The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	199870	315854	5474193	integrase,protease,plate,transposase,tail,tRNA	Enterobacteria_phage(24.14%)	100	278736:278750	316270:316284
WP_001295561.1|199870_201223_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201252_203685_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203805_204291_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204294_205320_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205424_205880_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205883_206672_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206671_207820_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207816_208413_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208449_211932_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211944_212904_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213002_215144_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215200_215590_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176538.1|215654_216950_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217002_217263_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217249_217450_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217615_218161_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218157_218568_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218581_219292_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219491_220316_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220368_222087_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222197_222905_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222901_223306_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223423_224239_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224278_224932_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224924_225956_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226143_226719_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232478_233282_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233278_234193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234433_235234_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235311_236082_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236129_237488_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237559_238315_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238348_239071_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239067_239535_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239599_240331_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240868_241669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242146_242596_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242598_243195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243273_243495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243515_243995_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243960_245370_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001693614.1|245380_248815_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248951_250364_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250368_251112_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614380.1|251108_253880_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|253888_254650_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254654_255986_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255988_256513_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256509_257790_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257814_258897_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258860_260711_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260714_261128_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261218_262610_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262660_262885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262919_263420_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264116_264635_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264844_266986_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267061_271294_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_001451053.1|273909_274473_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275219_276356_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278320_278584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278498_278684_-	protein YncO	NA	NA	NA	NA	NA
278736:278750	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|278764_279937_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|280054_280825_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|280978_281452_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|281494_283939_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|284178_284757_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|284861_285629_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|285599_286340_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|286495_286756_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|286774_287035_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|287220_287994_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001303130.1|288811_290551_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|290495_291281_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|291351_292407_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|292458_292752_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|292754_293153_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|293162_293615_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|294713_296171_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|296431_296890_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|296981_298226_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|298283_298685_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|298723_299779_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300066_301170_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301181_302435_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303504_303750_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304076_305290_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000708831.1|305315_305699_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_001274756.1|305826_306540_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306640_306841_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306959_307253_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|307285_308185_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788819.1|308181_308493_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308492_309287_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309286_309880_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|309851_310295_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000904979.1|310757_311312_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_072643086.1|311369_312143_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.3	2.5e-49
WP_000246059.1|312966_313710_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|314672_315854_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
316270:316284	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	894803	934217	5474193	protease,lysis,portal,holin,transposase,tail,terminase,integrase	Enterobacteria_phage(48.84%)	50	884245:884259	916539:916553
884245:884259	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|894803_895874_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|895851_896070_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|896109_896277_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|896519_897122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|897332_897554_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|897652_897868_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|897944_898136_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|898108_898291_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|898287_898968_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|899665_899848_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|899844_900015_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|900007_900628_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|900624_901290_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|901501_902461_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|902798_902921_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|902935_903625_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|903808_904552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|904637_904796_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|904876_905275_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|905417_905633_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|905632_906130_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|906126_906594_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|906581_906734_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|907408_907900_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934096.1|907899_910002_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|909998_910211_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|910138_911263_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|911384_911720_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136596.1|911664_913692_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|913778_914102_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|914094_914370_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|914381_914960_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|914956_915358_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|915368_916112_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|916172_916559_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
916539:916553	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|916567_916897_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_162829202.1|919282_920496_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000447253.1|921246_921576_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|921585_922284_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|922289_923033_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|922969_923578_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|923638_927052_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|927122_927722_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|927781_929098_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|929099_929369_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|929545_930526_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|930559_931579_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|932075_932237_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|932406_933288_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|933518_934217_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	1150925	1220616	5474193	head,capsid,portal,holin,transposase,tail,terminase,protease	Enterobacteria_phage(25.58%)	76	NA	NA
