The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	652127	662018	4117900		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|652127_653420_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_052827141.1|653495_654215_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	2.0e-48
WP_003155758.1|654214_654469_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_072588863.1|654465_655149_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_033574955.1|655132_657361_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	9.4e-158
WP_007609856.1|657336_658767_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_015239317.1|658858_659899_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007408902.1|659895_660483_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_025284372.1|660479_662018_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 2
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	1124406	1158010	4117900	tRNA,coat,protease	Planktothrix_phage(16.67%)	38	NA	NA
WP_014304785.1|1124406_1125399_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025284554.1|1126142_1127777_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015239567.1|1127883_1128819_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|1128822_1129740_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1129752_1130829_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_012117283.1|1130821_1131739_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_059367234.1|1131845_1133033_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|1133150_1133729_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1133907_1134303_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007409109.1|1134360_1135017_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155032.1|1135292_1135949_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_072588980.1|1136099_1137260_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_094031915.1|1137487_1139317_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1139354_1139522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155024.1|1139807_1140710_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_003155023.1|1140706_1141105_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_007409105.1|1141333_1142020_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_007409104.1|1142024_1142597_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|1142721_1143087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610625.1|1143114_1143750_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1143767_1144568_+	NAD kinase	NA	NA	NA	NA	NA
WP_072588981.1|1144582_1145476_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
WP_072588982.1|1145509_1146259_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	7.6e-11
WP_007610641.1|1146487_1148332_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_015417218.1|1148581_1149289_+	thiaminase II	NA	NA	NA	NA	NA
WP_012117296.1|1149266_1149884_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_072588984.1|1149867_1150977_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|1150973_1151177_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_094031644.1|1151173_1151944_+	thiazole synthase	NA	NA	NA	NA	NA
WP_012117298.1|1151940_1152951_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_015417222.1|1152973_1153786_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1153916_1154693_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_172424049.1|1154784_1155399_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1155456_1155900_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|1156045_1156528_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239583.1|1156678_1157179_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239584.1|1157271_1157586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588985.1|1157623_1158010_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	1229631	1261698	4117900	holin,capsid,portal,plate,tail,terminase	Bacillus_phage(29.03%)	43	NA	NA
WP_087920760.1|1229631_1230768_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1230757_1230892_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_015417280.1|1231034_1231988_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1232025_1232403_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015239671.1|1232513_1233119_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
WP_007610775.1|1233257_1233848_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1233996_1234335_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007407285.1|1234525_1234705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284603.1|1234694_1235522_+	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_014417520.1|1235421_1236222_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_003154863.1|1236221_1236389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407281.1|1236486_1236828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407280.1|1236817_1237021_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_007407279.1|1237134_1237647_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_025284604.1|1237759_1238557_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.0	3.0e-58
WP_025284605.1|1238553_1239852_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_094031916.1|1239900_1241292_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	3.0e-138
WP_015239679.1|1241311_1242157_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	58.1	5.7e-55
WP_007407274.1|1242183_1243119_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015239680.1|1243135_1243519_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_020955684.1|1243515_1243872_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_020955685.1|1243868_1244372_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	40.4	1.6e-36
WP_007407270.1|1244368_1244815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407269.1|1244811_1245021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039062945.1|1245020_1246418_+|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	2.6e-81
