The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	199858	315826	5513008	protease,plate,transposase,integrase,tRNA,tail	Escherichia_phage(22.22%)	98	278693:278707	316242:316256
WP_001295561.1|199858_201211_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201240_203673_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203793_204279_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139281.1|204282_205308_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205412_205868_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205871_206660_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206659_207808_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207804_208401_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208437_211920_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211932_212892_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|212990_215132_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215188_215578_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|215642_216938_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|216990_217251_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217237_217438_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217603_218149_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218145_218556_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218569_219280_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219479_220304_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220356_222075_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094001.1|222185_222893_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222889_223294_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223411_224227_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224266_224920_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224912_225944_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226131_226707_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232464_233268_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233264_234179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234419_235220_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235297_236068_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236115_237474_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237545_238301_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238334_239057_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239053_239521_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239585_240317_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_072612710.1|240854_241655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242132_242582_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242584_243181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243259_243481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243501_243981_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243946_245356_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245366_248801_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|250353_251097_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000343292.1|253880_254642_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254646_255978_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255980_256505_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256501_257782_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257806_258889_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258852_260703_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260706_261120_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261210_262602_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262652_262877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262911_263412_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264108_264627_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264836_266978_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_149025286.1|267053_271301_+	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271440_272157_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001414559.1|273915_274431_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_072612711.1|275176_276313_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278277_278541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278455_278641_-	protein YncO	NA	NA	NA	NA	NA
278693:278707	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|278721_279894_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|280011_280782_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|280935_281409_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|281451_283896_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|284135_284714_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|284818_285586_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|285556_286297_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|286452_286713_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|286731_286992_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|287177_287951_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|288768_290508_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|290452_291238_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|291308_292364_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|292415_292709_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|292711_293110_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|293119_293572_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|294670_296128_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|296388_296847_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|296938_298183_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|298240_298642_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|298680_299736_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300023_301127_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301138_302392_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303461_303707_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304042_305255_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001274756.1|305777_306491_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306591_306792_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251067.1|306910_307204_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_000788819.1|308155_308467_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308466_309261_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309260_309854_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|309825_310269_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|310289_310700_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310729_311284_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311341_312115_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312938_313682_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|314644_315826_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
316242:316256	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 2
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	894749	932845	5513008	terminase,lysis,portal,protease,integrase,tail,holin	Enterobacteria_phage(51.16%)	50	884191:884205	916480:916494
884191:884205	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_089625990.1|894749_895688_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
WP_001303849.1|895793_896012_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|896051_896219_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|896461_897064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|897274_897496_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|897594_897810_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|897886_898078_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|898050_898233_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|898229_898910_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|899607_899790_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|899786_899957_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|899949_900570_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|900566_901232_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|901443_902403_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|902739_902862_+	YlcG family protein	NA	NA	NA	NA	NA
WP_072612724.1|902876_903566_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.6	1.0e-57
WP_001302581.1|903749_904493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|904578_904737_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|904817_905216_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|905358_905574_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|905573_906071_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|906067_906535_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|906522_906675_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|907349_907841_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|907840_909943_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|909939_910152_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|910079_911204_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|911325_911661_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|911605_913633_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|913719_914043_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|914035_914311_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|914322_914901_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|914897_915299_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|915309_916053_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|916113_916500_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
916480:916494	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|916508_916838_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|916809_919875_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|919874_920204_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|920213_920912_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|920917_921661_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|921597_922206_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|922266_925680_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|925750_926350_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|926409_927726_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|927727_927997_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|928173_929154_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|929187_930207_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|930703_930865_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|931034_931916_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|932146_932845_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	1149556	1218084	5513008	holin,portal,protease,transposase,capsid,integrase,tail,head	Escherichia_phage(23.26%)	76	1158044:1158059	1179410:1179425