WP_072643096.1|1150925_1152686_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1152871_1153324_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1153398_1154439_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1154795_1155305_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1155523_1156153_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1156115_1158278_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1158287_1158734_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1158856_1160911_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1160942_1161401_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1161496_1162159_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1162331_1162745_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1162789_1163107_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1163164_1164355_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1164449_1164728_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1164724_1165054_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1165144_1165804_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1167195_1167438_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1167505_1169977_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1170070_1170262_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1170258_1170447_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1171020_1171206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1171392_1171782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1171923_1172079_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1172356_1172644_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1172643_1172835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1172862_1173264_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1173372_1173645_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1173628_1174054_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1174260_1174716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1174794_1175886_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|1175892_1176639_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1176660_1177431_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1177446_1177860_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160650.1|1178211_1178985_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1179589_1179745_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1179912_1180191_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1180192_1181242_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1181254_1181626_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1181615_1181987_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1182138_1182957_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1183577_1184291_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1185058_1186909_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1187084_1188297_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1188502_1188817_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1189344_1189530_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1189751_1189865_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1190085_1190619_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1190778_1191051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1191306_1191513_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1192263_1192539_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1192614_1192995_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612598.1|1192991_1193339_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_000998048.1|1193388_1194927_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302857.1|1195190_1197119_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1197102_1197309_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1197305_1198898_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1198887_1200393_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1200429_1200777_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1200834_1201101_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1201082_1201823_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1201836_1202268_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1202294_1202708_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082464.1|1202688_1205268_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000847298.1|1205264_1205594_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1205593_1206292_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1206302_1207046_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122997399.1|1206991_1207624_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_000649829.1|1207814_1208342_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|1208475_1211949_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|1212016_1212616_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_072643130.1|1212680_1213994_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	1.5e-83
WP_001023352.1|1213995_1214265_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1216397_1217516_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1217512_1219306_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1219324_1220032_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1220028_1220616_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	1482385	1617536	5474193	head,tRNA,capsid,protease,portal,holin,transposase,tail,terminase,integrase	Enterobacteria_phage(32.67%)	162	1545656:1545671	1571574:1571589
WP_000952736.1|1482385_1483207_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1483362_1484409_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1484405_1485200_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1485366_1486485_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1486453_1486723_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1486784_1487174_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1487306_1487822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1487936_1488089_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1488404_1488881_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1489005_1489329_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1489312_1489738_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1489806_1490844_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1490755_1491298_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1491331_1492048_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1492080_1492362_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1492358_1492661_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1492650_1492968_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1492921_1493239_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1493225_1493663_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1493664_1493856_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1493858_1494446_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1494561_1494666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1494854_1495067_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1495234_1495513_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1495514_1496564_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1496576_1496951_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1496947_1497769_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|1498847_1500785_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1500932_1501115_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1501152_1501422_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1501497_1501713_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1501717_1502062_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1502112_1502646_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1502916_1503486_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1503485_1503632_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1503859_1504066_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1504130_1504355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1504711_1504852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1504981_1505167_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1505208_1505574_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_072643100.1|1505863_1506427_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	95.2	4.3e-83
WP_001301491.1|1506423_1508085_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1508148_1510086_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1510130_1510352_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356670.1|1510297_1512799_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	98.8	0.0e+00
WP_000126019.1|1512878_1513205_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1513214_1513565_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1513561_1514008_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1514004_1514349_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1514414_1515131_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1515145_1515520_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1515615_1515825_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_187655834.1|1515958_1518424_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.0	0.0e+00
WP_001356753.1|1518448_1519120_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.6	5.8e-119
