The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1127179	1132992	4898059		Enterobacteria_phage(100.0%)	8	NA	NA
WP_000783706.1|1127179_1129513_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743153.1|1129527_1129848_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216598.1|1129844_1130072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980354.1|1130068_1130626_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	66.4	2.7e-29
WP_000556587.1|1130622_1130889_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000194694.1|1131429_1132167_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	3.1e-81
WP_000984206.1|1132163_1132409_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	4.8e-31
WP_000210079.1|1132425_1132992_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	3.8e-55
>prophage 2
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1136081	1225857	4898059	portal,holin,plate,head,integrase,tail,terminase,capsid,tRNA	Cronobacter_phage(65.12%)	78	1137457:1137504	1169133:1169180
WP_000124716.1|1136081_1137275_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.6e-106
1137457:1137504	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000290918.1|1137620_1138631_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.7	9.5e-174
WP_001047672.1|1138630_1139197_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	59.7	1.1e-65
WP_000204908.1|1139342_1139546_+	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	1.0e-10
WP_000460879.1|1139583_1140087_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	71.3	1.5e-58
WP_000643375.1|1140096_1140324_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996734.1|1140313_1140739_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|1140738_1141140_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000057335.1|1141207_1141438_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000985848.1|1141428_1141758_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	2.0e-11
WP_000279398.1|1141747_1142581_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	68.3	1.6e-105
WP_000171003.1|1142577_1144599_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.9e-298
WP_000960961.1|1144711_1144930_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	3.6e-06
WP_001669965.1|1144903_1145227_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038205.1|1145223_1146285_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	6.0e-163
WP_001151940.1|1146281_1148057_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000018802.1|1148217_1149021_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.4	4.1e-79
WP_000550496.1|1149082_1150105_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|1150108_1150810_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001628758.1|1150906_1151359_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	3.6e-64
WP_000084220.1|1151355_1151862_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560083.1|1151858_1152566_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_000220203.1|1152562_1153690_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|1153686_1154142_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|1154151_1154445_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1154441_1154783_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376370.1|1154782_1155115_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	6.7e-36
WP_000411339.1|1155261_1155519_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811087.1|1155706_1157677_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.8	9.2e-266
WP_001002797.1|1157673_1158003_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1157999_1159184_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001823.1|1159176_1159764_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	8.4e-90
WP_000084299.1|1159773_1161879_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	69.0	8.8e-198
WP_000861354.1|1161891_1162446_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.5	9.4e-91
WP_000267955.1|1162435_1163161_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	5.5e-67
WP_000200789.1|1163132_1163678_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000977536.1|1163677_1165381_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
WP_000136561.1|1166061_1167180_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001177838.1|1168805_1169054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000342601.1|1169569_1170733_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1169133:1169180	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196147.1|1170740_1172921_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533874.1|1172917_1174327_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237676.1|1174391_1185557_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_001518569.1|1186170_1186653_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1186802_1187279_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1187268_1187559_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1187724_1188063_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1188211_1189873_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1189958_1190837_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1190959_1191550_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001294020.1|1191584_1192190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1192310_1193597_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1193616_1194408_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1194573_1195935_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1196187_1196436_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1196454_1197003_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1197047_1197815_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1197855_1198203_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1198359_1199580_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212380.1|1199572_1200091_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1200530_1201601_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225194.1|1201610_1202732_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000632386.1|1202789_1203698_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1203658_1204819_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1204918_1204966_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178449.1|1205069_1205408_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1205679_1206417_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1206548_1207529_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1207525_1208257_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1208386_1210960_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985653.1|1217034_1217490_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807818.1|1217593_1218895_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264478.1|1218891_1219215_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1219259_1220615_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082646.1|1220729_1223390_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183641.1|1223443_1224124_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|1224196_1224616_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997365.1|1224819_1225857_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1230496	1281663	4898059	portal,protease,holin,head,integrase,tail,transposase,terminase,lysis,capsid,tRNA	Salmonella_phage(40.43%)	61	1224829:1224843	1238474:1238488
1224829:1224843	attL	GAATTAAAAAACAAA	NA	NA	NA	NA
WP_000083342.1|1230496_1231234_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|1231218_1232841_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1233104_1233269_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1233265_1233841_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1233872_1234523_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1234522_1235479_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|1235475_1235955_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|1236452_1237682_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|1237659_1237944_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1237984_1238224_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1238266_1239424_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