WP_000156526.1|1149556_1151317_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1151502_1151955_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1152030_1153071_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1153427_1153937_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1154155_1154785_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1154747_1156910_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1156919_1157366_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1157488_1159543_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1158044:1158059	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1159574_1160033_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1160128_1160791_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1160963_1161377_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1161421_1161739_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1161796_1162987_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1163081_1163360_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1163356_1163686_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1163776_1164436_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1164843_1165863_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1165840_1166083_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1166150_1168622_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1168715_1168907_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1168903_1169092_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1169665_1169851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1170037_1170427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1170568_1170724_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1171001_1171289_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1171288_1171480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1171507_1171909_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1172017_1172290_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1172273_1172699_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1172905_1173361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1173439_1174531_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1174537_1175284_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1175305_1176076_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1176091_1176505_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1176856_1177630_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1178234_1178390_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1178557_1178836_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1178837_1179887_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1179410:1179425	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1179899_1180271_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1180260_1180632_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1180783_1181602_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1182222_1182936_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1183703_1185554_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001303878.1|1185829_1186144_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1186671_1186857_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1187078_1187192_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1187412_1187946_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1188105_1188378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1188633_1188840_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1189590_1189866_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1189941_1190322_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1190318_1190666_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1190715_1192254_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|1194430_1194637_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1194633_1196226_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1196215_1197721_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1197757_1198105_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1198162_1198429_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1198410_1199151_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1199164_1199596_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1199622_1200036_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001455418.1|1200016_1201879_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	7.4e-265
WP_010904726.1|1201830_1202595_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000847304.1|1202591_1202921_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|1202920_1203619_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|1203629_1204373_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1204318_1204951_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1205141_1205669_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515110.1|1205802_1209276_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230444.1|1209343_1209943_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|1210007_1211321_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|1211322_1211592_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1213865_1214984_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1214980_1216774_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1216792_1217500_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1217496_1218084_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	1479854	1600413	5513008	terminase,lysis,portal,protease,head,transposase,capsid,integrase,tRNA,tail,holin	Enterobacteria_phage(35.92%)	147	1545772:1545787	1574027:1574042
WP_000952736.1|1479854_1480676_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1480831_1481878_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1481874_1482669_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1482835_1483954_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1483922_1484192_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1484253_1484643_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1484775_1485291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1485405_1485558_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1485873_1486350_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1486474_1486798_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1486781_1487207_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1487275_1488313_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1488224_1488767_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1488800_1489517_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1489549_1489831_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1489827_1490130_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1490119_1490437_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1490390_1490708_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1490694_1491132_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1491133_1491325_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1491327_1491915_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1492030_1492135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1492323_1492536_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1492703_1492982_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1492983_1494033_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|1494045_1494420_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1494416_1495238_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|1496316_1498254_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|1498401_1498584_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1498621_1498891_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1498966_1499182_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731240.1|1499186_1499531_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
WP_001056806.1|1500386_1500956_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1500955_1501102_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1501329_1501536_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1501600_1501825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1502181_1502322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1502451_1502637_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1502678_1503044_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1503333_1503897_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|1503893_1505555_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1505618_1507556_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1507600_1507822_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072612732.1|1507767_1510347_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125988.1|1510349_1510676_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1510685_1511036_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1511032_1511479_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1511475_1511820_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1511885_1512602_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1512616_1512991_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1513086_1513296_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_162829202.1|1515606_1516820_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000807950.1|1517891_1518233_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|1518232_1518931_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|1518947_1519202_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1519311_1519422_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1519724_1520603_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1520656_1521394_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1521339_1521576_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1521588_1521678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1521697_1524046_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1524636_1528038_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1530346_1530622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1530682_1532044_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1532407_1533271_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1533254_1534391_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1534640_1535867_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1535915_1537037_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1537285_1538515_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1538879_1539068_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1539872_1540070_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1540062_1540275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1540264_1540729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1540721_1540955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1540960_1541260_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1541256_1542657_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1542857_1543109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1543105_1543516_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1543526_1543799_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1543925_1544150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1544401_1544608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1544607_1545663_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1545675_1546011_+|head	head decoration protein	head	NA	NA	NA	NA