WP_003154837.1|1246419_1246863_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1246939_1247386_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1247427_1247580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589002.1|1247567_1252856_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	3.5e-41
WP_072589003.1|1252848_1253508_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_015239687.1|1253521_1254499_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	3.7e-34
WP_007407264.1|1254498_1254765_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	1.3e-05
WP_020955689.1|1254868_1255294_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
WP_039062947.1|1255286_1256333_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	1.1e-68
WP_039062948.1|1256316_1256895_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
WP_003154822.1|1256891_1257164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239691.1|1257166_1258756_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	54.1	2.4e-14
WP_051483351.1|1258768_1259194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012117366.1|1259198_1259396_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
WP_072589004.1|1259452_1260214_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|1260265_1260529_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1260542_1260806_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1260819_1261698_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 4
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	1857701	1863914	4117900		Bacillus_phage(50.0%)	6	NA	NA
WP_003154061.1|1857701_1858094_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007611605.1|1858053_1860156_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|1860173_1861163_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_012117609.1|1861211_1861832_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_072589117.1|1861880_1862639_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.8e-52
WP_015417523.1|1862945_1863914_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 5
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	2203381	2216492	4117900		Bacillus_phage(86.67%)	24	NA	NA
WP_072589192.1|2203381_2203936_-	hypothetical protein	NA	O64195	Bacillus_phage	92.7	2.5e-91
WP_014470254.1|2204033_2204273_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_072589193.1|2204262_2204454_-	hypothetical protein	NA	O64193	Bacillus_phage	73.2	9.9e-16
WP_072589194.1|2204491_2204932_-	macro domain-containing protein	NA	A0A0H3V0V8	Geobacillus_virus	53.7	9.5e-38
WP_072589195.1|2204935_2205613_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_068947650.1|2205701_2206037_-	hypothetical protein	NA	F8WPK8	Bacillus_phage	67.0	9.1e-41
WP_072589196.1|2206063_2206285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589197.1|2206656_2206869_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	98.6	1.6e-30
WP_072589198.1|2207292_2207634_-	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	71.2	1.3e-21
WP_072589199.1|2207719_2208079_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	48.8	7.8e-22
WP_072589200.1|2208075_2208459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589201.1|2208470_2208797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589202.1|2208943_2209474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589203.1|2209525_2209891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589204.1|2210019_2210526_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	36.2	1.3e-19
WP_072589205.1|2210525_2211365_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	90.0	1.9e-151
WP_080491666.1|2211435_2212044_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_072589207.1|2212497_2212797_-	hypothetical protein	NA	O64180	Bacillus_phage	54.3	1.1e-18
WP_072589208.1|2212956_2213355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162992616.1|2213509_2213674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589209.1|2213783_2214212_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	1.8e-73
WP_072589210.1|2214455_2214692_-	glutaredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	79.7	1.1e-27
WP_072589211.1|2214692_2215412_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	44.7	1.2e-48
WP_072589213.1|2215970_2216492_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	92.5	5.7e-90
>prophage 6
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	2220134	2271017	4117900	integrase	Bacillus_phage(95.08%)	89	2258788:2258810	2274420:2274442
WP_072589216.1|2220134_2220530_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	83.2	8.2e-57
WP_072589217.1|2220526_2220877_-	hypothetical protein	NA	O64171	Bacillus_phage	45.0	9.3e-20
WP_154066726.1|2220895_2221045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589218.1|2221079_2221412_-	hypothetical protein	NA	O64168	Bacillus_phage	83.7	1.2e-13
WP_080491678.1|2221425_2221653_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	81.2	5.4e-29
WP_150123254.1|2221687_2221906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589219.1|2222015_2222333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589822.1|2222378_2222684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589220.1|2222729_2223077_-	hypothetical protein	NA	O64164	Bacillus_phage	94.8	2.6e-54
WP_072589221.1|2223091_2223499_-	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	63.4	2.8e-36
WP_072589223.1|2223987_2224458_-	hypothetical protein	NA	O64162	Bacillus_phage	86.5	4.7e-75
WP_072589224.1|2224535_2225087_-	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	60.1	2.0e-56
WP_069007289.1|2225644_2226403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589226.1|2226589_2226787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589227.1|2226801_2227029_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	78.7	7.8e-28
WP_072589228.1|2227066_2227282_-	hypothetical protein	NA	O64155	Bacillus_phage	57.4	1.4e-13
