1498877_1499420_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1499453_1500170_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1500202_1500484_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1500480_1500783_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1500772_1501090_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1501043_1501361_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1501347_1501785_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1501786_1501978_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1501980_1502568_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1502683_1502788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1502976_1503189_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1503356_1503635_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1503636_1504686_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1504698_1505073_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1505069_1505891_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|1506969_1508907_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1509054_1509237_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1509274_1509544_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1509619_1509835_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1509839_1510184_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1510234_1510768_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1511038_1511608_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1511607_1511754_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1511981_1512188_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1512252_1512477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1512833_1512974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1513103_1513289_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279786.1|1513330_1513696_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958387.1|1513984_1514548_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_038425863.1|1514544_1516206_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1516269_1518207_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1518251_1518473_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1520999_1521326_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1521335_1521686_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1521682_1522129_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1522125_1522470_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1522528_1523245_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1523250_1523625_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1523720_1523930_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072616981.1|1523982_1527225_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.6	0.0e+00
WP_000807954.1|1527217_1527559_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072616982.1|1527558_1528257_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	6.8e-131
WP_000194720.1|1528267_1529011_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1528956_1529589_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_072616983.1|1529931_1533405_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.4	0.0e+00
WP_001228304.1|1533472_1534072_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1534223_1535537_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1535538_1535808_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1536834_1538160_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1539759_1539882_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1539988_1540900_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1540965_1541535_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1542500_1544039_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1544088_1544436_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1544432_1544813_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1545152_1545431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1545858_1546005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1546141_1546789_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1546972_1547563_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|1549069_1549720_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001079499.1|1551033_1551540_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056499.1|1551585_1552086_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1552171_1552351_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1552731_1553538_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1553537_1554731_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1554742_1556104_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1556104_1557700_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|1557699_1559262_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1559353_1559398_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1559535_1560417_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1560413_1561034_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1561061_1562645_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1562857_1563730_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1563769_1564360_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1564356_1565115_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1565334_1566384_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	1650025	1703812	5513531	tail,head,holin,tRNA,capsid,terminase,integrase	Stx2-converting_phage(43.86%)	64	1655362:1655387	1705807:1705832
WP_000628061.1|1650025_1651258_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1651512_1652496_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|1652770_1652941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|1652973_1654347_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|1654475_1655411_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
1655362:1655387	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_001358842.1|1655462_1656698_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_000079602.1|1656699_1656915_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	2.3e-37
WP_001302840.1|1657014_1657203_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001502425.1|1657446_1658256_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_001502426.1|1658248_1660849_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	5.1e-248
WP_001502427.1|1660950_1661226_-	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	5.2e-42
WP_065336296.1|1661299_1661470_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_000560228.1|1661469_1661691_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_000935592.1|1661737_1662586_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_001169149.1|1663014_1663167_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|1663547_1664012_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|1664116_1664392_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|1664375_1664798_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|1664810_1665668_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000788990.1|1665674_1666421_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_072616986.1|1666442_1667195_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.6	1.8e-76
WP_001502613.1|1667181_1667910_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	54.8	4.3e-51
WP_000172332.1|1667906_1668392_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	5.7e-68
WP_072616987.1|1669787_1670450_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	54.5	9.5e-74
WP_001278450.1|1670565_1670670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175526.1|1670858_1671071_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	4.0e-26
WP_000119356.1|1671281_1671461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818161.1|1671479_1671965_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000687443.1|1672165_1672339_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_001502554.1|1672398_1672998_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000228020.1|1672997_1673288_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_001502553.1|1673284_1673827_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.1e-75
WP_000735807.1|1674312_1674537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175525.1|1674589_1674811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001359877.1|1674989_1675421_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_072616988.1|1675991_1677842_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_029785460.1|1678276_1678492_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|1678496_1678841_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992168.1|1678891_1679425_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_001056806.1|1679695_1680265_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1680264_1680411_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1680638_1680824_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095749.1|1681248_1681476_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1681517_1681883_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958380.1|1682170_1682734_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1682730_1684392_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000173079.1|1684455_1686393_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|1686437_1686659_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000126019.1|1689184_1689511_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1689520_1689871_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1689867_1690314_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1690310_1690655_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1690713_1691430_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1691435_1691810_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1691905_1692115_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212915.1|1692167_1695410_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1695402_1695744_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_059214312.1|1695743_1696442_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_072616989.1|1696452_1697196_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.1	3.0e-145