1545772:1545787	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1546023_1546437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1546642_1547185_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1547440_1547722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1548322_1549783_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1549782_1550454_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1550622_1551993_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1551996_1552638_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1552673_1553780_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1553833_1554295_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1554304_1554958_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1555129_1556380_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1556493_1557636_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1557625_1557862_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1558786_1559488_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1559484_1559787_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1559854_1560187_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1560251_1560374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1560431_1561958_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1562459_1562915_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1562914_1563085_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1563077_1563368_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1563364_1563727_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1563723_1563864_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1563860_1564550_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1564871_1565177_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1565163_1565640_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1565856_1566039_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1566129_1566423_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1566714_1567125_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1567410_1567617_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1567781_1567976_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1568364_1568910_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_000198153.1|1570807_1571014_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1571010_1572612_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_072612733.1|1572592_1573912_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	5.8e-232
WP_001295978.1|1573921_1574254_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1574027:1574042	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|1574309_1575335_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1575376_1575775_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_072612734.1|1575786_1576140_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	3.2e-60
WP_000975100.1|1576151_1576730_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1576726_1577122_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1577129_1577870_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1577885_1578308_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1578289_1578724_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1578716_1581266_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1581262_1581592_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1581591_1582290_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1582295_1583039_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1582975_1583608_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1583668_1587067_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|1587133_1587733_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|1587797_1590713_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885630.1|1590712_1591294_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1591413_1592304_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1592322_1592829_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1592865_1593366_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1593444_1593627_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1594124_1594793_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1594849_1595098_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1595173_1595554_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1595550_1595898_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1595947_1597486_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1597788_1599273_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1599459_1600413_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 5
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	1695831	1770111	5513008	terminase,portal,protease,head,transposase,capsid,integrase,tail,holin	Stx2-converting_phage(38.18%)	81	1695668:1695695	1754583:1754610
1695668:1695695	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1695831_1696962_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1696939_1697188_-	excisionase	NA	NA	NA	NA	NA
WP_072612735.1|1697252_1699724_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.9	9.4e-58
WP_001090200.1|1699816_1700008_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1700004_1700193_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|1700761_1700980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|1701051_1701351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1701703_1701982_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1701983_1702175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|1702195_1702567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1702664_1702967_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|1702963_1703389_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|1703411_1704374_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|1704380_1705121_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|1705931_1706327_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|1706383_1706968_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|1707083_1707188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1707376_1707589_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|1707756_1708035_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|1708036_1709086_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|1709098_1709458_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001303509.1|1710782_1711211_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|1711689_1713540_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|1713979_1714195_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|1714199_1714544_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1714594_1715128_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1715398_1715968_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1715967_1716114_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1716341_1716527_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1716951_1717179_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1717220_1717586_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1717876_1718440_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|1718436_1720098_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1720161_1722099_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1722143_1722365_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1722310_1724812_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1724891_1725218_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1725227_1725578_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1725574_1726021_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1726017_1726362_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_072612736.1|1726420_1727137_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	6.6e-129
WP_001030063.1|1727142_1727517_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1727612_1727822_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_072612737.1|1727874_1730955_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_000807954.1|1730947_1731289_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|1731288_1731987_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000194720.1|1731997_1732741_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1732686_1733319_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1733661_1734837_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1734788_1737134_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1737201_1737801_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|1737952_1739266_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|1739267_1739537_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1740563_1741889_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|1743486_1743609_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|1743715_1744627_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1744692_1745262_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|1746227_1747766_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1747815_1748163_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1748159_1748540_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1748879_1749158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1749585_1749732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1749868_1750516_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1750699_1751290_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_170760845.1|1752796_1753447_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.4	1.5e-26
WP_001079499.1|1754760_1755267_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1754583:1754610	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1755312_1755813_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1755898_1756078_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1756458_1757265_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1757264_1758458_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1758469_1759831_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1759831_1761427_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1761426_1762989_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1763080_1763125_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1763262_1764144_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1764140_1764761_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1764788_1766372_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1766584_1767457_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1767496_1768087_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1768083_1768842_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1769061_1770111_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2033536	2194462	5513008	terminase,lysis,holin,portal,protease,transposase,capsid,tail,head	Escherichia_phage(33.12%)	194	NA	NA