WP_000807950.1|1519112_1519454_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|1519453_1520152_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1520168_1520423_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1520532_1520643_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1520945_1521824_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1521877_1522615_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1522560_1522797_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1522809_1522899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1522918_1525267_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1525857_1529259_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1530230_1530506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1530566_1531928_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1532291_1533155_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1533138_1534275_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1534524_1535751_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1535799_1536921_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1537169_1538399_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1538763_1538952_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1539756_1539954_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1539946_1540159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1540148_1540613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1540605_1540839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1540844_1541144_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1541140_1542541_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1542741_1542993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1542989_1543400_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1543410_1543683_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1543809_1544034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1544285_1544492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1544491_1545547_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1545559_1545895_+|head	head decoration protein	head	NA	NA	NA	NA
1545656:1545671	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1545907_1546321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1546526_1547069_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1547324_1547606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1548206_1549667_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1549666_1550338_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1550506_1551877_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1551880_1552522_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1552557_1553664_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1553717_1554179_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1554188_1554842_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1555013_1556264_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1556377_1557520_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1557509_1557746_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1558670_1559372_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1559368_1559671_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1559738_1560071_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1560135_1560258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|1560315_1561842_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1562343_1562799_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_162829348.1|1562850_1564064_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000079504.1|1564262_1564673_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1564958_1565165_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1565329_1565524_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1565912_1566458_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1566432_1568358_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1568354_1568561_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1568557_1570159_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1570139_1571459_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1571468_1571801_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1571574:1571589	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1571856_1572882_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1572923_1573322_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1573333_1573687_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1573698_1574277_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1574273_1574669_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1574676_1575417_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1575432_1575855_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1575836_1576271_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1576263_1578813_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1578809_1579139_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1579138_1579837_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1579842_1580586_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1580522_1581155_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1581215_1584614_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1584680_1585280_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1585344_1588260_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1588259_1588841_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1588960_1589851_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1589869_1590376_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1590412_1590913_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1590991_1591174_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1591671_1592340_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1592396_1592645_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1592720_1593101_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1593097_1593445_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1593494_1595033_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1595335_1596820_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1597006_1597960_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1598458_1599043_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001185665.1|1600282_1600549_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|1600552_1601365_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|1601388_1602084_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056834.1|1602603_1602972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|1603074_1603476_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|1603546_1603705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295992.1|1603716_1604010_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000284277.1|1604081_1604741_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807626.1|1604817_1605279_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304191.1|1605485_1606397_-	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000897378.1|1606769_1607189_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457644.1|1607188_1608457_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000943459.1|1608502_1609033_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406391.1|1609178_1610720_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234823.1|1610941_1611661_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000190855.1|1611712_1613245_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_001266908.1|1613607_1614906_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000197859.1|1614915_1615986_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_162829348.1|1616323_1617536_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
>prophage 5
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	1696536	1771183	5474193	head,capsid,protease,lysis,portal,holin,transposase,tail,terminase,integrase	Enterobacteria_phage(35.71%)	84	1696373:1696400	1755655:1755682
1696373:1696400	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1696536_1697667_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1697644_1697893_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1697957_1700429_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|1700521_1700713_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1700709_1700898_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1701456_1701690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1701667_1702075_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1702097_1702316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1702388_1702688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1702951_1703359_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1703435_1703663_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1703646_1704198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1704169_1705210_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1705121_1705664_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1705850_1706432_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1706428_1706593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1707291_1708050_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1708328_1708541_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1708761_1709019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1709088_1709367_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1709368_1710415_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1710427_1710787_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1710795_1711326_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1711567_1711765_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000143067.1|1713769_1715623_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1715772_1715988_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1715992_1716337_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1716387_1716921_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1717191_1717761_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1717760_1717907_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1717914_1718382_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1718845_1719160_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1719241_1719466_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1719852_1720398_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|1720372_1722298_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|1722294_1722501_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1722497_1724099_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1724079_1725399_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1725408_1725741_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1725796_1726822_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1726863_1727262_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1727273_1727627_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1727641_1728175_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1728171_1728567_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1728574_1729327_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1729340_1729763_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1729789_1730203_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|1730183_1732796_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|1732792_1733122_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1733121_1733820_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1733830_1734574_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122989782.1|1734519_1735149_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_072643102.1|1735389_1738215_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.0	0.0e+00
