The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	245469	307969	4393047	capsid,tail,terminase,coat,integrase,protease,bacteriocin,tRNA,portal,head	Clostridium_phage(39.58%)	82	244742:244762	306896:306916
244742:244762	attL	ATAAAAAAATTAATAGAAGAT	NA	NA	NA	NA
WP_072584264.1|245469_246528_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_072584265.1|246605_247487_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043031910.1|247505_248696_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003493604.1|248749_248911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042385544.1|248996_250187_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_072584266.1|250777_252430_-	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	62.0	4.6e-194
WP_072584267.1|252453_252849_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RU96	Clostridium_phage	64.5	1.5e-37
WP_045895993.1|253069_253294_+	helix-turn-helix domain-containing protein	NA	A0A0A7S118	Clostridium_phage	65.5	2.0e-12
WP_155119526.1|253347_253506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366070.1|253525_253690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584268.1|253695_254250_+	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	33.2	3.9e-20
WP_045895992.1|254315_254642_+	hypothetical protein	NA	A0A0A7S0N7	Clostridium_phage	41.8	1.1e-09
WP_080490381.1|254642_256898_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	39.3	2.6e-99
WP_072584269.1|256918_257845_+	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	47.3	7.1e-59
WP_072584270.1|257846_258563_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	48.5	2.9e-60
WP_155119527.1|258564_258726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052705773.1|258736_259519_+	DnaD domain protein	NA	A0A2P1JTY8	Anoxybacillus_phage	39.1	1.9e-36
WP_072587230.1|259478_260282_+	ATP-binding protein	NA	D2XQ17	Bacillus_virus	40.1	1.6e-43
WP_045895991.1|260313_260553_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.4	2.0e-18
WP_045895990.1|260552_261032_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	40.8	4.2e-15
WP_072584271.1|261059_261236_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	54.7	1.2e-12
WP_072584272.1|261347_261509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584273.1|261505_261928_+	DUF1064 domain-containing protein	NA	A0A0A7RTV9	Clostridium_phage	69.3	5.5e-51
WP_072584274.1|261915_262545_+	hypothetical protein	NA	A0A0A7RW43	Clostridium_phage	72.1	1.8e-82
WP_072584275.1|262589_263498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045895994.1|263506_263839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045895987.1|263875_264064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405269.1|264721_266545_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	8.4e-88
WP_045896279.1|266812_266992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896277.1|267074_268070_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	26.1	3.7e-05
WP_072584276.1|268102_268930_+	DNA adenine methylase	NA	A7YGL3	Campylobacter_phage	35.0	2.8e-30
WP_045896273.1|268972_269416_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	35.2	3.0e-15
WP_072584277.1|269408_269747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119529.1|269839_270007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896270.1|270106_270520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584278.1|270860_271208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896268.1|271280_271490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896266.1|271557_271803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896264.1|271860_272163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584279.1|272204_272582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119530.1|272750_273107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896258.1|273108_273534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584281.1|273533_274007_+	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	37.1	7.4e-12
WP_072587231.1|274277_274742_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.0	1.5e-49
WP_072584282.1|274738_276439_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	56.6	2.5e-187
WP_072584283.1|276454_277648_+|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	37.8	3.5e-66
WP_072584284.1|277628_278297_+|head,protease	HK97 family phage prohead protease	head,protease	E2ELI4	Clostridium_phage	46.5	8.0e-36
WP_072584285.1|278307_279459_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	57.8	4.3e-122
WP_155119531.1|279502_279634_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045896253.1|279648_279975_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	50.0	8.4e-15
WP_045896251.1|279955_280282_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_072584286.1|280274_280658_+	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	50.0	2.7e-28
WP_072584287.1|280654_280996_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	42.6	2.5e-17
WP_045896249.1|280998_281580_+|tail	tail protein	tail	E2ELJ1	Clostridium_phage	58.5	9.9e-59