1238474:1238488	attR	TTTGTTTTTTAATTC	NA	NA	NA	NA
WP_000017128.1|1239386_1242314_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1242440_1242791_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1242812_1242971_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1243427_1244090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1244089_1244476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1244468_1245308_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1245366_1245762_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1245861_1246104_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1246063_1246438_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1246529_1247414_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1247410_1248106_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1248119_1248818_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1248925_1249558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1249800_1250034_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1250150_1250399_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1250433_1251036_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096562.1|1251244_1251856_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|1251852_1251993_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1251989_1252667_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1252938_1253502_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1254008_1254197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1254411_1255098_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1255373_1255703_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1255686_1256139_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1256156_1256609_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1256844_1257246_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1257532_1258078_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1258049_1259981_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1259964_1260168_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1260164_1261745_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1261734_1263231_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1263243_1263591_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1263645_1264674_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1264731_1265091_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1265101_1265485_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1265512_1266091_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1266139_1267270_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1267378_1267780_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1267787_1268534_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1268584_1268980_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1268976_1269315_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1269286_1272382_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1272384_1272714_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1272723_1273422_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1273428_1274166_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1274063_1274711_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1274772_1278135_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1278173_1278416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1278469_1280842_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1280838_1281663_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
>prophage 4
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1745470	1754641	4898059	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1745470_1746418_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1746401_1747133_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1747113_1747221_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1747280_1748012_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1748234_1749920_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1749916_1750636_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1750682_1751150_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1751206_1751737_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1751908_1752367_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1752607_1754641_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1822732	1833239	4898059		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1822732_1824136_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1824313_1825207_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1825583_1826669_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1826668_1827568_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1827615_1828494_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1828494_1829046_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1829051_1830026_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1830041_1830815_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1830819_1831899_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1831925_1833239_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 6
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	1929767	1937018	4898059		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1929767_1930187_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1930189_1931458_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1931912_1932125_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1932135_1932324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1932581_1933778_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1934427_1934739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1934818_1935514_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1935587_1937018_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	2837022	2977677	4898059	portal,protease,holin,plate,integrase,tail,terminase,lysis,capsid,tRNA	Salmonella_phage(50.0%)	158	2837823:2837882	2879689:2879766
WP_000938182.1|2837022_2837703_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
2837823:2837882	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_000503667.1|2838414_2839062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2839104_2839302_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2839484_2839730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2839927_2840320_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2840429_2841038_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2841100_2841286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2841534_2842053_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2842067_2843600_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2843599_2844280_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|2844276_2845476_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|2845476_2845830_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2845829_2846582_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2846700_2847156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2847239_2847572_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|2847568_2848636_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|2848638_2848941_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|2848940_2849516_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|2849515_2851525_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|2851702_2852155_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|2852158_2852602_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|2852614_2853760_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|2853763_2854327_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|2854301_2854691_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|2854677_2855232_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