WP_001228334.1|1738282_1738882_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|1739033_1740338_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|1740339_1740609_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1741635_1742961_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1744558_1744681_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1744787_1745699_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1745764_1746334_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1747299_1748838_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1748887_1749235_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1749231_1749612_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001303943.1|1749951_1750230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1750657_1750804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1750940_1751588_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1751771_1752362_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_169072547.1|1753868_1754519_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.4	1.5e-26
WP_001079499.1|1755832_1756339_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1755655:1755682	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1756384_1756885_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1756970_1757150_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1757530_1758337_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1758336_1759530_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1759541_1760903_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1760903_1762499_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1762498_1764061_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1764152_1764197_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1764334_1765216_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1765212_1765833_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1765860_1767444_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1767656_1768529_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1768568_1769159_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1769155_1769914_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_072643103.1|1770133_1771183_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.8e-21
>prophage 6
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	2043961	2158820	5474193	head,capsid,portal,holin,transposase,tail,terminase,protease	Stx2-converting_phage(42.72%)	131	NA	NA
WP_000214712.1|2043961_2044165_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2044200_2045661_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2047164_2047407_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2047568_2048210_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2048291_2048921_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2048993_2049569_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2049682_2049952_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268849.1|2049953_2051267_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230508.1|2051331_2051931_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2056419_2057052_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2056997_2057741_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001303180.1|2057751_2058450_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000807954.1|2058449_2058791_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2058783_2062026_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2062077_2062287_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2062382_2062757_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2062762_2063479_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2063537_2063882_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2063878_2064325_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2064321_2064672_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|2064681_2065008_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2067048_2067270_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173065.1|2067314_2069252_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_001414292.1|2069315_2070977_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958392.1|2070973_2071537_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_032173279.1|2071826_2072192_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000095736.1|2072233_2072461_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2072885_2073071_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2073298_2073445_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2073444_2074014_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2074284_2074818_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2074868_2075213_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2075217_2075433_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2075871_2077722_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2078199_2078631_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2079081_2079795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2079930_2080128_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2080352_2080907_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2080969_2081275_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_072643106.1|2081287_2082337_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.9e-109
WP_000191871.1|2082338_2082611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|2082732_2083077_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2083196_2083409_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2083642_2084200_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2084201_2084420_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2084547_2084859_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2084851_2085079_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2085075_2085357_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2085389_2086106_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2086139_2086601_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001356791.1|2086593_2087649_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|2087717_2088143_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001416688.1|2088761_2089100_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2089392_2089545_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2089556_2090195_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2090195_2090405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2090969_2091158_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_072643107.1|2091154_2091343_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2091435_2092680_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2093390_2093633_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2094595_2094976_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2094972_2095320_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2095369_2096908_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2097490_2098141_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2098851_2099427_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2099540_2099810_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268842.1|2099811_2101035_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2101099_2101699_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001179509.1|2105432_2105870_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|2105869_2106211_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|2106203_2109446_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|2109493_2109703_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2109798_2110173_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2110187_2110904_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2110969_2111314_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2111310_2111757_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2111753_2112104_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2112113_2112440_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_072643108.1|2112442_2115022_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	96.5	0.0e+00
WP_001063023.1|2114967_2115189_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173065.1|2115233_2117171_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.4	0.0e+00
WP_001303179.1|2117234_2118896_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958392.1|2118892_2119456_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_032173279.1|2119745_2120111_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	4.9e-64
WP_000095736.1|2120152_2120380_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2120804_2120990_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2121217_2121364_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2121363_2121933_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2122203_2122737_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2122787_2123132_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2123136_2123352_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_064234946.1|2123790_2125641_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001303509.1|2126119_2126548_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001217455.1|2127869_2128229_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2128241_2129291_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2129292_2129571_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2129738_2129951_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2130139_2130244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2130359_2130944_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2131000_2131396_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2132206_2132947_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2132953_2133916_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2133938_2134364_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2134360_2134663_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169686.1|2134760_2135132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2135152_2135344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2135345_2135624_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001240334.1|2135975_2136275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2136346_2136565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2137133_2137322_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2137318_2137510_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048458.1|2137602_2140074_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_000005552.1|2140146_2140398_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001302046.1|2141386_2141713_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2141847_2142189_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2142223_2142784_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2142786_2143497_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2143604_2143910_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041703.1|2144108_2146535_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	3.2e-212