WP_072589229.1|2227425_2227773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589230.1|2227835_2228354_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	89.5	2.8e-89
WP_072589231.1|2228362_2228860_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	79.9	4.3e-71
WP_165882056.1|2228856_2229015_-	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	64.7	3.2e-12
WP_014417936.1|2229019_2229223_-	YorP family protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
WP_072589232.1|2229234_2229942_-	3D domain-containing protein	NA	A0A1P8CX16	Bacillus_phage	36.7	5.7e-24
WP_072589233.1|2229968_2233898_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.6	0.0e+00
WP_072589234.1|2233910_2235638_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	80.7	1.2e-272
WP_072589235.1|2235637_2236774_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.7	1.8e-205
WP_072589236.1|2236789_2238307_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.9	1.6e-212
WP_072589237.1|2238321_2238792_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	90.4	4.4e-81
WP_072589238.1|2238833_2239805_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	96.0	2.0e-173
WP_072589239.1|2239893_2240808_-	hypothetical protein	NA	O64140	Bacillus_phage	90.1	3.6e-156
WP_045207857.1|2240830_2241211_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	77.6	4.1e-53
WP_172645811.1|2241463_2241631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045207858.1|2241736_2242114_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	77.0	5.8e-52
WP_045207860.1|2242455_2242980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589240.1|2243092_2244835_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	64.0	1.5e-219
WP_072589241.1|2244831_2245656_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	59.9	1.7e-83
WP_154018562.1|2245768_2245912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589242.1|2245945_2246218_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	93.3	2.7e-43
WP_072589243.1|2246207_2247095_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	94.9	5.6e-162
WP_072589244.1|2247175_2247394_-	hypothetical protein	NA	O64132	Bacillus_phage	87.0	2.0e-28
WP_072589245.1|2247464_2248139_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	95.1	1.0e-75
WP_072589246.1|2248208_2249021_+	hypothetical protein	NA	O64130	Bacillus_phage	88.1	2.5e-140
WP_080491667.1|2249616_2250231_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	56.9	1.6e-43
WP_072589249.1|2250271_2250580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623442.1|2250591_2251116_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.1	4.6e-47
WP_190279039.1|2251203_2251368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041054525.1|2251568_2251760_-	hypothetical protein	NA	A0A142F1P8	Bacillus_phage	66.1	2.0e-16
WP_072589251.1|2252193_2252469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589252.1|2252482_2253157_-	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	90.6	9.3e-117
WP_072589253.1|2253174_2253435_-	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	91.9	3.9e-39
WP_014471982.1|2253454_2253649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589254.1|2253697_2253982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589256.1|2254351_2255101_-	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	52.6	3.7e-66
WP_072589257.1|2255113_2255323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589258.1|2255364_2255772_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.1	3.1e-67
WP_072589259.1|2255778_2256117_-	hypothetical protein	NA	O64111	Bacillus_phage	76.8	3.7e-42
WP_072589260.1|2256113_2256419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190279040.1|2256415_2256586_-	hypothetical protein	NA	A0A2H4JCE7	uncultured_Caudovirales_phage	62.8	1.5e-07
WP_072589261.1|2256582_2256786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589262.1|2256775_2256973_-	hypothetical protein	NA	R4JF30	Bacillus_phage	77.4	1.5e-22
WP_072589263.1|2256969_2257152_-	hypothetical protein	NA	Q38080	Bacillus_phage	66.7	1.7e-12
WP_072589264.1|2257148_2257562_-	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	37.2	2.6e-13
WP_190279041.1|2257558_2257894_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	48.4	1.3e-18
WP_072589265.1|2257893_2258466_-	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	52.6	5.7e-43
2258788:2258810	attL	AATACTTATTTTATTTTTATTCT	NA	NA	NA	NA
WP_020954128.1|2258833_2259079_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_020954129.1|2259153_2259453_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
WP_038458670.1|2259618_2259840_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	80.8	1.3e-27
WP_072589266.1|2260060_2261044_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	78.0	1.9e-139
WP_072589267.1|2261064_2262414_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	76.6	1.0e-191
WP_072589268.1|2262490_2263549_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.9	1.9e-156
WP_021493556.1|2263558_2263723_-	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	52.6	5.1e-05
WP_190279042.1|2263825_2263987_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	1.1e-12
WP_014472000.1|2264001_2264214_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014721235.1|2264363_2264519_-	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	68.6	4.5e-11
WP_142295830.1|2264644_2264770_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_072589269.1|2264798_2265953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150123255.1|2266151_2266484_-	hypothetical protein	NA	A0A1P8CWV8	Bacillus_phage	54.8	4.4e-27
WP_072589271.1|2266489_2267035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094295810.1|2267088_2267220_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	88.4	1.2e-17
WP_072589272.1|2267231_2267447_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	53.5	4.0e-13
WP_014470146.1|2267449_2267701_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	7.1e-22