WP_140439088.1|1697141_1697774_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_072616991.1|1698022_1701496_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.6	0.0e+00
WP_001230471.1|1701563_1702163_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_072617073.1|1702227_1703541_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.1e-76
WP_001023356.1|1703542_1703812_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
1705807:1705832	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
>prophage 7
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	1888200	1986466	5513531	tail,lysis,head,portal,holin,transposase,capsid,terminase,integrase	Escherichia_phage(30.77%)	121	1931478:1931491	1987345:1987358
WP_000214712.1|1888200_1888404_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|1888439_1889900_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|1891403_1891646_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|1891807_1892449_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|1892530_1893160_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|1893232_1893808_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|1893921_1894191_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072616998.1|1894192_1895506_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001230508.1|1895570_1896170_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072616999.1|1896237_1899717_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.3	0.0e+00
WP_064562156.1|1899957_1900587_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_054191786.1|1900532_1901276_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_072617001.1|1901286_1901985_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|1901984_1902314_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617002.1|1902310_1904923_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
WP_000533440.1|1904903_1905317_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|1905343_1905766_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|1905779_1906532_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|1906539_1906935_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|1906931_1907465_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|1907479_1907833_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|1907844_1908243_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|1908284_1909310_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001457523.1|1909365_1909698_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_000123254.1|1909707_1911027_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|1911007_1912609_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|1912605_1912812_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|1912808_1914734_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|1914708_1915254_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|1915640_1915865_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|1915946_1916261_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072617003.1|1916724_1917192_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	88.3	3.2e-68
WP_000539792.1|1917199_1917346_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1917345_1917915_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|1918185_1918719_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|1918769_1919114_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_187655776.1|1919118_1919334_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	95.8	5.0e-32
WP_072617005.1|1919772_1921623_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|1922100_1922532_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|1922982_1923696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|1923831_1924029_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|1924253_1924808_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|1924870_1925176_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|1925188_1926238_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1926239_1926512_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1926633_1926978_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1927097_1927310_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1927543_1928101_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1928102_1928321_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1928448_1928760_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1928752_1928980_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1928976_1929258_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|1929290_1930007_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|1930040_1930502_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|1930494_1931538_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
1931478:1931491	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|1931606_1932032_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|1932015_1932258_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|1932649_1932988_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|1933280_1933433_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|1933444_1934083_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1934083_1934293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1934857_1935046_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1935042_1935231_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|1935323_1936568_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|1937278_1937521_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|1938483_1938864_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1938860_1939208_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1939257_1940796_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|1941378_1942029_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|1942738_1943314_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|1943427_1943697_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_071805583.1|1943698_1944922_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001230508.1|1944986_1945586_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001152180.1|1949319_1949757_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|1949756_1950098_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234971.1|1950090_1953333_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|1953385_1953595_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|1953690_1954065_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|1954070_1954787_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|1954845_1955190_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1955186_1955633_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|1955629_1955980_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|1955989_1956316_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|1958842_1959064_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|1959108_1961046_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|1961109_1962771_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958422.1|1962767_1963331_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279786.1|1963620_1963986_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|1964027_1964255_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|1964679_1964865_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1965092_1965239_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1965238_1965808_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|1966078_1966612_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|1966662_1967007_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|1967011_1967227_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|1967376_1969230_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935548.1|1970026_1971085_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|1971235_1971433_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|1971674_1972205_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|1972213_1972573_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|1972585_1973632_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_072617008.1|1973633_1973912_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_001217394.1|1973981_1974239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|1974459_1974672_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|1974950_1975709_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1976407_1976572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026311.1|1976568_1977150_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	79.7	4.3e-78
WP_157825328.1|1977336_1977879_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1977790_1978831_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|1978802_1979354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|1979337_1979565_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|1979641_1980049_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1980314_1980614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1980686_1980905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1980927_1981335_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1981312_1981546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1982104_1982293_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1982289_1982481_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|1982573_1985045_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1985109_1985358_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1985335_1986466_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
1987345:1987358	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 8
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2033162	2138528	5513531	tail,lysis,head,portal,holin,transposase,tRNA,capsid,terminase,integrase,protease	Enterobacteria_phage(50.0%)	106	2070309:2070324	2132431:2132446