WP_001414236.1|2146595_2149019_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000213028.1|2149029_2149647_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526515.1|2149648_2150503_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2150545_2151160_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071525082.1|2151317_2152610_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|2152562_2153258_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2153382_2154603_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|2154737_2155631_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091829.1|2155737_2156991_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743954.1|2157387_2157723_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2157815_2157899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|2157998_2158820_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	2446508	2497630	5474193	integrase,transposase,tail,tRNA	Enterobacteria_phage(60.0%)	59	2439732:2439747	2497709:2497724
2439732:2439747	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2446508_2448242_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2448418_2448907_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2449026_2449419_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2449418_2451497_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2451489_2452638_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2452839_2453484_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2453494_2453884_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2453898_2454948_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2454950_2455811_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2455829_2457431_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2457476_2459138_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2459280_2459784_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2459804_2461769_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2461773_2462700_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2462696_2463584_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2463710_2464289_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2464291_2464642_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2465421_2465850_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2465856_2467281_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2467255_2468056_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2468222_2469209_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2469223_2470738_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2470807_2471797_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2472593_2473097_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2473176_2473428_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2473542_2473629_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2473890_2474214_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2474384_2474882_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2474918_2475158_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2475349_2476561_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2476622_2477288_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2477644_2478646_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2478651_2478999_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2479028_2479679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2479694_2480099_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2480188_2480326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2480397_2480601_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2480622_2480973_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_072643109.1|2480983_2481262_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	1.4e-34
WP_000514287.1|2481273_2481516_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2481512_2481626_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2481718_2482135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2482158_2482362_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2482358_2482625_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2482621_2482921_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2482932_2483550_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2483546_2483912_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2483918_2486741_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2486817_2487777_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2487781_2488096_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2489187_2489718_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2489761_2490334_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2490490_2490979_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2493781_2493937_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2493945_2494311_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2494365_2494878_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2494877_2496062_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2496219_2496543_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2496493_2497630_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2497709:2497724	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 8
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	2555070	2622290	5474193	head,capsid,portal,holin,transposase,tail,terminase,integrase	Escherichia_phage(33.33%)	68	2570869:2570884	2626635:2626650
WP_001023455.1|2555070_2555340_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268850.1|2555341_2556655_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.3	5.3e-84
WP_001230514.1|2556719_2557319_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643111.1|2557386_2560866_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_123007081.1|2561106_2561736_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|2561681_2562425_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001301816.1|2562435_2563134_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2563133_2563463_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032339796.1|2563459_2566039_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|2566019_2566433_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2566459_2566891_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2566904_2567645_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2567626_2567893_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2567950_2568298_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2568334_2569840_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2569829_2571422_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2570869:2570884	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2571418_2571625_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2573509_2574019_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2574413_2574638_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2574719_2575034_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2575560_2575746_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2575973_2576105_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2576117_2576300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2576455_2576989_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2577039_2577384_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2577388_2577604_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2577914_2579127_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2579209_2581060_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2581537_2581966_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2582599_2583289_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2583285_2583645_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2583657_2584707_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2584708_2584987_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2585154_2585367_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2585553_2585658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2585767_2586331_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2586457_2586769_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2586765_2586918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2586950_2587307_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2587303_2587528_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2587549_2588248_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2588282_2588825_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2588736_2589774_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2589842_2590268_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2590264_2590492_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2590589_2591234_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2591508_2591661_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2592141_2592330_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2592326_2592515_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034478.1|2592610_2595082_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2595140_2595344_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2595343_2596366_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2596601_2597399_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2597888_2605871_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2606132_2607185_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2607498_2608815_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2608916_2610371_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2610713_2611430_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2612055_2613699_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2613816_2614767_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2614868_2615786_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2616242_2617178_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2617239_2618319_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2618330_2619074_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2619070_2619616_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2619977_2620358_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2620354_2620702_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2620751_2622290_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2626635:2626650	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 9
