The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	1120146	1194722	4833991	lysis,integrase,protease,tail,holin,capsid,terminase,portal,plate,transposase,head	Salmonella_phage(57.95%)	96	1161158:1161203	1194792:1194837
WP_000537359.1|1120146_1121322_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.4	1.4e-147
WP_001061331.1|1121527_1122097_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.3	3.7e-90
WP_000210516.1|1122098_1122539_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	40.3	3.1e-12
WP_000840609.1|1122542_1123016_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	1.1e-66
WP_000125081.1|1123015_1123330_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	85.0	3.4e-21
WP_001253786.1|1123326_1123503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120457.1|1123490_1124030_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	81.0	9.5e-80
WP_070810427.1|1124158_1124986_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	94.2	8.4e-144
WP_070810426.1|1125042_1125414_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	85.4	3.6e-54
WP_072600479.1|1126442_1127135_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	70.9	3.2e-88
WP_072600482.1|1127232_1127478_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	54.3	1.0e-17
WP_045445262.1|1127488_1128040_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	7.0e-46
WP_003034732.1|1128212_1128392_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_072600484.1|1128381_1129239_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	96.6	2.0e-60
WP_072600486.1|1129235_1130555_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.5	8.7e-119
WP_003034741.1|1130551_1130938_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
WP_072600488.1|1130951_1131665_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	53.7	1.1e-56
WP_000609697.1|1132647_1133217_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	54.4	1.5e-46
WP_000417508.1|1133407_1133983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076937917.1|1134169_1134610_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	4.3e-14
WP_001283171.1|1134771_1135158_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	93.0	1.0e-56
WP_000250463.1|1135144_1135426_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.0	3.1e-18
WP_072600490.1|1135425_1136040_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	5.5e-92
WP_000522146.1|1136047_1136317_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	69.0	2.2e-21
WP_001100261.1|1136457_1136688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120194.1|1136779_1137094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761930.1|1137603_1137930_+	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	80.0	2.9e-07
WP_001670093.1|1138113_1138602_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	90.7	6.3e-75
WP_001118990.1|1138601_1140704_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.6	0.0e+00
WP_001082414.1|1140700_1140916_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_000054308.1|1140912_1142421_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.7	4.2e-258
WP_001125851.1|1142365_1144390_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.7	0.0e+00
WP_001097009.1|1144481_1144808_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.2	2.4e-30
WP_000933904.1|1144800_1145076_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	61.5	2.6e-25
WP_000023109.1|1145088_1145643_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	76.7	2.4e-62
WP_000797819.1|1145639_1146038_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.0	6.8e-43
WP_000211139.1|1146045_1146783_+	Ig-like domain-containing protein	NA	O64327	Escherichia_phage	66.9	3.6e-90
WP_000479023.1|1146819_1147227_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	3.8e-25
WP_071529728.1|1147235_1147556_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.1e-34
WP_000079422.1|1147533_1150050_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.2	1.0e-309
WP_000963482.1|1150053_1150401_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	69.6	1.0e-39
WP_000056207.1|1150397_1151153_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	85.3	1.8e-129
WP_001249174.1|1151154_1151865_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	90.7	1.1e-136
WP_000709674.1|1151894_1152236_+	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	92.9	5.6e-54
WP_000659016.1|1152279_1152885_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	97.0	1.4e-100
WP_001162257.1|1152938_1156142_+	host specificity protein J	NA	O64335	Escherichia_phage	88.7	0.0e+00
WP_001113924.1|1156143_1157103_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	94.4	2.1e-175
WP_001272641.1|1157113_1158295_+	hypothetical protein	NA	S4TSP4	Salmonella_phage	68.9	1.2e-55
WP_000497432.1|1158518_1158761_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_072600492.1|1159081_1159471_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	1.1e-50
WP_072600494.1|1159658_1160864_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
1161158:1161203	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1161320_1162346_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000052559.1|1162349_1162982_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.1e-66
WP_000102104.1|1163098_1163338_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000460862.1|1163373_1163883_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000957775.1|1163890_1164124_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1164071_1164530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1164749_1165091_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1165158_1165392_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_072600496.1|1165391_1165619_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	8.6e-35
WP_000104122.1|1165615_1166473_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.7	9.3e-130
WP_072600498.1|1166463_1168893_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.5	0.0e+00
WP_001154433.1|1169045_1169234_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1169244_1169478_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_023134870.1|1169591_1170269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078040414.1|1170690_1171173_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072600503.1|1171162_1172140_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	33.2	5.4e-25
WP_072600505.1|1172166_1173192_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.8	9.0e-180
WP_072600507.1|1173191_1174958_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_001655635.1|1175100_1175934_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_072600509.1|1175950_1177015_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.5	2.5e-193
WP_023260028.1|1177018_1177672_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.2	1.0e-112