WP_001299679.1|2033162_2034419_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2034632_2035256_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2035255_2036107_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2036257_2037205_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_072617010.1|2037329_2039009_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_000823885.1|2039063_2039342_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2039619_2040204_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2040320_2041412_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|2042255_2045141_+	pertactin family autotransporter	NA	NA	NA	NA	NA
WP_001310261.1|2045240_2047160_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|2047387_2048458_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2048468_2049101_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|2049111_2050530_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000060146.1|2052869_2053892_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|2053891_2054872_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|2054868_2055627_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|2056445_2057300_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|2057325_2059296_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|2059345_2059600_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|2060448_2061661_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_000051572.1|2062559_2063474_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2063569_2065306_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|2065463_2066677_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|2067014_2068085_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2068094_2069393_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2069722_2071255_+	SpoVR family protein	NA	NA	NA	NA	NA
2070309:2070324	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2071306_2072026_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2072247_2073789_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2073934_2074465_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2074510_2075779_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2075778_2076198_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2076570_2077482_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2077688_2078150_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2078226_2078886_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2078957_2079251_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|2079262_2079421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2079491_2079893_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|2079995_2080364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2080883_2081579_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2081602_2082415_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2082418_2082685_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|2083923_2084508_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2085006_2085960_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2086146_2087631_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|2087933_2089472_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2089521_2089869_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2089865_2090246_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|2090321_2090570_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2090626_2091295_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2091792_2091975_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2092053_2092554_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2092590_2093097_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2093115_2094006_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|2094125_2094707_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|2094706_2097622_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|2097686_2098286_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_072617011.1|2098352_2101751_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090920.1|2101811_2102444_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|2102380_2103124_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|2103129_2103828_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000459457.1|2104413_2104848_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|2104829_2105252_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|2105267_2106008_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|2106015_2106411_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_072617012.1|2106996_2107350_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158906.1|2107361_2107760_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2107801_2108827_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2108882_2109215_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2109224_2110544_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2110524_2112126_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2112122_2112329_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|2112325_2114251_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|2114225_2114771_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|2115159_2115354_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2115518_2115725_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2116010_2116421_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2116712_2117006_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|2117096_2117279_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|2117495_2117972_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|2117958_2118264_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|2118585_2119275_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|2119271_2119412_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|2119408_2119771_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|2119767_2120058_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2120050_2120221_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|2120220_2120676_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|2121177_2122704_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|2122761_2122884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|2122948_2123281_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2123348_2123651_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|2123647_2124349_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|2125273_2125510_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|2125499_2126642_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|2126755_2128006_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|2128177_2128831_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2128840_2129302_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|2129355_2130462_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|2130497_2131139_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2131142_2132513_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
2132431:2132446	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|2132681_2133353_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|2133352_2134813_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2135413_2135695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2135950_2136493_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|2136698_2137112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|2137124_2137460_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|2137472_2138528_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 9
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2144619	2194931	5513531	tail,head,holin,transposase,capsid,terminase,integrase	Stx2-converting_phage(37.21%)	52	2144027:2144040	2153323:2153336
2144027:2144040	attL	CAGATGATTGATGT	NA	NA	NA	NA
WP_000085256.1|2144619_2145849_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|2146097_2147219_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2147267_2148494_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2148743_2149880_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|2149863_2150727_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|2151090_2152452_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|2152512_2152788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|2155096_2158498_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
2153323:2153336	attR	CAGATGATTGATGT	NA	NA	NA	NA
WP_001301673.1|2159088_2161437_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2161456_2161546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|2161558_2161795_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967274.1|2161740_2162478_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_000835336.1|2162531_2163410_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|2163712_2163823_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|2163932_2164187_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_072617013.1|2164203_2164902_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	2.4e-131
WP_000807954.1|2164901_2165243_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072617014.1|2165235_2168478_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.5	0.0e+00
WP_001453698.1|2168530_2168740_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2168835_2169210_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2169215_2169932_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2169990_2170335_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2170331_2170778_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2170774_2171125_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2171134_2171461_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|2173987_2174209_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072617015.1|2174253_2176191_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	97.7	0.0e+00
WP_038425863.1|2176254_2177916_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958422.1|2177912_2178476_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	99.5	1.8e-89