|2855228_2855636_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|2855601_2855991_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|2856032_2856974_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|2856985_2857483_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|2857487_2858720_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|2858723_2859470_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|2859354_2860824_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|2860823_2862446_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|2862448_2863078_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|2863578_2864034_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|2864351_2864891_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|2864868_2865171_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000658037.1|2865373_2865562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2865954_2866533_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2866529_2866823_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2866819_2867416_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2867484_2867676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2867859_2868198_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|2868197_2868368_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2868364_2868967_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2868959_2869208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2869211_2869892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2869929_2871318_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2871314_2872295_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2872297_2872522_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2872544_2872991_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_023972394.1|2873396_2873852_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	4.6e-35
WP_000387662.1|2874536_2874860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2874867_2875113_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|2875142_2877407_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|2877403_2877958_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2877960_2878143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2878355_2878580_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2878580_2879600_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2880187_2880847_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2879689:2879766	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
WP_000904446.1|2880933_2881263_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2881259_2881541_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2881589_2882369_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|2882394_2882943_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|2883157_2884369_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2884426_2884744_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2884788_2885202_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2885375_2886038_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2886132_2886591_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|2886626_2888681_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|2888804_2889251_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2889269_2891423_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2891409_2892015_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2892231_2892741_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2893097_2894150_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2894221_2894674_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2894859_2896620_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2896688_2897207_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2897306_2897474_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2897729_2898293_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2898289_2899930_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2899934_2901188_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2901202_2903110_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2903122_2905231_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2905329_2906439_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001670452.1|2906435_2906978_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2907143_2908154_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2908361_2910974_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|2911400_2911592_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2911862_2912549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2912533_2912833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2912901_2913528_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|2914175_2915144_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|2915619_2916201_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2916200_2918639_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2918692_2918935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_188317969.1|2918973_2921439_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	66.6	7.5e-265
WP_045723188.1|2921354_2922323_-	host specificity protein J	NA	A0A2I6TCW5	Escherichia_phage	73.3	3.4e-128
WP_000246065.1|2922394_2923099_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2922996_2923734_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2923743_2924439_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2924528_2925062_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2925178_2925676_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2925774_2926107_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2926103_2929091_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2929170_2929500_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2929496_2929895_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2929940_2930690_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2930701_2931103_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2931099_2931666_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2931646_2931946_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2931938_2932262_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2932352_2934434_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2934357_2935905_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2935901_2936108_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2936104_2938243_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2938199_2938733_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2938940_2939420_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2939437_2939890_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2939873_2940203_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2940478_2941165_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2941525_2941975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2942110_2942236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508330.1|2942409_2942628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2942792_2943590_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2943579_2943726_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2943722_2944334_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2944542_2945145_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2945227_2945449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2945560_2945794_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2946085_2946376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2946453_2946765_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2946761_2947109_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2947119_2947869_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001574095.1|2948917_2949292_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2949257_2949497_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2949616_2950027_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2950076_2950337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