WP_000214712.1|2033536_2033740_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2033775_2035236_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2036739_2036982_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2037143_2037785_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2037866_2038496_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2038568_2039144_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2039257_2039527_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072612739.1|2039528_2040680_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.9	8.2e-81
WP_072612740.1|2040744_2041344_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_072612741.1|2041410_2044890_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.4	0.0e+00
WP_072147834.1|2045130_2045760_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_072612742.1|2045705_2046449_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	97.2	1.2e-146
WP_032208657.1|2046454_2047153_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_032206995.1|2047152_2047482_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	1.2e-56
WP_149025287.1|2047417_2050090_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	0.0e+00
WP_000533440.1|2050070_2050484_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2050510_2050933_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2050946_2051699_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2051706_2052102_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2052098_2052632_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2052646_2053000_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2053011_2053410_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2053451_2054477_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2054532_2054865_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2054874_2056194_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2056174_2057776_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2057772_2057979_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|2057975_2059901_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2059875_2060421_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2060807_2061032_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2061113_2061428_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2061953_2062139_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2062361_2062508_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2062507_2063077_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2063347_2063881_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2063931_2064276_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2064280_2064496_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2064934_2066785_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2067262_2067694_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2068144_2068858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2068993_2069191_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2069415_2069970_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2070032_2070338_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2070350_2071400_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2071401_2071674_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2071795_2072140_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2072259_2072472_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2072705_2073263_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2073264_2073483_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2073610_2073922_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2073914_2074142_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2074138_2074420_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2074452_2075169_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2075202_2075664_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2075656_2076700_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2076768_2077194_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2077177_2077420_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2077811_2078150_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2078442_2078595_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2078606_2079245_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2079245_2079455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2080019_2080208_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2080204_2080393_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2080485_2081730_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2082440_2082683_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001023360.1|2083049_2083319_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	1.9e-44
WP_045893719.1|2083320_2084634_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	7.7e-83
WP_052915486.1|2084698_2085298_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_072612743.1|2085364_2088841_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_122368358.1|2089081_2089711_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	1.9e-103
WP_000194755.1|2089656_2090400_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	6.8e-145
WP_001357740.1|2090410_2091109_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2091108_2091438_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072612744.1|2091434_2094080_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532075.1|2094123_2094432_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479061.1|2094458_2094881_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000235090.1|2094894_2095647_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2095654_2096053_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2096065_2096689_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281347.1|2096691_2096973_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|2096965_2097292_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|2097379_2099359_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974563.1|2099348_2100851_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_000102415.1|2100850_2101063_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077608.1|2101059_2103183_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|2103179_2103656_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_000735655.1|2104074_2104299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255337.1|2104322_2104790_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	85.3	6.3e-64
WP_001092859.1|2104786_2105320_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	3.1e-99
WP_001015164.1|2105362_2105920_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.3	8.6e-52
WP_000284516.1|2105923_2106139_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290217.1|2106215_2106488_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143457.1|2106528_2106708_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	3.7e-25
WP_072612745.1|2106844_2108791_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.2	0.0e+00
WP_024222756.1|2109504_2110062_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	77.6	1.4e-46
WP_033816149.1|2110335_2110890_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	4.5e-69
WP_000140011.1|2110898_2111264_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_024239880.1|2111264_2112329_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_001304183.1|2112330_2112609_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|2112674_2112842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373318.1|2113686_2114481_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|2114464_2115181_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001224661.1|2115440_2115614_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000403785.1|2115711_2116068_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001118156.1|2116140_2116521_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_033816177.1|2116536_2117307_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.2e-83
WP_033816178.1|2117336_2118074_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	3.4e-112
WP_032211818.1|2118080_2119034_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_000693899.1|2119056_2119482_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2119465_2119741_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2119843_2120233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380316.1|2120401_2120554_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2120565_2121204_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2121204_2121414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2121977_2122166_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199474.1|2122162_2122354_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_033815912.1|2122446_2124891_+	exonuclease	NA	V5UQJ3	Shigella_phage	59.9	8.4e-176
WP_000005551.1|2124961_2125213_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_024239772.1|2125248_2126523_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.2	4.3e-155
WP_001120551.1|2126706_2126949_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2127911_2128292_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2128288_2128636_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2128685_2130224_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2130806_2131457_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2132167_2132743_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2132856_2133126_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_024183355.1|2133127_2134441_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001230508.1|2134505_2135105_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001152128.1|2138838_2139276_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2139275_2139617_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072612737.1|2139609_2142690_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_001453698.1|2142742_2142952_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2143047_2143422_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_072612736.1|2143427_2144144_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	6.6e-129