WP_072600511.1|1177765_1178230_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	95.5	8.7e-82
WP_000868184.1|1178229_1178433_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1178436_1178652_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_078040417.1|1178632_1179142_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	5.4e-93
WP_072600513.1|1179146_1179524_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.0	2.6e-60
WP_179127319.1|1179520_1179949_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	1.5e-64
WP_072600517.1|1180044_1180476_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	94.4	9.9e-72
WP_063314686.1|1180468_1180915_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.0	1.2e-64
WP_072600520.1|1180983_1181562_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.2e-106
WP_000177404.1|1181558_1181918_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	95.8	9.8e-57
WP_072600522.1|1181904_1182813_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.3	8.5e-158
WP_001086807.1|1182805_1183411_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_072600524.1|1183407_1185213_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	74.8	1.1e-217
WP_072600526.1|1185212_1185788_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	96.3	1.7e-103
WP_015406347.1|1186667_1186892_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	97.3	1.2e-33
WP_000046105.1|1186994_1188167_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.0	4.1e-221
WP_001207654.1|1188176_1188692_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	1.0e-91
WP_001280962.1|1188746_1189049_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763317.1|1189063_1189183_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001282763.1|1189175_1191983_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.4	0.0e+00
WP_000980407.1|1191979_1192465_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
WP_001010541.1|1192461_1193562_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	96.7	7.9e-190
WP_000972388.1|1193628_1193847_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
WP_001668082.1|1194131_1194722_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	75.9	4.4e-46
1194792:1194837	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
>prophage 2
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	1723775	1732946	4833991	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|1723775_1724723_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1724706_1725438_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1725418_1725526_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1725585_1726317_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1726539_1728225_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1728221_1728941_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1728987_1729455_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265355.1|1729511_1730042_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1730213_1730672_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1730912_1732946_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	1807444	1817951	4833991		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111836.1|1807444_1808848_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1809025_1809919_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1810295_1811381_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1811380_1812280_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1812327_1813206_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1813206_1813758_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1813763_1814738_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1814753_1815527_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1815531_1816611_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_072600582.1|1816637_1817951_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	1911093	1958567	4833991	lysis,integrase,protease,tail,holin,capsid,terminase,portal,plate,head	Salmonella_phage(77.97%)	63	1912339:1912354	1923870:1923885
WP_001219023.1|1911093_1911618_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
1912339:1912354	attL	ATCAGCCTGTTTTTTG	NA	NA	NA	NA
WP_000598921.1|1912927_1913725_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1914016_1915006_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1915007_1915235_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1915274_1915844_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208069.1|1915847_1916681_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	99.6	4.0e-162
WP_000224241.1|1916691_1916949_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1916950_1917484_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008353.1|1917554_1918094_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	1.3e-97
WP_000080416.1|1918230_1919058_-	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1919115_1919487_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1920026_1920251_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1920213_1920552_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1920757_1921453_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1921550_1921775_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1921803_1922358_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001087404.1|1922354_1923497_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1923493_1923718_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_072600588.1|1923714_1924689_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	99.4	2.6e-168
1923870:1923885	attR	CAAAAAACAGGCTGAT	NA	NA	NA	NA
WP_000054228.1|1924685_1925159_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_000200164.1|1925155_1926037_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	100.0	1.3e-171
WP_000779148.1|1926045_1926435_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061460.1|1926451_1927312_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.0	2.1e-161
WP_001202280.1|1927319_1928309_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	5.4e-190
WP_000609695.1|1928323_1928596_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	76.3	2.1e-27
WP_001668823.1|1928592_1929429_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.8	6.5e-128
WP_001668825.1|1931063_1931408_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	98.8	3.4e-43
WP_001005904.1|1931410_1932025_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	97.1	8.2e-112
WP_077906432.1|1932057_1932501_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	5.4e-57
WP_000268746.1|1932985_1933309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023891432.1|1933404_1933749_+	HNH endonuclease	NA	K7P6U5	Enterobacteria_phage	73.0	7.4e-46