2950329_2950488_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2950509_2950809_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2950935_2953821_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2953783_2954941_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2954983_2955223_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2955263_2955512_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2955556_2956849_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191406.1|2957043_2958246_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|2958326_2959760_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544853.1|2960005_2961220_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762343.1|2961536_2961998_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2962198_2963599_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977709.1|2964205_2965297_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2965481_2966672_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2966733_2967381_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2967408_2967957_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000572746.1|2970407_2974874_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060024.1|2974873_2975578_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2975558_2976881_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154027.1|2976873_2977677_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	3010007	3101875	4898059	portal,protease,plate,head,integrase,tail,terminase,lysis,capsid,tRNA	Salmonella_phage(59.32%)	98	3068664:3068680	3101950:3101966
WP_000886697.1|3010007_3011300_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|3011558_3012902_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|3012911_3013523_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001670447.1|3013665_3017748_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|3017882_3018377_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|3018922_3019891_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_001044546.1|3020004_3021771_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.8	3.9e-21
WP_001202252.1|3021771_3023493_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
WP_001241649.1|3023537_3024242_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|3024242_3024626_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|3024553_3024772_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|3024862_3025774_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|3025882_3026743_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|3026762_3027440_+	hydrolase	NA	NA	NA	NA	NA
WP_001670446.1|3028028_3028406_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|3028567_3028765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3028978_3031255_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3031285_3031606_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3031929_3032151_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3032280_3034227_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|3034223_3035342_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
WP_000192846.1|3035487_3036438_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|3036434_3038093_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491119.1|3038294_3039194_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458785.1|3039337_3040990_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001670445.1|3041001_3041970_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815313.1|3042127_3043846_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
WP_000566421.1|3043884_3044886_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000079015.1|3044896_3046330_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866904.1|3046425_3047439_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000645850.1|3047435_3048266_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|3048262_3048586_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270724.1|3048713_3049229_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|3049458_3050187_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
WP_000756586.1|3050204_3050936_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001677.1|3050942_3051659_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000895396.1|3051658_3052327_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_000737538.1|3052563_3053295_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000644030.1|3053512_3055000_-	sulfatase	NA	NA	NA	NA	NA
WP_000655399.1|3055009_3055330_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000399323.1|3055359_3056703_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001149788.1|3056985_3058116_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	1.2e-23
WP_000505788.1|3058158_3058632_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061629.1|3058705_3059551_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105453.1|3059547_3060501_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001000698.1|3060510_3061644_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
WP_000125764.1|3061731_3062844_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000624810.1|3063192_3063669_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684361.1|3063764_3064667_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
WP_000075300.1|3064724_3065447_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001259137.1|3065430_3065721_-	YbjC family protein	NA	NA	NA	NA	NA
WP_000495513.1|3065890_3066154_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
WP_000680850.1|3066185_3066563_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024853.1|3066833_3068519_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3068664:3068680	attL	ATGGGTTTTTTGTTGCC	NA	NA	NA	NA
WP_000972391.1|3068754_3068973_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|3069063_3070164_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000980413.1|3070160_3070646_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_058655992.1|3070642_3073720_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_000763311.1|3073712_3073832_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3073846_3074149_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001504081.1|3074203_3074719_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046120.1|3074728_3075901_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_058655991.1|3076043_3076610_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.9e-86
WP_001340317.1|3077116_3077350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3077330_3077741_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001086833.1|3079257_3079863_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_001552638.1|3079855_3080764_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_000177581.1|3080750_3081110_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	2.8e-51
WP_001552634.1|3081106_3081685_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.1e-94
WP_047340712.1|3081753_3082200_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	1.3e-61
WP_001039926.1|3082192_3082624_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.9e-71
WP_001080918.1|3082719_3083148_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_058655989.1|3083144_3083522_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001069905.1|3083523_3084036_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3084016_3084232_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3084235_3084439_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3084438_3084903_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3084998_3085649_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|3085652_3086711_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|3086727_3087561_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_058655988.1|3087703_3089470_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_040075594.1|3089469_3090501_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	3.8e-170