WP_000133388.1|2144202_2144547_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2144543_2144990_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2144986_2145337_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2145346_2145673_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2145752_2148254_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2148199_2148421_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2148465_2150403_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_038425863.1|2150466_2152128_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2152124_2152688_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2152977_2153343_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2153384_2153612_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2154036_2154222_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2154449_2154596_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_162829202.1|2154942_2156155_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000992137.1|2156748_2157282_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2157332_2157677_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2157681_2157897_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2158046_2159900_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2160696_2161755_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2161905_2162103_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2162344_2162875_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2162883_2163243_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2163255_2164302_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2164303_2164582_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2164651_2164909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2165129_2165342_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2165620_2166379_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2167077_2167242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2167238_2167820_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2168006_2168549_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2168460_2169501_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2169472_2170024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2170007_2170235_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2170311_2170719_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2170982_2171282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2171354_2171573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2171595_2172003_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2171980_2172214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2172775_2172964_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2172960_2173152_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048458.1|2173244_2175716_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_000005552.1|2175788_2176040_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001302046.1|2177028_2177355_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|2177489_2177831_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2177865_2178426_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|2178428_2179139_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|2179246_2179552_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041704.1|2179750_2182177_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_001414236.1|2182237_2184661_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000213028.1|2184671_2185289_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526515.1|2185290_2186145_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2186187_2186802_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071525082.1|2186959_2188252_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_072612748.1|2188204_2188900_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|2189024_2190245_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|2190379_2191273_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091829.1|2191379_2192633_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743952.1|2193029_2193365_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2193457_2193541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|2193640_2194462_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2414280	2496192	5513008	terminase,portal,protease,transposase,integrase,tRNA,tail,holin	Escherichia_phage(50.0%)	97	2455171:2455185	2494869:2494883
WP_001220997.1|2414280_2414976_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2415033_2416944_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2417075_2417420_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2417781_2418141_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2418260_2418440_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854987.1|2418513_2419875_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
WP_000456725.1|2419878_2420457_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624305.1|2420640_2422005_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001302042.1|2422135_2423734_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|2423737_2425294_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150543.1|2425756_2426728_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|2426790_2427591_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|2427603_2428455_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156258.1|2428509_2428968_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|2429397_2429964_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010147.1|2429960_2430770_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|2430935_2431145_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|2431157_2431301_-	YobF family protein	NA	NA	NA	NA	NA
WP_072612751.1|2431969_2432257_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|2432331_2432475_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211007.1|2432634_2432874_+	membrane protein	NA	NA	NA	NA	NA
WP_001262182.1|2433017_2433809_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127211.1|2433985_2435359_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|2435404_2436286_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055778.1|2436477_2438526_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431368.1|2438545_2439244_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2439340_2439838_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207282.1|2439967_2441251_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001302055.1|2441219_2443853_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001302304.1|2443933_2445373_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2445490_2445727_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2445831_2446023_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812736.1|2446023_2446680_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_149025289.1|2447412_2448426_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2448640_2448718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655766.1|2448828_2449008_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	9.2e-16
WP_162829202.1|2449006_2450219_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_077891446.1|2450222_2450438_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6ETG7	Enterobacteria_phage	98.3	1.4e-26
WP_077891445.1|2450412_2451726_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_072612754.1|2451790_2452390_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	1.1e-105
WP_072612755.1|2452456_2455933_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.8	0.0e+00
2455171:2455185	attL	TGCGTTTTTCCTGGT	NA	NA	NA	NA
WP_141116124.1|2456178_2456811_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.7e-104
WP_060552850.1|2456756_2457500_-|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	99.2	2.1e-146
WP_032208657.1|2457505_2458204_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_032206995.1|2458203_2458533_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	1.2e-56
WP_000532075.1|2461218_2461527_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_072612757.1|2461553_2461976_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	2.2e-71
WP_072612758.1|2461989_2462742_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	1.7e-135
WP_000682716.1|2462749_2463148_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2463160_2463784_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2463786_2464068_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2464060_2464387_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_149025297.1|2464474_2466454_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	99.1	0.0e+00
WP_072612759.1|2466443_2467949_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	93.0	3.3e-271
WP_053265017.1|2467948_2468161_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	85.7	4.0e-26
WP_072612760.1|2468157_2470281_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	95.8	0.0e+00
WP_053265019.1|2470277_2470754_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	94.3	3.2e-79
WP_072612762.1|2471077_2472370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005499.1|2472366_2472789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072612812.1|2472977_2473490_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	31.1	1.9e-05
WP_072612763.1|2473495_2474029_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	2.4e-96
WP_053265023.1|2474348_2474552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284506.1|2474555_2474771_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2474848_2475094_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143464.1|2475134_2475314_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_072612764.1|2475450_2477397_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_072612765.1|2478089_2478644_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	2.5e-67
WP_000228019.1|2478640_2478931_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000940348.1|2478930_2479530_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000687443.1|2479589_2479763_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_000813254.1|2480015_2480171_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001278459.1|2480414_2480519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206192.1|2480628_2481462_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_000063625.1|2481497_2481710_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000403779.1|2481758_2482115_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_072612766.1|2482172_2482565_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	2.2e-38
WP_072612767.1|2482580_2483351_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.3e-85
WP_000789014.1|2483376_2484117_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	83.3	2.3e-116
WP_032348771.1|2484123_2484912_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_044805260.1|2484989_2485412_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	4.5e-69
WP_000171139.1|2485395_2485671_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|2485775_2486240_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_072612768.1|2486621_2486777_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.0e-08
WP_001502431.1|2486778_2487141_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	77.5	1.7e-08
WP_001502430.1|2487130_2487310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560223.1|2487717_2487939_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2487938_2488109_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2488183_2488459_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_072612770.1|2488560_2491161_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	6.7e-248
WP_042853000.1|2492020_2492215_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_072612771.1|2492207_2492396_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	2.3e-25
WP_001311878.1|2492502_2492784_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_072612772.1|2492749_2493826_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.4	6.9e-98