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	2721376	2759443	5474193	integrase,head,capsid,plate,lysis,portal,holin,tail,terminase,tRNA	Escherichia_phage(62.22%)	50	2725676:2725703	2757636:2757663
WP_000675144.1|2721376_2722780_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2722776_2723499_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2723689_2724022_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2724169_2725531_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2725676:2725703	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2725804_2726023_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2726104_2727268_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2727267_2727747_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2727761_2730209_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2730201_2730321_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2730353_2730629_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2730685_2731204_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|2731216_2732407_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|2732466_2733060_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001145592.1|2733090_2733501_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_001008233.1|2733521_2733965_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|2733936_2734539_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000217052.1|2734538_2735858_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001285352.1|2735854_2736466_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2736458_2737367_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2737371_2737719_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2737715_2738351_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2738417_2738870_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2738862_2739330_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2739292_2739466_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2739437_2739863_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2739850_2740276_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2740290_2740788_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2740787_2741069_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2741072_2741276_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2741275_2741785_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024178727.1|2741884_2742628_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.2	2.8e-122
WP_001248594.1|2742631_2743705_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2743763_2744618_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2744791_2746564_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001693738.1|2746563_2747598_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	9.3e-201
WP_000844437.1|2747915_2749883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2749882_2750335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2750381_2751605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2751694_2753977_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2753966_2754242_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2754238_2754463_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2754465_2754765_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2754764_2754989_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2755052_2755553_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2755549_2755720_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2755730_2756006_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2756127_2756427_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2756542_2757556_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2757820_2758138_-	hypothetical protein	NA	NA	NA	NA	NA
2757636:2757663	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2758543_2759443_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 10
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	2785092	2869591	5474193	tRNA,protease,portal,holin,tail,terminase,integrase	Enterobacteria_phage(52.7%)	95	2809655:2809675	2867097:2867117
WP_001301615.1|2785092_2787126_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2794083_2797713_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2797774_2798092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2799332_2800421_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2800431_2801961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2801979_2802711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2802703_2803840_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2803836_2805840_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2805964_2806426_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2806467_2806938_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2806984_2807704_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2807700_2809386_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2809655:2809675	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2809900_2810149_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2810516_2810786_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268979.1|2810787_2812101_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001228302.1|2812165_2812765_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_072643112.1|2812832_2816309_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.7	0.0e+00
WP_123007081.1|2816549_2817179_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000194801.1|2817124_2817868_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001301816.1|2817878_2818577_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2818576_2818906_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2818902_2821548_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|2821591_2821900_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2821926_2822349_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2822362_2823115_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2823122_2823521_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2823533_2824157_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2824159_2824441_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2824433_2824760_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114426.1|2824847_2826872_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2826816_2828319_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2828318_2828531_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000133409.1|2830023_2830305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860404.1|2830562_2832452_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|2833109_2833532_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|2833528_2833774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032311625.1|2834061_2835876_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	4.4e-129
WP_000728901.1|2835872_2836115_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000551748.1|2836311_2836905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335965.1|2836897_2837122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088136225.1|2837114_2837834_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001038670.1|2837814_2838396_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_000229066.1|2838455_2838680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|2838672_2839911_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001077621.1|2840072_2841080_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000348565.1|2841076_2841553_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2842070_2842256_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2842483_2842630_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2842629_2843199_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2843469_2844003_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2844007_2844223_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2844300_2844546_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2844586_2844766_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|2844902_2846849_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|2847652_2847805_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2848056_2848491_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2848576_2848717_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2848713_2849076_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2849072_2849363_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2849355_2849526_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2849525_2849981_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2849977_2850079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2850195_2850993_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2851002_2851554_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2852018_2853545_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|2853602_2853710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2853801_2854134_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2854201_2854504_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788810.1|2854500_2855202_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147876.1|2855198_2856218_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|2856214_2856754_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2856823_2857054_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2857158_2857848_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2857928_2858990_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2858967_2859345_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2859825_2860032_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2860107_2860404_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2860409_2861195_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_072643113.1|2861191_2861869_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.6	7.8e-132