WP_000279786.1|2178765_2179131_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2179172_2179400_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2179824_2180010_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2180237_2180384_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2180383_2180953_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2181223_2181757_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731204.1|2181807_2182152_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2182156_2182372_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_072617016.1|2182811_2184662_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|2185140_2185569_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2186207_2186897_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2186893_2187253_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2187265_2188315_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2188316_2188595_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2188762_2188975_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2189163_2189268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2189383_2189968_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2190024_2190420_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2191230_2191971_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2191977_2192940_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2192962_2193388_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_072617017.1|2193384_2193669_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	35.4	5.2e-05
WP_162829202.1|2193717_2194931_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 10
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2507278	2559492	5513531	tRNA,tail,integrase,transposase	Enterobacteria_phage(60.0%)	60	2500502:2500517	2559571:2559586
2500502:2500517	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2507278_2509012_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2509188_2509677_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2509796_2510189_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2510188_2512267_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2512259_2513408_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2513609_2514254_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2514264_2514654_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2514668_2515718_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2515720_2516581_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2516599_2518201_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_072617026.1|2518246_2519686_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_000147302.1|2519828_2520332_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2520352_2522317_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2522321_2523248_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2523244_2524132_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_072617027.1|2524258_2524837_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2524839_2525190_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2525969_2526398_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2526404_2527829_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2527803_2528604_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2528770_2529757_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2529771_2531286_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2531355_2532345_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2533141_2533645_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2533724_2533976_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2534090_2534177_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2534438_2534762_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2534932_2535430_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2535466_2535706_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2535897_2537109_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2537170_2537836_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2538192_2539194_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2539199_2539547_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2539576_2540227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2540242_2540647_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2540737_2540875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2540946_2541150_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2541171_2541522_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2541532_2541811_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2541822_2542065_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2542061_2542175_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2542267_2542684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2542707_2542911_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2542907_2543174_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2543170_2543470_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2543481_2544099_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2544095_2544461_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2544467_2547290_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2547366_2548326_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2548330_2548645_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2549736_2550267_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2550310_2550883_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2551039_2551528_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2554330_2554486_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2554494_2554860_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2554914_2555427_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2555426_2556611_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2556768_2557092_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829202.1|2557196_2558409_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_050543672.1|2558412_2559492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
2559571:2559586	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2617010	2687931	5513531	tail,head,portal,holin,transposase,capsid,terminase,integrase	Escherichia_phage(34.09%)	67	2632811:2632826	2688420:2688435
WP_001023406.1|2617010_2617280_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_072617028.1|2617281_2618595_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001230508.1|2618659_2619259_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072617029.1|2619326_2622809_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	99.1	0.0e+00
WP_054191786.1|2623623_2624367_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_072617001.1|2624377_2625076_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|2625075_2625405_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|2625401_2627981_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_072617030.1|2627961_2628375_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	4.6e-42
WP_000479117.1|2628401_2628833_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2628846_2629587_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2629568_2629835_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2629892_2630240_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2630276_2631782_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2631771_2633364_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2632811:2632826	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2633360_2633567_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2635436_2635946_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2636340_2636565_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2636646_2636961_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2637487_2637673_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2637900_2638032_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2638044_2638227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2638382_2638916_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2638966_2639311_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2639315_2639531_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2639843_2641056_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2641138_2642989_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2644527_2645217_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2645213_2645573_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2645585_2646635_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2646636_2646915_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2647082_2647295_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278461.1|2647481_2647586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2647695_2648259_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2648385_2648697_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2648693_2648846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2648878_2649235_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2649231_2649456_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2649477_2650176_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2650210_2650753_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2650664_2651702_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2651770_2652196_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2652192_2652420_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2652517_2653162_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2653436_2653589_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2654069_2654258_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2654254_2654443_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2654538_2657010_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2657068_2657272_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2657271_2658294_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2658529_2659327_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2659816_2667799_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2668060_2669113_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2669426_2670743_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2670844_2672299_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2672641_2673358_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2673983_2675627_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2675744_2676695_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2676796_2677714_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2678170_2679106_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2679167_2680247_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2680258_2681002_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2680998_2681544_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2681905_2682286_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2682282_2682630_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2682679_2684218_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_162829348.1|2686718_2687931_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