WP_000976483.1|2494218_2494560_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879314.1|2494572_2495445_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
2494869:2494883	attR	ACCAGGAAAAACGCA	NA	NA	NA	NA
WP_000168751.1|2495448_2495823_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2495961_2496192_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 8
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2519704	2574378	5513008	terminase,lysis,holin,transposase,capsid,tRNA,tail,head	Stx2-converting_phage(36.36%)	62	NA	NA
WP_001258683.1|2519704_2521477_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891621.1|2521786_2522353_+	hydrolase	NA	NA	NA	NA	NA
WP_001261931.1|2522670_2522919_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|2523290_2524304_-	M85 family metallopeptidase	NA	NA	NA	NA	NA
WP_122988840.1|2524518_2524596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023381.1|2524706_2524976_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_072612773.1|2524977_2526291_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	6.9e-76
WP_001230428.1|2526355_2526955_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000515051.1|2527025_2530523_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.8	0.0e+00
WP_000649829.1|2530656_2531184_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_149025298.1|2531374_2532007_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	89.5	9.3e-95
WP_000194763.1|2531952_2532696_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_012817889.1|2532706_2533405_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	1.6e-127
WP_000807964.1|2533404_2533746_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212809.1|2533738_2536981_-|tail	phage tail tape measure protein	tail	H6WZM1	Escherichia_phage	94.4	0.0e+00
WP_001453698.1|2537032_2537242_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030048.1|2537337_2537712_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
WP_001275508.1|2537717_2538434_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2538492_2538837_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2538833_2539280_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2539276_2539627_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2539637_2539964_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2542490_2542712_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2542756_2544694_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_012817891.1|2544757_2546419_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000279810.1|2547268_2547634_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	8.4e-64
WP_000095736.1|2547675_2547903_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|2548271_2548496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032313590.1|2548492_2548987_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	98.7	7.6e-76
WP_000998048.1|2549703_2551242_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2551291_2551639_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2551635_2552016_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000284510.1|2552273_2552489_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|2552565_2552838_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143463.1|2552878_2553058_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000143119.1|2553193_2555131_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	98.9	0.0e+00
WP_001398907.1|2555374_2555698_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	100.0	2.0e-61
WP_000738068.1|2555995_2556265_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_001365678.1|2556276_2557236_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000483505.1|2557618_2558677_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|2558828_2559026_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|2559241_2559622_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|2559640_2560630_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|2560681_2560939_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|2560935_2562336_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|2562332_2563211_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|2563221_2564130_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621233.1|2564116_2564350_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_000587259.1|2564346_2565009_-	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|2565117_2565825_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|2565906_2566140_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|2566296_2566986_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|2567133_2567835_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|2567831_2568032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365075.1|2568417_2568990_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|2569359_2570187_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|2570227_2570599_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|2570790_2571045_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_072612775.1|2571078_2572365_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.5	2.0e-253
WP_171880451.1|2572369_2573146_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.4e-71
WP_000252980.1|2573198_2573594_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2573634_2574378_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 9
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2580994	2632110	5513008	tail,integrase,tRNA,transposase	Enterobacteria_phage(60.0%)	59	2574218:2574233	2632189:2632204
2574218:2574233	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2580994_2582728_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2582904_2583393_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2583512_2583905_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2583904_2585983_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2585975_2587124_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2587325_2587970_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2587980_2588370_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2588384_2589434_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2589436_2590297_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2590315_2591917_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2591962_2593624_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2593766_2594270_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2594290_2596255_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2596259_2597186_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2597182_2598070_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2598196_2598775_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2598777_2599128_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2599907_2600336_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2600342_2601767_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2601741_2602542_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2602708_2603695_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2603709_2605224_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2605293_2606283_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2607079_2607583_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2607662_2607914_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2608028_2608115_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2608376_2608700_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2608870_2609368_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2609404_2609644_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2609835_2611047_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2611108_2611774_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2612130_2613132_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2613137_2613485_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2613514_2614165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2614180_2614585_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2614674_2614812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2614883_2615087_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2615108_2615459_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2615469_2615748_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2615759_2616002_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2615998_2616112_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2616204_2616621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2616644_2616848_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2616844_2617111_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2617107_2617407_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2617418_2618036_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2618032_2618398_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2618404_2621227_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2621303_2622263_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2622267_2622582_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2623673_2624204_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2624247_2624820_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2624976_2625465_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2628267_2628423_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2628431_2628797_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2628851_2629364_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|2629363_2630548_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|2630705_2631029_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_072612814.1|2630979_2632110_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	4.8e-41
2632189:2632204	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2689689	2758231	5513008	terminase,holin,portal,transposase,capsid,integrase,tail,head	Escherichia_phage(34.78%)	68	2705497:2705512	2763890:2763905
WP_001023352.1|2689689_2689959_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_072612778.1|2689960_2691274_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	6.9e-84
WP_001230514.1|2691338_2691938_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_170760895.1|2692005_2693124_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.7	9.7e-196
WP_126446229.1|2695731_2696364_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	99.5	5.7e-100
WP_000194810.1|2696309_2697053_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_032256908.1|2697063_2697762_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2697761_2698091_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072612779.1|2698087_2700667_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.8	0.0e+00