WP_000919034.1|1933881_1934346_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_000229716.1|1934299_1936042_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_000002707.1|1936041_1937346_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_000039021.1|1937359_1938208_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	4.4e-132
WP_000005722.1|1938217_1939435_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.4	1.4e-195
WP_072600590.1|1939478_1939730_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.8e-10
WP_000901160.1|1939729_1940053_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	56.5	8.3e-31
WP_001255650.1|1940064_1940478_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	3.5e-50
WP_001179802.1|1940449_1940962_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	86.5	3.1e-80
WP_001241332.1|1940958_1941504_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_000497755.1|1941525_1941690_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001007988.1|1941679_1943176_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	99.2	1.2e-276
WP_000515953.1|1943175_1943532_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1943528_1943855_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1943939_1945865_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1945881_1946331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000863828.1|1946390_1947731_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	4.4e-251
WP_001066632.1|1947727_1948786_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1948785_1949319_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1949323_1949737_+	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1949729_1950809_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1950811_1951399_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1951385_1952948_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1952917_1953523_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1953636_1953870_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1953944_1954058_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1954105_1954519_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1954515_1954728_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_001532308.1|1955921_1956083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1956209_1956629_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457666.1|1956631_1957900_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000187976.1|1958354_1958567_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	5.1e-21
>prophage 5
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	2870026	2946361	4833991	lysis,protease,tail,capsid,holin,plate	Salmonella_phage(78.95%)	86	NA	NA
WP_000938188.1|2870026_2870707_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2871345_2872005_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2872091_2872421_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2872417_2872699_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548081.1|2872747_2873527_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2873552_2874101_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2874315_2875527_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2875584_2875902_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2875946_2876360_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847736.1|2876533_2877196_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2877290_2877749_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2877784_2879839_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2879962_2880409_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950881.1|2880427_2882581_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2882567_2883173_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2883389_2883899_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2884255_2885308_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2885379_2885832_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156459.1|2886017_2887778_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2887846_2888365_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2888464_2888632_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2888887_2889451_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2889447_2891088_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2891092_2892346_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053051.1|2892360_2894268_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
WP_001086485.1|2894280_2896389_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224076.1|2896487_2897597_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2897593_2898136_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291725.1|2898301_2899312_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193785.1|2899519_2902132_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2902558_2902750_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2903020_2903707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2904066_2904693_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001669084.1|2905340_2906309_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	8.7e-193
WP_065304850.1|2906427_2906562_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_023261776.1|2907429_2907948_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	1.9e-45
WP_023261522.1|2907962_2909624_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	57.8	7.3e-131
WP_000049935.1|2909623_2910304_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.2	1.4e-128
WP_001197094.1|2910300_2911500_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.7	2.2e-214
WP_001270643.1|2911500_2911854_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	2.1e-59
WP_000301076.1|2911853_2912606_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	71.7	1.2e-93
WP_024156220.1|2912669_2913395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081751.1|2913397_2914462_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	85.9	8.8e-162
WP_000155111.1|2914464_2914767_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|2914766_2915342_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990863.1|2915341_2917351_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	98.5	0.0e+00
WP_001669124.1|2917528_2917981_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	81.3	3.2e-65
WP_000535993.1|2917984_2918428_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	6.0e-56
WP_023261524.1|2918440_2919586_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	2.0e-164
WP_023261525.1|2919589_2920153_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	4.7e-82
WP_001142474.1|2920127_2920517_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	97.7	6.0e-68
WP_000008736.1|2920503_2921058_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.8e-94
WP_001125673.1|2921054_2921462_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	100.0	3.8e-73