2688420:2688435	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2698740	2757128	5513531	tail,lysis,head,portal,holin,transposase,capsid,terminase,integrase,protease	Stx2-converting_phage(59.49%)	79	2703034:2703048	2764271:2764285
WP_001303036.1|2698740_2699907_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2701229_2701880_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2702104_2702980_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
2703034:2703048	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|2703120_2703390_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_070080209.1|2703391_2704705_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001230509.1|2704769_2705369_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_072617032.1|2705436_2708919_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	99.1	0.0e+00
WP_122994717.1|2709155_2709788_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_001457600.1|2709733_2710471_-|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.6	9.1e-150
WP_001428824.1|2710525_2711449_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_001154345.1|2711519_2711693_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2711800_2712121_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001179516.1|2712137_2712836_-|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2712835_2713177_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234948.1|2713169_2716412_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|2716464_2716674_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2716769_2717144_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2717149_2717866_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2717924_2718269_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2718265_2718712_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2718708_2719059_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2719068_2719395_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_149026313.1|2719474_2721976_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_001063099.1|2721921_2722143_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072617033.1|2722187_2724125_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_072617034.1|2724188_2725850_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000958365.1|2725846_2726410_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_001303046.1|2726700_2727066_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2727107_2727335_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2727797_2728055_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2728051_2728549_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2728751_2729189_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2729185_2729683_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001299338.1|2729682_2729898_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	5.9e-33
WP_001290231.1|2729974_2730247_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2730287_2730467_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_072617035.1|2730603_2732541_-	SASA family carbohydrate esterase	NA	A0A0N7KZH7	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2732784_2733108_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2733404_2733674_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2733685_2734645_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2735294_2735783_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2735773_2736445_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2736441_2737047_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2737046_2737769_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001455113.1|2737843_2738323_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	3.1e-90
WP_162829202.1|2738381_2739594_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000208502.1|2740092_2740851_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2741125_2741308_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2741304_2741832_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2741828_2742275_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2742231_2742468_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2742478_2742694_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2742826_2743105_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2743175_2744552_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2744548_2745370_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2745356_2745518_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2745550_2745847_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2745988_2746204_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2746279_2746975_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2747476_2747998_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2748566_2748749_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2748726_2748999_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2749057_2749309_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|2749491_2749860_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2749932_2750097_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2750065_2750209_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995487.1|2750283_2750580_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000100845.1|2750585_2751371_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_054428303.1|2751367_2752048_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000682304.1|2752044_2752227_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548531.1|2752199_2752391_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|2752467_2752683_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2752781_2753003_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2752999_2753947_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000207904.1|2754460_2754817_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	99.2	1.2e-62
WP_000610373.1|2754813_2755164_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2755351_2755696_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2755777_2755969_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007947.1|2755949_2757128_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
2764271:2764285	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 13
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2840350	2878404	5513531	tail,terminase,head,portal,holin,plate,tRNA,capsid,lysis,integrase	Escherichia_phage(59.52%)	46	2844650:2844677	2876597:2876624
WP_000675144.1|2840350_2841754_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2841750_2842473_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2842663_2842996_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476015.1|2843143_2844505_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
2844650:2844677	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2844778_2844997_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2845078_2846242_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2846241_2846721_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2846735_2849183_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2849175_2849295_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2849327_2849603_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2849659_2850178_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286704.1|2850190_2851381_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_000905094.1|2851440_2852034_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001008233.1|2852488_2852932_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001285352.1|2854816_2855428_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2855420_2856329_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2856333_2856681_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2856677_2857313_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001809.1|2857379_2857832_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_000917144.1|2857824_2858292_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2858254_2858428_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2858399_2858825_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2858812_2859238_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2859252_2859750_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2859749_2860031_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2860034_2860238_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2860237_2860747_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2860846_2861590_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2861593_2862667_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2862725_2863580_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2863753_2865526_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2865525_2866560_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2866877_2868845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2868844_2869297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2870655_2872938_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2872927_2873203_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2873199_2873424_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2873426_2873726_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2873725_2873950_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217673.1|2874013_2874514_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_001005162.1|2874510_2874681_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2874691_2874967_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2875088_2875388_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2875503_2876517_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2876781_2877099_-	hypothetical protein	NA	NA	NA	NA	NA