WP_000533402.1|2700647_2701061_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2701087_2701519_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2701532_2702273_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2702254_2702521_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2702578_2702926_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2702962_2704468_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2704457_2706050_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2705497:2705512	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2706046_2706253_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2708137_2708647_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2709041_2709266_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2709347_2709662_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2710188_2710374_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2710601_2710733_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2710745_2710928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2711083_2711617_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2711667_2712012_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2712016_2712232_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2712542_2713755_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2713837_2715688_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|2716165_2716594_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2717227_2717917_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2717913_2718273_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2718285_2719335_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2719336_2719615_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2719782_2719995_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2720181_2720286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2720395_2720959_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2721085_2721397_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2721393_2721546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2721578_2721935_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2721931_2722156_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2722177_2722876_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2722910_2723453_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2723364_2724402_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2724470_2724896_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2724892_2725120_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2725217_2725862_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2726136_2726289_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2726769_2726958_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2726954_2727143_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2727238_2729710_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2729768_2729972_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2729971_2730994_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2731229_2732027_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_162829243.1|2736755_2737968_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_000480501.1|2742073_2743126_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2743439_2744756_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2744857_2746312_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2746654_2747371_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2747996_2749640_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2749757_2750708_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2750809_2751727_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2752183_2753119_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2753180_2754260_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2754271_2755015_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2755011_2755557_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2755918_2756299_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2756295_2756643_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2756692_2758231_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2763890:2763905	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 11
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	2861427	2973859	5513008	terminase,portal,protease,integrase,tRNA,tail,holin	Enterobacteria_phage(49.33%)	121	2914929:2914949	2971365:2971385
WP_000476014.1|2861427_2862789_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|2863118_2863436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2863841_2864741_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|2864822_2865602_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2865701_2866742_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2866789_2868145_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|2868148_2868433_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2868463_2868916_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|2868925_2870188_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|2870216_2871071_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2871369_2872422_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|2872678_2873956_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|2873952_2874957_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|2874953_2875919_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2875892_2876639_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|2876690_2877509_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|2877573_2878374_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|2878370_2879159_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|2879492_2879732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|2880782_2881130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|2881139_2881454_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|2881563_2881836_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|2881956_2882808_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|2883025_2883364_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|2883445_2884480_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|2886986_2887661_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|2887748_2888291_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|2888582_2888864_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|2889125_2890235_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|2890366_2892400_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2899357_2902987_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2903048_2903366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2904606_2905695_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2905705_2907235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|2907253_2907985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|2907977_2909114_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2909110_2911114_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2911238_2911700_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2911741_2912212_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2912258_2912978_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2912974_2914660_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
2914929:2914949	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|2915174_2915423_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023407.1|2915790_2916060_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_072612781.1|2916061_2917375_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	1.1e-78
WP_001228289.1|2917439_2918039_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_072612782.1|2918106_2921580_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_149025299.1|2921820_2922450_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	99.0	1.8e-98
WP_000194798.1|2922395_2923139_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072612784.1|2923149_2923848_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847298.1|2923847_2924177_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072612785.1|2924173_2926819_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|2926862_2927171_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2927197_2927620_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2927633_2928386_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2928393_2928792_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2928804_2929428_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2929430_2929712_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2929704_2930031_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_149025290.1|2930118_2932143_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2932087_2933590_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2933589_2933802_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000133411.1|2935294_2935576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|2935834_2937724_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|2938381_2938804_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|2938800_2939046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761774.1|2939333_2941148_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_000728901.1|2941144_2941387_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000551748.1|2941583_2942177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335965.1|2942169_2942394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149025300.1|2942386_2943106_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001038670.1|2943086_2943668_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_000229066.1|2943727_2943952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114062.1|2943944_2945183_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	3.9e-60
WP_001077621.1|2945344_2946352_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000348565.1|2946348_2946825_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2946857_2947130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2947341_2947527_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2947754_2947901_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2947900_2948470_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2948740_2949274_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2949278_2949494_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2949571_2949817_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2949857_2950037_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142933.1|2950173_2952120_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_001356551.1|2952923_2953076_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2953324_2953759_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2953844_2953985_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2953981_2954344_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2954340_2954631_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2954623_2954794_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|2954793_2955249_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|2955245_2955347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2955470_2955872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2955850_2956267_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|2956566_2957175_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|2957927_2958275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788902.1|2958479_2959181_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_001415152.1|2959177_2960107_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182877.1|2960195_2960735_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000712399.1|2961098_2961791_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_072612786.1|2961901_2963506_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	1.2e-93