WP_001040702.1|2921427_2921796_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|2921837_2922779_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128058.1|2922790_2923288_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	100.0	3.0e-88
WP_000873180.1|2923292_2924525_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	97.6	2.0e-226
WP_077905805.1|2924539_2925277_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	99.0	6.4e-111
WP_000113508.1|2925164_2926631_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.6	1.2e-281
WP_001130809.1|2926630_2928253_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.3	0.0e+00
WP_001118125.1|2928255_2928885_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	99.5	9.3e-111
WP_000381863.1|2928954_2929218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050821.1|2929417_2929903_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	88.2	4.2e-71
WP_001005894.1|2929899_2930526_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.7	7.1e-95
WP_162264800.1|2930528_2930870_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_000993184.1|2931070_2931760_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	51.9	2.4e-59
WP_000801757.1|2931756_2931897_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096547.1|2931893_2932505_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_000929790.1|2932713_2933316_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001217670.1|2933649_2933889_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000208070.1|2934408_2935218_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_000151011.1|2935214_2935667_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	100.0	3.8e-74
WP_000065341.1|2935663_2936065_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000113621.1|2936061_2936409_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000800012.1|2936419_2937169_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001669125.1|2937171_2938155_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	7.3e-163
WP_001538023.1|2938239_2938614_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	100.0	3.0e-64
WP_000869364.1|2938579_2938816_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009038.1|2938945_2939350_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000917564.1|2939748_2939907_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001669126.1|2939928_2940279_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	100.0	7.5e-62
WP_000017138.1|2940405_2943333_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	100.0	0.0e+00
WP_001539618.1|2943295_2944453_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2944495_2944735_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2944775_2945024_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2945068_2946361_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
>prophage 6
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	3017576	3024889	4833991	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001531374.1|3017576_3017954_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
WP_001117984.1|3018115_3018313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3018525_3020802_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3020832_3021153_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3021476_3021698_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3021827_3023774_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201753.1|3023770_3024889_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 7
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	4383248	4428023	4833991	tail,tRNA,plate,holin	Burkholderia_phage(36.36%)	47	NA	NA
WP_001182219.1|4383248_4384247_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4384334_4385645_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4385891_4386407_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4386506_4386716_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4386737_4386851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128118.1|4386847_4388173_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4388351_4388960_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4389068_4389437_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4389607_4392028_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4392126_4392999_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019231.1|4393012_4393510_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4393690_4394608_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973642.1|4394771_4396130_-	maltoporin	NA	NA	NA	NA	NA
WP_072600747.1|4396218_4397328_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4397688_4398879_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4399010_4400555_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4400569_4401460_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4401625_4402036_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4402178_4404275_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4404274_4405012_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_123220402.1|4405008_4405677_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4405710_4405953_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790042.1|4406396_4408046_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4408390_4409740_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4409870_4410218_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4410794_4411082_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_001203711.1|4411084_4411690_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	9.3e-60
WP_000777266.1|4411702_4412017_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449399.1|4412176_4412632_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4412628_4412826_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729853.1|4412815_4414243_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.4e-194
WP_000907494.1|4414242_4414767_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003635.1|4414818_4415136_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4415095_4415224_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262492.1|4415320_4417672_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	3.4e-65
WP_000271425.1|4417671_4418625_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4418624_4418834_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818150.1|4418821_4419865_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	3.8e-77
WP_000679389.1|4419874_4420597_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4420924_4421287_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703628.1|4421283_4422213_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095009.1|4422212_4423760_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