WP_041482308.1|2267771_2267954_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
WP_057080574.1|2267964_2268189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589273.1|2268211_2268439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589274.1|2268468_2269077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150123256.1|2269078_2269615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458693.1|2269586_2269976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080491679.1|2270004_2270352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041482335.1|2270502_2270724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|2270813_2271017_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
2274420:2274442	attR	AATACTTATTTTATTTTTATTCT	NA	NA	NA	NA
>prophage 7
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	2281322	2334216	4117900	integrase,tail,holin,capsid	Bacillus_phage(82.35%)	53	2293395:2293410	2318773:2318788
WP_072589286.1|2281322_2282435_-	hypothetical protein	NA	G3MBK4	Bacillus_virus	29.8	3.7e-30
WP_046559798.1|2282434_2282719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045207958.1|2282897_2283134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014417885.1|2283253_2283433_+	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
WP_150123268.1|2283494_2285351_+	hypothetical protein	NA	O64076	Bacillus_phage	86.2	0.0e+00
WP_072589288.1|2285533_2286436_+	GIY-YIG nuclease family protein	NA	G3MAX5	Bacillus_virus	36.4	4.7e-07
WP_072589289.1|2286657_2287287_+	hypothetical protein	NA	O64076	Bacillus_phage	73.4	1.5e-81
WP_072589290.1|2287547_2287823_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	94.5	2.7e-38
WP_072589291.1|2288455_2288725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589292.1|2288801_2289464_+	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	39.9	7.1e-29
WP_072589293.1|2289742_2289952_+	YonK family protein	NA	NA	NA	NA	NA
WP_072589294.1|2289963_2291151_+	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	37.7	2.8e-68
WP_072589295.1|2291311_2291812_+|capsid	capsid protein	capsid	A0A1P8CWS3	Bacillus_phage	31.4	1.5e-18
WP_020954171.1|2291920_2292928_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	23.8	1.4e-07
WP_041482314.1|2292927_2294676_+	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.8	6.6e-66
2293395:2293410	attL	CTTTTCAAAAGACAGT	NA	NA	NA	NA
WP_072589296.1|2294694_2296236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589297.1|2296253_2297408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589298.1|2297448_2297913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589299.1|2297937_2299044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589300.1|2299098_2299572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559812.1|2299584_2299971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589301.1|2299980_2300646_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	51.1	1.3e-49
WP_072589302.1|2300642_2301149_+	hypothetical protein	NA	O64060	Bacillus_phage	67.9	2.0e-63
WP_072589303.1|2301145_2301871_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.9e-27
WP_072589304.1|2301910_2302702_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	35.5	5.7e-17
WP_072589305.1|2302722_2303190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623492.1|2303261_2303618_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_072589306.1|2303617_2304949_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	50.9	4.2e-20
WP_080491669.1|2304962_2305238_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	36.2	5.2e-10
WP_072589308.1|2305238_2305391_+	XkdX family protein	NA	NA	NA	NA	NA
WP_072589309.1|2305409_2306258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458755.1|2306340_2306826_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	72.9	3.7e-59
WP_072589310.1|2306825_2307242_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	62.6	1.3e-44
WP_014472041.1|2307255_2308257_+|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	86.7	2.2e-170
WP_072589824.1|2308301_2308517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559818.1|2308639_2309113_+	hypothetical protein	NA	O64047	Bacillus_phage	43.3	4.5e-25
WP_046559819.1|2309180_2309861_+	hypothetical protein	NA	Q37974	Bacillus_phage	68.7	2.8e-76
WP_072589311.1|2309919_2316810_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	60.7	0.0e+00
WP_072589312.1|2316854_2317616_+|tail	phage tail family protein	tail	A0A1P8CWP8	Bacillus_phage	78.8	3.6e-109
WP_060964937.1|2320947_2321763_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	62.8	6.0e-94
2318773:2318788	attR	ACTGTCTTTTGAAAAG	NA	NA	NA	NA
WP_072589825.1|2321806_2324368_+	hypothetical protein	NA	D6R401	Bacillus_phage	37.6	1.7e-139
WP_072589313.1|2324526_2325573_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	51.7	5.7e-81
WP_072589314.1|2325637_2326051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|2326063_2326315_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_041482578.1|2326670_2326931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072589315.1|2327082_2328243_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	8.4e-33
WP_072589316.1|2328407_2329658_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.8	8.0e-223
WP_038458779.1|2329650_2329983_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	1.8e-41
WP_072589317.1|2330199_2330958_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_057080536.1|2331070_2331274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589318.1|2331518_2331608_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_038458787.1|2331901_2332462_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	57.7	5.1e-52
WP_072589319.1|2332461_2334216_-	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	70.0	2.3e-239
>prophage 8