WP_149866257.1|3090552_3090867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065344884.1|3090884_3091298_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	39.1	2.0e-05
WP_040075599.1|3091299_3092118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3092445_3092679_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3092689_3092878_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_058655987.1|3093031_3095446_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_001544405.1|3095442_3096300_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3096296_3096524_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3096523_3096757_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3096824_3097166_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3097283_3097580_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3097587_3098097_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3098129_3098351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058655986.1|3098446_3099043_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	1.2e-40
WP_058655985.1|3099063_3100740_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	1.7e-82
WP_058655984.1|3100822_3101875_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	2.7e-107
3101950:3101966	attR	ATGGGTTTTTTGTTGCC	NA	NA	NA	NA
>prophage 9
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	3193115	3229934	4898059	portal,protease,holin,head,integrase,tail,terminase,lysis	Salmonella_phage(45.61%)	58	3192823:3192847	3230000:3230024
3192823:3192847	attL	CGTTCAACTTAGTATAAAAAAGCAG	NA	NA	NA	NA
WP_024143557.1|3193115_3194972_-|tail	tail protein	tail	S4TVJ1	Salmonella_phage	90.1	2.3e-274
WP_001029850.1|3195256_3197248_-	hypothetical protein	NA	A0A1R3Y5Q1	Salmonella_virus	96.6	0.0e+00
WP_000246943.1|3197247_3198543_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.0	2.1e-181
WP_000964873.1|3198552_3199245_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_000627705.1|3199247_3199703_-	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	98.7	4.4e-86
WP_000774929.1|3199702_3200404_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	92.3	4.7e-71
WP_001122372.1|3200407_3201826_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.9e-274
WP_001140510.1|3201835_3202297_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|3202277_3202466_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013269.1|3202507_3203761_-	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	98.3	1.0e-233
WP_000372591.1|3203779_3204673_-	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	84.2	2.6e-114
WP_001535486.1|3204763_3206962_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_000200777.1|3206963_3208379_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.2	3.2e-276
WP_000190002.1|3208375_3208798_-	hypothetical protein	NA	Q716H4	Shigella_phage	99.3	3.6e-74
WP_000542583.1|3208821_3209001_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	2.1e-23
WP_000807823.1|3209002_3209245_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	98.8	8.3e-36
WP_000191867.1|3209540_3210068_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.6	3.3e-45
WP_001670813.1|3210146_3210584_-|lysis	lysis protein	lysis	A0A2I6PIF7	Escherichia_phage	97.9	6.5e-71
WP_001670814.1|3210672_3211170_-	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	100.0	9.9e-92
WP_000286100.1|3211147_3211351_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000512805.1|3211814_3212333_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	2.2e-94
WP_001028837.1|3212323_3212995_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	2.0e-127
WP_001224087.1|3212991_3213600_-	recombination protein NinG	NA	I6S604	Salmonella_phage	95.0	2.9e-93
WP_000566850.1|3213574_3213754_-	protein ninF	NA	I6R994	Salmonella_phage	94.9	1.1e-27
WP_000113769.1|3213750_3213927_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	100.0	3.0e-27
WP_000679702.1|3213893_3214067_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736889.1|3214063_3214501_-	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	98.6	9.4e-78
WP_000344577.1|3214725_3214977_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	65.5	2.9e-23
WP_000049638.1|3214988_3215189_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000796285.1|3215185_3215512_-	hypothetical protein	NA	Q716D0	Shigella_phage	99.1	4.2e-59
WP_001036029.1|3215584_3215854_-	hypothetical protein	NA	G9L682	Escherichia_phage	98.9	1.9e-44
WP_000145948.1|3215850_3216141_-	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000171135.1|3216137_3216983_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	73.6	2.1e-110
WP_000050079.1|3216985_3217828_-	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	1.0e-128
WP_000220588.1|3217814_3218459_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001177653.1|3218493_3218772_-	lambda phage CII family protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000620665.1|3218880_3219075_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|3219181_3219898_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233126.1|3219916_3220285_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_000219336.1|3220652_3220958_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.8	1.3e-25
WP_000915090.1|3220966_3221104_+	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_000246166.1|3221228_3221423_+	Restriction inhibitor protein ral	NA	A0A2H4FS18	Salmonella_phage	100.0	2.5e-30
WP_071825053.1|3221506_3222490_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	82.6	8.3e-74
WP_001670815.1|3222684_3222858_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_000156731.1|3222838_3223027_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3223016_3223160_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_001046987.1|3223156_3223864_+	recombinase	NA	B8K1D9	Salmonella_phage	96.2	6.7e-134
WP_000168278.1|3223864_3224323_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
WP_001016182.1|3224819_3225368_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_001111323.1|3225383_3225677_+	DUF2856 family protein	NA	A0A1V0E5L7	Salmonella_phage	100.0	5.5e-50
WP_001214773.1|3225687_3225861_+	DUF2737 family protein	NA	A0A2H4FUQ1	Salmonella_phage	96.5	2.1e-25
WP_020924094.1|3225872_3226397_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	64.8	1.6e-39
WP_000065091.1|3226393_3226990_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	55.2	8.7e-42
WP_000161224.1|3226991_3227210_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000208026.1|3227213_3227447_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	91.1	6.0e-15
WP_001060559.1|3227516_3228491_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	44.0	5.2e-28
WP_001556007.1|3228667_3228886_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533680.1|3228863_3229934_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	99.6	3.0e-154
3230000:3230024	attR	CGTTCAACTTAGTATAAAAAAGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	4457490	4502266	4898059	tail,tRNA,plate,holin	