WP_001303590.1|2861868_2862051_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2862023_2862215_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2862291_2862507_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2862605_2862827_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2862823_2863771_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2863772_2863949_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2864282_2864639_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2864635_2864998_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2865085_2865328_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2865331_2865466_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2865484_2865739_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2865772_2867059_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2867079_2867781_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2867097:2867117	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2867840_2867948_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2867928_2868660_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2868664_2869591_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 11
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	3084574	3184951	5474193	integrase,capsid,portal,lysis,transposase,holin,bacteriocin,tail,terminase,tRNA	Escherichia_phage(80.46%)	115	3105113:3105129	3181940:3181956
WP_001283590.1|3084574_3085387_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3085386_3086400_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3086465_3087602_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615801.1|3087700_3088696_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3088692_3089871_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3090145_3091366_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3091524_3093531_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3093651_3093930_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3093963_3094512_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_072643116.1|3094511_3095321_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043834.1|3095320_3096145_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3096148_3097234_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3097268_3098201_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3098366_3098918_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3099088_3099931_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3099932_3100454_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|3100686_3100860_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3100856_3101327_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3101323_3101824_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3101834_3102593_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112847.1|3102615_3104214_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3104295_3104859_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3105113:3105129	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3105504_3105990_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3106192_3108337_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3108336_3109647_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3109826_3110111_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3110482_3111823_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3112187_3113219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3113613_3114369_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3114662_3115595_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331692.1|3115816_3124198_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3124267_3125533_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3125543_3125795_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3125804_3126251_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3126253_3126910_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3127003_3127405_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3127461_3127602_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835362.1|3127834_3128569_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	100.0	4.4e-136
WP_001301884.1|3128659_3129277_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3129282_3129561_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3129575_3130844_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_162829202.1|3132285_3133499_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303606.1|3134073_3134262_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3134401_3134671_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3134672_3136610_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207926.1|3136606_3137257_-	hypothetical protein	NA	A0A0N6WEJ5	Escherichia_phage	100.0	4.6e-121
WP_000829200.1|3137256_3137820_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3137803_3138265_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3138314_3138704_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3138759_3139974_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3139997_3141005_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3141162_3143307_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3143306_3145013_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|3144993_3145800_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001301714.1|3145855_3146059_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3146208_3146502_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3146533_3146998_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3147005_3147155_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_000989259.1|3147154_3147718_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	2.6e-104
WP_162829202.1|3147771_3148984_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000087729.1|3149311_3149845_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072901.1|3149849_3150065_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290210.1|3150142_3150388_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000143458.1|3150428_3150608_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874428.1|3150742_3152680_-	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	100.0	0.0e+00
WP_000738068.1|3153165_3153435_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3153446_3154406_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3154788_3154941_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204844.1|3155189_3155624_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|3155616_3155811_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001187434.1|3155807_3156371_-	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000402093.1|3156378_3156828_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001193567.1|3156827_3157799_-	toprim domain-containing protein	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000913119.1|3157788_3159309_-	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001271433.1|3159302_3159680_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|3159846_3160041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|3160211_3160415_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|3160510_3161224_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|3161318_3162788_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|3162784_3163738_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000917253.1|3165316_3165529_+	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000934195.1|3165540_3165822_+	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	1.3e-45
WP_000995346.1|3165842_3166124_+	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_000459724.1|3166142_3167093_+	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000187066.1|3167089_3167779_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
WP_000344634.1|3167778_3168366_+	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000077905.1|3168441_3168789_+	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|3168852_3169674_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001159716.1|3169750_3170194_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
WP_001453790.1|3170301_3171180_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|3171176_3171380_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476217.1|3171372_3171612_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_001303141.1|3171608_3172556_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_001301469.1|3172557_3173064_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|3173023_3173239_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|3173240_3173459_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3173460_3173748_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206752.1|3173751_3174375_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_001304084.1|3174468_3174645_+	hypothetical protein	NA	A0A0N7C151	Escherichia_phage	100.0	2.5e-26
WP_001451754.1|3174637_3175207_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001302866.1|3175249_3175555_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451755.1|3175643_3175841_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260980.1|3175969_3176227_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_000211992.1|3176551_3177229_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_000809302.1|3177284_3177716_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163444.1|3177712_3178339_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3178298_3178511_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3178546_3178924_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3179002_3179185_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3179168_3180338_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3180769_3181927_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_001693763.1|3182101_3183238_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.4	5.3e-80
3181940:3181956	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3183247_3183928_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3183914_3184382_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3184381_3184951_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 12