2876597:2876624	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2877504_2878404_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 14
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	2921646	2931092	5513531		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001302810.1|2921646_2922783_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2922779_2924783_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2924907_2925369_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2925410_2925881_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2925927_2926647_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2926643_2928329_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001240409.1|2928550_2929282_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_001216963.1|2929341_2929449_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2929429_2930161_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2930165_2931092_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	3144773	3238821	5513531	tail,portal,holin,transposase,tRNA,capsid,lysis,integrase,protease	Stx1_converting_phage(29.11%)	105	3165947:3165963	3235810:3235826
WP_001283590.1|3144773_3145586_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3145585_3146599_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3146664_3147801_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615801.1|3147899_3148895_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3148891_3150070_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3150344_3151565_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3151723_3153730_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3153850_3154129_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3154162_3154711_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447364.1|3154710_3155520_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043834.1|3155519_3156344_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3156347_3157433_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3157467_3158400_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3158565_3159117_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3159287_3160130_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3160131_3160653_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3160649_3161120_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3161116_3161617_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3161627_3162386_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3162408_3165048_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3165129_3165693_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3165947:3165963	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3166338_3166824_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3167026_3169171_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3169170_3170481_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3170660_3170945_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3171316_3172657_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3173021_3174053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3174447_3175203_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3175496_3176429_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_072617036.1|3176650_3185035_-	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000012455.1|3185104_3186370_-	hypothetical protein	NA	A0A1U9AJC6	Stx1_converting_phage	100.0	2.4e-206
WP_000540394.1|3186380_3186632_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|3186641_3187088_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|3187090_3187747_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3187840_3188242_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3188298_3188439_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835358.1|3188671_3189406_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_001426808.1|3189496_3190114_-	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_072617037.1|3190119_3190392_-	hypothetical protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.2e-46
WP_001171554.1|3190472_3190853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3190849_3191197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3191246_3192785_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000197192.1|3192862_3194131_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146325.1|3194127_3195753_-	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_001426815.1|3196047_3196236_-	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001023473.1|3196377_3196647_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_064234923.1|3196648_3198544_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_000207923.1|3198540_3199191_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3199190_3199754_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001367376.1|3199737_3200199_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140442.1|3200248_3200638_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3200693_3201908_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3201931_3202939_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787520.1|3203096_3205241_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000143991.1|3205240_3206947_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_001086076.1|3206927_3207734_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_001301714.1|3207789_3207993_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3208142_3208436_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082653.1|3208467_3208932_-|lysis	lysis protein	lysis	A0A1U9AJA1	Stx1_converting_phage	100.0	4.5e-78
WP_000455406.1|3208939_3209089_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001369534.1|3209088_3209631_-	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_001080433.1|3209945_3210479_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_000284510.1|3210483_3210699_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290231.1|3210775_3211048_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|3211088_3211268_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064032101.1|3211404_3213345_-	SASA family carbohydrate esterase	NA	A0A1U9AJ89	Stx1_converting_phage	100.0	0.0e+00
WP_000752026.1|3213848_3214118_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3214127_3215075_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|3215581_3216016_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|3216008_3216203_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_064032103.1|3216199_3216811_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_001108081.1|3216785_3217352_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001502725.1|3217933_3219706_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001254221.1|3220209_3220392_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000153270.1|3220388_3220916_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001310475.1|3220912_3221359_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|3221315_3221552_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3221562_3221778_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3221910_3222189_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|3222259_3222550_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788928.1|3222546_3223248_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|3223244_3224183_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438532.1|3224215_3224512_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	100.0	3.1e-48
WP_000064148.1|3224650_3224884_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|3224997_3225702_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000198444.1|3226591_3226975_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_001502698.1|3227033_3227504_+	hypothetical protein	NA	A0A1U9AJ69	Stx1_converting_phage	100.0	1.7e-88
WP_072617038.1|3227654_3228023_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	100.0	2.0e-65
WP_001198861.1|3228095_3228260_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|3228228_3228372_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|3228447_3228744_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|3228749_3229535_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_054428303.1|3229531_3230212_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000682304.1|3230208_3230391_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548531.1|3230363_3230555_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|3230631_3230847_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|3230945_3231167_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000497812.1|3232560_3232812_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000405131.1|3232872_3233055_+	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_001218301.1|3233038_3234208_-|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000958700.1|3234639_3235797_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3235971_3237108_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3235810:3235826	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3237117_3237798_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3237784_3238252_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3238251_3238821_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 16
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	3516194	3530945	5513531	holin,tail,transposase	Enterobacteria_phage(42.86%)	18	NA	NA