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4457490_4458489_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4458576_4459887_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4460133_4460649_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4460748_4460958_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4460979_4461093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4461089_4462415_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4462593_4463202_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4463310_4463679_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4463849_4466270_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4466368_4467241_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4467254_4467752_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4467932_4468850_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4469013_4470372_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4470460_4471570_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4471931_4473122_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|4473253_4474798_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4474812_4475703_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4475868_4476279_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|4476421_4478518_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4478517_4479255_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4479251_4479920_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4479953_4480196_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|4480639_4482289_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4482633_4483983_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4484113_4484461_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4485038_4485326_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4485328_4485934_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4485946_4486261_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4486420_4486876_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4486872_4487070_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4487059_4488487_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|4488486_4489011_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4489062_4489380_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|4489339_4489468_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|4489564_4491919_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|4491918_4492872_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4492871_4493081_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|4493068_4494112_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|4494121_4494844_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000593184.1|4495167_4495530_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4495526_4496456_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|4496455_4498003_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|4498166_4498526_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|4498516_4499632_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|4499624_4500257_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|4500259_4501741_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|4501750_4502266_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 11
NZ_CP016012	Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 chromosome, complete genome	4898059	4621032	4686813	4898059	portal,protease,plate,head,integrase,tail,terminase,lysis,capsid	Salmonella_phage(40.91%)	77	4650888:4650934	4681867:4681913
WP_000208240.1|4621032_4621563_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4621572_4622904_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4622970_4623900_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4623992_4624478_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4624699_4624939_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4625337_4626183_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4626203_4627712_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4627823_4628834_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|4628930_4629677_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|4629782_4630211_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|4630311_4630908_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4631020_4631788_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|4631879_4632644_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4632653_4632944_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4633026_4633902_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4633930_4634953_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4634981_4635983_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4635979_4637023_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4637016_4638552_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4638807_4639767_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4639853_4641446_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4641459_4641810_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001519915.1|4642308_4643031_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|4643093_4644134_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4644143_4645103_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|4645113_4646448_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|4646710_4647466_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4647566_4648556_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4648759_4649722_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4649906_4650809_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4650888:4650934	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|4651095_4651512_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|4651546_4651765_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|4651842_4653012_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|4653008_4653494_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|4653505_4655947_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|4655939_4656095_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4656091_4656427_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|4656489_4657008_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|4657023_4658211_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|4658345_4658915_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|4658914_4660657_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|4660667_4661198_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|4661190_4662099_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|4662105_4662453_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|4662449_4663091_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|4663167_4664544_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|4664548_4665016_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|4665008_4665476_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_000849743.1|4665583_4665997_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|4665993_4666503_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|4666486_4666708_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|4666698_4666902_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|4666901_4667402_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|4667499_4668258_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|4668261_4669422_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|4669453_4670317_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|4670481_4672251_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|4672250_4673288_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|4673808_4674000_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|4673998_4674430_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|4674563_4675604_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|4675600_4675798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|4675976_4678253_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|4678242_4678518_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|4678514_4678739_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|4679040_4679265_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|4679328_4679829_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|4679998_4680271_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|4680407_4680701_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|4680770_4681751_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_020924309.1|4681935_4682436_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4681867:4681913	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4682586_4683285_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4683281_4684655_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|4684702_4684906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|4685026_4685422_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559230.1|4685433_4686123_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4686192_4686813_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