WP_023148105.1|2964009_2964300_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|2964375_2964672_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|2964677_2965463_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2965459_2966137_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2966136_2966319_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2966291_2966483_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2966559_2966775_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2966873_2967095_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2967091_2968039_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2968040_2968217_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2968550_2968907_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2968903_2969266_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2969353_2969596_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|2969599_2969734_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|2969752_2970007_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2970040_2971327_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2971347_2972049_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
2971365:2971385	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|2972108_2972216_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2972196_2972928_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2972932_2973859_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 12
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	3218257	3223683	5513008	integrase	Enterobacteria_phage(50.0%)	6	3208708:3208724	3220672:3220688
3208708:3208724	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3218257_3219190_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3219501_3220659_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3220833_3221970_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3220672:3220688	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3221979_3222660_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3222646_3223114_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_187655764.1|3223113_3223683_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 13
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	3468230	3531079	5513008	transposase,integrase,tRNA,tail,holin	Enterobacteria_phage(30.0%)	60	3509498:3509557	3529813:3531124
WP_000138184.1|3468230_3468929_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082974.1|3468960_3471621_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3471734_3473090_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3473135_3473459_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3473455_3474754_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3480527_3483101_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3483230_3483962_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|3483958_3484939_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3485073_3485811_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3486081_3486423_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3486526_3486574_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200120.1|3486672_3487833_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3487875_3488997_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3489007_3490078_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3490287_3490653_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3490802_3491321_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3491310_3492537_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|3492552_3493035_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3493111_3493459_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3493500_3494268_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3494298_3494847_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3494865_3495114_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3495250_3496612_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3496778_3497570_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3497591_3498878_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3498932_3499526_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3499648_3500527_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|3500612_3502274_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3502422_3502764_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3502825_3503116_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3503105_3503582_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3503713_3504196_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3505041_3505290_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3505791_3506382_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3506564_3507215_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3507293_3508352_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3508481_3508904_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3509064_3509334_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
3509498:3509557	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|3509551_3510764_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3511265_3511613_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3511609_3511990_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3512346_3512691_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3512695_3512911_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3513060_3514914_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3515321_3515489_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3515574_3516318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3516570_3517194_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3517190_3517856_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3517852_3518464_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3518438_3519005_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001418122.1|3520074_3520410_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150581.1|3520485_3521700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3522095_3522509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3522606_3523005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|3523005_3524637_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|3524633_3525947_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3525948_3527154_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001071599.1|3527476_3527683_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000800629.1|3527782_3528634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3529866_3531079_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
3529813:3531124	attR	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACTAAAAATACTCGTTTTTCCCCCGAAGTCCGTCAGCGGGCGATTCGTATGGTTCTGGAAAGTCAGGATGAATATGACTCACAGTGGGCGGCAATTTGTTCCATTGCCCCAAAGATTGGCTGTACGCCGGAGACTCTGCGTGTCTGGGTTCGCCAGCATGAGCGGGATACCGGGGGCGGTGATGGTGGGCTCACCAGCGCTGAACGTCAGCGTCTGAAAGAGCTGGAACGTGAAAATCGTGAACTGCGCCGCAGTAACGATATCCTTCGCCAGGCTTCCGCTTATTTTGCGAAGGCGGAGTTCGACCGCCTCTGGAAAAAATGATGCCACTGCTGGATAAGCTGCGTGAGCAGTACGGGGTCGGACCGGTATGCAGCGAACTGCATATTGCCCCGTCAACGTATTACCATTGTCAGCAACAGCGACATCATCCGGATAAACGCAGTGCCCGTGCGCAGCACGACGACTGGCTGAAGAGAGAGATACAGCGCGTATACGATGAAAATCATCAGGTGTACGGTGTGCGTAAAGTCTGGCGTCAGTTGTTACGGGAAGGAATCAGGGTGGCCAGATGTACAGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTTATCATTGATGTGTTTGCCGGATACATCGTGGGGTGGCGGGTCTCATCGTCTATGGAAACGACATTCGTGCTGGATGCGCTGGAGCAGGCGTTGTGGGCCCGTCGTCCGTCTGGCACCATCCATCACAGCGATAAAGGCTCTCAGTATGTGTCACTGGCCTATACGGAGCGACTAAAAGAAGCCGGATTACTGGCATCAACAGGGAGTACAGGCGACTCGTATGACAACGCGATGGCTGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTAACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGGAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAGT	NA	NA	NA	NA
>prophage 14
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	4612427	4625986	5513008	transposase,integrase	Enterobacteria_phage(66.67%)	15	4607643:4607656	4622970:4622983
4607643:4607656	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218979.1|4612427_4613597_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|4613616_4615476_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4615472_4615898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446146.1|4616225_4616798_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|4616871_4617372_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283029.1|4617368_4618103_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|4618654_4618921_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980245.1|4618917_4619508_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001244665.1|4619500_4619788_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459321.1|4619780_4620236_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.4e-63
WP_000856729.1|4620371_4620692_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783682.1|4620706_4623040_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
4622970:4622983	attR	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001171554.1|4623673_4624054_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4624050_4624398_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|4624447_4625986_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
>prophage 15
NZ_CP018237	Escherichia coli strain 155 chromosome, complete genome	5513008	5116354	5126870	5513008	tail,integrase	Enterobacteria_phage(46.67%)	15	5117635:5117650	5135165:5135180
WP_000956557.1|5116354_5116888_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5117084_5117258_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5117305_5117587_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5117635:5117650	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5117931_5118129_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5118464_5118749_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5118745_5119096_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5119086_5119623_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5120944_5121544_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5121608_5122922_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5122923_5123193_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5123304_5123877_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5123949_5124579_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5124660_5125302_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5125462_5125711_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5125772_5126870_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
5135165:5135180	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