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	3427046	3490178	5474193	tRNA,transposase,holin,tail,integrase	Enterobacteria_phage(30.0%)	60	3442760:3442774	3492321:3492335
WP_000138184.1|3427046_3427745_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082974.1|3427776_3430437_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3430550_3431906_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3431951_3432275_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3432271_3433570_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3439343_3441917_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3442046_3442778_-	polyphenol oxidase	NA	NA	NA	NA	NA
3442760:3442774	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|3442774_3443755_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3443889_3444627_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3444897_3445239_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3445342_3445390_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200120.1|3445488_3446649_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3446691_3447813_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3447823_3448894_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3449103_3449469_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3449618_3450137_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3450126_3451353_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3451368_3451851_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3451927_3452275_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3452316_3453084_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3453114_3453663_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3453681_3453930_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3454066_3455428_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3455594_3456386_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3456407_3457694_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301442.1|3457748_3458342_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3458464_3459343_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3459428_3461090_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3461238_3461580_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3461641_3461932_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3461921_3462398_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3462529_3463012_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3463857_3464106_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132152.1|3464607_3465198_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3465380_3466031_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3466109_3467168_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3467297_3467720_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3467880_3468150_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3468367_3469580_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3470081_3470429_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3470425_3470806_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3471162_3471507_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3471511_3471727_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|3471876_3473730_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3474137_3474305_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3474390_3475134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3475386_3476010_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3476006_3476672_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3476668_3477280_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3477254_3477821_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001418122.1|3478932_3479268_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024180907.1|3479343_3480594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3480989_3481403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3481500_3481899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3481899_3483531_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|3483527_3484841_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3484842_3486048_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001071599.1|3486370_3486577_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000800629.1|3486676_3487528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655833.1|3488965_3490178_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
3492321:3492335	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 13
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	5080062	5094727	5474193	tRNA,tail,integrase	Enterobacteria_phage(43.75%)	19	5081343:5081358	5098872:5098887
WP_000956557.1|5080062_5080596_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5080792_5080966_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5081013_5081295_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5081343:5081358	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5081639_5081837_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5082172_5082457_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5082453_5082804_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5082794_5083331_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5084652_5085252_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_072643134.1|5085316_5086630_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023355.1|5086631_5086901_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5087012_5087585_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5087657_5088287_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5088368_5089010_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5089170_5089419_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5089480_5090578_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5090666_5091704_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5091837_5092080_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5092245_5093229_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5093311_5094727_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5098872:5098887	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 14
NZ_CP018239	Escherichia coli strain 272 chromosome, complete genome	5474193	5231606	5290612	5474193	transposase,protease	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|5231606_5232866_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5232868_5233873_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5233954_5234152_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5234255_5235554_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5235758_5236184_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5236222_5238664_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5238844_5239576_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5239702_5240104_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5240122_5240821_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5240871_5241531_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5241548_5241947_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5241956_5242595_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5242597_5243761_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5243844_5245470_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5245586_5245862_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5246010_5246340_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5246521_5247271_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5247267_5248023_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5248130_5249195_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|5249549_5250947_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5250962_5251268_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5251277_5251742_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5251755_5252406_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|5252415_5253270_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5253269_5253956_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5254084_5254360_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5254686_5255082_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5255088_5255403_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5255407_5255635_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5255676_5256126_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5256196_5256991_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5257613_5258045_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5258052_5259261_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5259395_5260034_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5260251_5260872_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5261180_5262593_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5262637_5263300_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5263402_5264368_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5264475_5265336_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5265424_5265805_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5265922_5267866_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5268055_5268796_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|5269007_5269946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5270008_5270563_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5270887_5271094_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5271172_5272516_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5272838_5273477_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5273682_5275416_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060931.1|5275412_5279192_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5279194_5279536_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5279747_5279999_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5279992_5280343_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5280422_5280953_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5281262_5282219_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|5283874_5284897_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5284883_5285879_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5285911_5286910_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5287085_5288459_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5288614_5289166_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5289259_5290612_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