WP_000162574.1|3516194_3516677_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3517522_3517771_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3518272_3518863_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3519045_3519696_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3519774_3520833_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3520962_3521385_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3521545_3521815_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3522032_3523245_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3523746_3524094_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3524090_3524471_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731259.1|3524827_3525172_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3525176_3525392_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3525541_3527395_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3527802_3527970_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3528055_3528799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3529051_3529675_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3529671_3530337_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3530333_3530945_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 17
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	3864200	3915705	5513531	tRNA,transposase,integrase,protease	Stx2-converting_phage(33.33%)	43	3877146:3877180	3922968:3923002
WP_000701842.1|3864200_3864959_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3865164_3866085_-	agmatinase	NA	NA	NA	NA	NA
WP_000758914.1|3866220_3866952_-	lipoprotein	NA	NA	NA	NA	NA
WP_001295380.1|3867097_3869074_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3869082_3869214_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3869349_3869565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3869868_3871023_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112296.1|3871459_3872854_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001303653.1|3872930_3873428_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286494.1|3873522_3874230_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3874309_3875041_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593272.1|3875053_3876001_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3876112_3876676_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017110.1|3876675_3877092_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
3877146:3877180	attL	ATTGCCGGATGCGGCGTGAACGCCTTATCCGGCCT	NA	NA	NA	NA
WP_001055622.1|3877282_3878263_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3878280_3878985_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3879002_3879569_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277224.1|3879565_3879856_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174762.1|3879863_3880457_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239959.1|3880449_3881586_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745247.1|3881828_3882836_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394102.1|3882952_3883999_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3884174_3884894_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107568.1|3885077_3885404_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786908.1|3885403_3886123_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001301529.1|3886283_3887336_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3887363_3887639_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001302020.1|3887703_3888783_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3888984_3890241_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839815.1|3890290_3892426_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234483.1|3892823_3893531_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218882.1|3893909_3895175_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
WP_001301939.1|3896165_3896840_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	31.6	4.7e-12
WP_162829202.1|3897097_3898310_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000605048.1|3900818_3901367_-	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_001453071.1|3901939_3902113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121626.1|3904346_3905996_+	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_000953022.1|3906603_3907593_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	2.9e-98
WP_000609742.1|3907641_3908316_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_001239097.1|3910190_3912326_+	hydrogenase	NA	NA	NA	NA	NA
WP_162829202.1|3912365_3913579_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3913769_3914117_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3914166_3915705_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3922968:3923002	attR	AGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAT	NA	NA	NA	NA
>prophage 18
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	5119348	5134013	5513531	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	18	5120629:5120644	5138158:5138173
WP_000956557.1|5119348_5119882_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5120078_5120252_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5120299_5120581_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5120629:5120644	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5120925_5121123_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5121458_5121743_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5121739_5122090_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5122080_5122617_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5123938_5124538_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5124602_5125916_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5125917_5126187_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5126298_5126871_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5126943_5127573_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5127654_5128296_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5128456_5128705_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5128766_5129864_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5129952_5130990_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5131123_5131366_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000918366.1|5132597_5134013_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5138158:5138173	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 19
NZ_CP018245	Escherichia coli strain 472 chromosome, complete genome	5513531	5270884	5329929	5513531	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5270884_5272144_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5272146_5273151_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5273232_5273430_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5273533_5274832_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5275036_5275462_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5275500_5277942_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5278122_5278854_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5278980_5279382_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5279400_5280099_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5280149_5280809_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5280826_5281225_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5281234_5281873_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5281875_5283039_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5283122_5284748_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5284864_5285140_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5285288_5285618_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5285799_5286549_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5286545_5287301_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5288827_5290225_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5290240_5290546_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5290555_5291020_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5291033_5291684_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5291693_5292548_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5292547_5293234_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5293362_5293638_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5293964_5294360_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5294366_5294681_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5294685_5294913_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5294954_5295404_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5295474_5296269_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5296891_5297323_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5297330_5298539_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5298673_5299312_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5299529_5300150_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5300458_5301871_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5301915_5302578_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5302685_5303651_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5303758_5304619_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5304707_5305088_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5305205_5307149_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5307338_5308079_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5308290_5309229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5309291_5309846_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5310170_5310377_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5310489_5311833_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5312155_5312794_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5312999_5314733_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5314729_5318509_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5318511_5318853_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5319064_5319316_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5319309_5319660_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5319739_5320270_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5320579_5321536_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5321675_5323178_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5323191_5324214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5324200_5325196_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5325228_5326227_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5326402_5327776_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5327931_5328483_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5328576_5329929_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