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	2439019	2445273	4117900		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2439019_2439613_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_007409427.1|2439602_2440358_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_072589349.1|2440565_2440655_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_007612304.1|2440743_2441265_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_015240122.1|2441330_2441705_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_015240123.1|2441821_2442286_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.7	1.6e-43
WP_072589350.1|2442318_2443515_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	9.6e-117
WP_007409425.1|2443529_2444177_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_015240125.1|2444157_2445273_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.7e-55
>prophage 9
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	3369535	3420732	4117900	protease,transposase,holin	Staphylococcus_phage(33.33%)	51	NA	NA
WP_094031235.1|3369535_3370685_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_039253862.1|3370747_3372763_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_012118438.1|3373111_3374827_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_072589559.1|3374854_3376663_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_072589560.1|3376837_3379153_-	UvrD-helicase domain-containing protein	NA	M1PME2	Moumouvirus	27.3	9.3e-07
WP_007410017.1|3379324_3379933_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_007410016.1|3380155_3380956_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_012118443.1|3380989_3381409_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_012118444.1|3381398_3382070_-	DsbA family protein	NA	NA	NA	NA	NA
WP_072589561.1|3382187_3384299_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	1.0e-116
WP_072589562.1|3384448_3386878_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	1.1e-114
WP_015240581.1|3386961_3387168_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_003151723.1|3387243_3387549_-	copper-sensing transcriptional repressor CsoR	NA	NA	NA	NA	NA
WP_072589563.1|3387687_3388728_+	oxidoreductase	NA	NA	NA	NA	NA
WP_072589564.1|3388772_3389408_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_072589565.1|3389762_3390614_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072589566.1|3390717_3391935_+	MFS transporter	NA	NA	NA	NA	NA
WP_072589567.1|3391934_3392351_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_015240588.1|3392354_3393140_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_060561959.1|3393341_3394670_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072589568.1|3394666_3394954_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_012118455.1|3394965_3395973_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069007347.1|3395969_3396749_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	5.4e-36
WP_020956345.1|3396745_3397453_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_072589569.1|3397468_3398191_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_072589570.1|3398213_3399026_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069007348.1|3399051_3399864_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012118461.1|3399860_3400400_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023357134.1|3400551_3401433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109127542.1|3401554_3402704_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.7	2.3e-38
WP_015418226.1|3402773_3403568_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003151688.1|3404544_3405015_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
WP_025285276.1|3405154_3407488_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	1.2e-86
WP_007409986.1|3407506_3408247_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003151681.1|3408365_3408596_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_087920807.1|3408719_3408905_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025285277.1|3409100_3409511_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	66.7	2.3e-17
WP_003151674.1|3409535_3409967_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151672.1|3410048_3410366_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072589571.1|3410450_3411854_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_072589572.1|3411844_3412507_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_020956353.1|3412528_3413299_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
WP_007409981.1|3413295_3414030_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
WP_003151665.1|3414026_3414740_-	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	2.5e-56
WP_015240601.1|3414850_3415528_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072589573.1|3415546_3416464_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072589574.1|3416478_3417132_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072589575.1|3417148_3418294_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	4.3e-13
WP_003151660.1|3418579_3419113_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072589576.1|3419146_3419821_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_150123275.1|3419838_3420732_-|holin	choline/betaine ABC transporter substrate-binding lipoprotein OpuCC	holin	NA	NA	NA	NA
>prophage 10
NZ_CP018295	Bacillus subtilis strain J-5 chromosome, complete genome	4117900	3812430	3820198	4117900		Bacillus_phage(33.33%)	9	NA	NA
WP_072589686.1|3812430_3813366_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.7e-23
WP_012118715.1|3813367_3814066_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	9.2e-35
WP_072589687.1|3814257_3815124_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_025285445.1|3815144_3815849_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025285446.1|3815913_3816840_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|3817189_3817645_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_072589688.1|3817641_3818490_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	4.1e-37
WP_020957994.1|3818510_3819458_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_003150981.1|3819460_3820198_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