WP_001093501.1|4423923_4424283_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_072600750.1|4424273_4425389_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	6.9e-101
WP_000359500.1|4425381_4426014_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368203.1|4426016_4427498_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4427507_4428023_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
>prophage 8
NZ_CP016010	Salmonella enterica subsp. enterica serovar Newport strain CFSAN001660 chromosome, complete genome	4833991	4546676	4611182	4833991	lysis,integrase,protease,tail,holin,capsid,terminase,portal,plate,head	Salmonella_phage(46.51%)	75	4576539:4576585	4606557:4606603
WP_000208240.1|4546676_4547207_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4547216_4548548_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|4548614_4549544_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4549636_4550122_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4550343_4550583_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4550981_4551827_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4551847_4553356_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4553467_4554478_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4554574_4555321_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|4555427_4555856_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802241.1|4555956_4556553_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216335.1|4556665_4557433_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4557524_4558289_-	epimerase	NA	NA	NA	NA	NA
WP_001667977.1|4558298_4558589_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|4558671_4559547_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090742.1|4559575_4560598_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981831.1|4560626_4561628_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|4561624_4562668_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4562661_4564197_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4564452_4565412_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113083.1|4565498_4567091_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|4567104_4567455_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000060999.1|4567691_4567862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001533426.1|4567959_4568682_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557882.1|4568744_4569785_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646502.1|4569794_4570754_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777314.1|4570764_4572099_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750756.1|4572361_4573117_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758710.1|4573217_4574207_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4574410_4575373_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4575557_4576460_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4576539:4576585	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468356.1|4576746_4577154_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_000468311.1|4577204_4577423_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_001526245.1|4577500_4578670_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	96.9	2.3e-208
WP_070811924.1|4578666_4579152_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	98.8	2.6e-84
WP_072600759.1|4579164_4581606_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	98.5	0.0e+00
WP_085984508.1|4581598_4581754_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|4581750_4582086_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|4582147_4582666_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001279030.1|4582681_4583869_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_072600761.1|4584003_4584573_-|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	98.4	4.4e-104
WP_072600763.1|4584572_4586315_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	98.6	1.4e-270
WP_072600765.1|4586325_4586856_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	1.6e-103
WP_024157126.1|4586848_4587757_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	98.7	2.0e-159
WP_072600768.1|4587763_4588111_-	GPW/gp25 family protein	NA	O80315	Escherichia_phage	95.7	1.5e-54
WP_072600770.1|4588107_4588749_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	3.2e-111
WP_072600773.1|4588817_4589267_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	1.9e-70
WP_072600775.1|4589259_4589727_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	98.7	4.6e-83
WP_072105331.1|4589689_4589863_-|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	1.8e-24
WP_072600777.1|4589834_4590248_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.8	3.7e-44
WP_072600779.1|4590244_4590742_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	97.6	8.4e-91
WP_000134660.1|4590728_4591025_-|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_000868400.1|4591028_4591232_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_023172566.1|4591231_4591738_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	98.2	9.5e-90
WP_052894587.1|4591831_4592581_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	86.7	2.2e-111
WP_052894588.1|4592584_4593652_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	3.0e-178
WP_001085936.1|4593727_4594582_-|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
WP_072600781.1|4594747_4596517_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.7	0.0e+00
WP_000517958.1|4596516_4597563_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_001526224.1|4597942_4600426_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001526225.1|4600664_4602944_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.7	0.0e+00
WP_000027667.1|4602933_4603209_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|4603205_4603430_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001526254.1|4603429_4603732_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_000557703.1|4603731_4603956_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4604019_4604520_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000453532.1|4604689_4604962_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_001017512.1|4605097_4605391_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_001526255.1|4605460_4606441_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	97.9	2.4e-182
WP_001233463.1|4606625_4607126_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4606557:4606603	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4607276_4607975_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4607971_4609345_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133449.1|4609395_4609791_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559216.1|4609802_4610492_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4610561_4611182_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