WP_072584288.1|281615_281942_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	34.6	4.2e-06
WP_072584289.1|282197_287504_+|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	38.8	3.9e-77
WP_080490383.1|287520_288387_+|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	69.6	4.8e-110
WP_080490384.1|288438_289458_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	E2ELJ7	Clostridium_phage	59.1	3.5e-115
WP_072584291.1|289457_290231_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	60.2	8.8e-79
WP_072584292.1|291255_291555_+	hypothetical protein	NA	J9QEB9	Clostridium_phage	47.6	4.4e-10
WP_072584293.1|291570_291786_+	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	67.4	2.7e-09
WP_072584294.1|291961_292258_+	hypothetical protein	NA	Q332A4	Clostridium_botulinum_C_phage	53.5	9.6e-18
WP_072584295.1|292257_292887_+	hypothetical protein	NA	Q332A5	Clostridium_botulinum_C_phage	65.1	2.5e-71
WP_072584296.1|292939_293143_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021106364.1|293151_293346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584297.1|293388_294159_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	64.8	2.1e-88
WP_045896240.1|294455_294656_+	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	77.4	2.2e-13
WP_061295793.1|294652_294898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061295790.1|294959_295340_+	recombinase family protein	NA	A0A2H4J078	uncultured_Caudovirales_phage	55.7	1.2e-28
WP_061295788.1|295628_295829_+	helix-turn-helix domain-containing protein	NA	A0A2H4J765	uncultured_Caudovirales_phage	50.0	5.0e-10
WP_167366071.1|295953_296112_+	hypothetical protein	NA	A0A2H4J4S7	uncultured_Caudovirales_phage	73.1	3.4e-14
WP_052705787.1|296240_296792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119532.1|296925_297075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584299.1|297071_298298_+	hypothetical protein	NA	Q331T3	Clostridium_botulinum_C_phage	25.3	2.0e-21
WP_072584300.1|298288_298885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584301.1|299108_299618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896231.1|299665_299944_-	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	88.0	2.3e-37
WP_045896228.1|300015_300252_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUG5	Clostridium_phage	71.8	4.2e-24
WP_072584302.1|300631_302005_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_072584303.1|302082_304881_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.8	2.5e-54
WP_072584304.1|305023_307018_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	4.3e-69
306896:306916	attR	ATAAAAAAATTAATAGAAGAT	NA	NA	NA	NA
WP_072584305.1|307033_307969_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	496621	503559	4393047		uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_072584434.1|496621_497566_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.6	8.4e-15
WP_003360796.1|497680_498340_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.2	2.5e-58
WP_072584435.1|498521_499112_-	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	55.1	1.8e-47
WP_072584436.1|499115_499781_-	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.8	1.3e-38
WP_072584437.1|499782_500214_-	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	37.5	1.4e-12
WP_072584438.1|500230_500992_-	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_072584439.1|500991_501990_-	2-hydroxyacyl-CoA dehydratase	NA	NA	NA	NA	NA
WP_072584440.1|502614_503559_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.0	2.7e-13
>prophage 3
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	657842	664458	4393047	integrase	Clostridium_phage(50.0%)	9	658869:658885	664504:664520
WP_072584550.1|657842_658241_-	ATP-dependent helicase	NA	A0A1V0SAV1	Catovirus	42.3	3.3e-05
WP_072584551.1|658511_659099_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	33.0	5.0e-10
658869:658885	attL	ATTTTCTTTAGCTTCTA	NA	NA	NA	NA
WP_045896982.1|659433_660192_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	55.7	6.4e-50
WP_003486633.1|660191_660365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486634.1|660366_660591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486635.1|660873_661068_-	hypothetical protein	NA	A0A0A7RU02	Clostridium_phage	96.9	3.9e-28
WP_030034659.1|661343_661499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072584552.1|661486_662392_-|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	27.7	6.8e-06
WP_072584553.1|662445_664458_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	30.5	3.4e-66
664504:664520	attR	TAGAAGCTAAAGAAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	2003878	2011861	4393047		Bacillus_phage(66.67%)	7	NA	NA
WP_167366085.1|2003878_2005225_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	29.9	9.4e-28
WP_072587281.1|2005544_2006591_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	1.7e-21
WP_072585539.1|2006628_2007324_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.5	2.9e-41
WP_072585540.1|2007397_2009362_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	25.6	1.5e-05
WP_080490415.1|2009477_2009777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366132.1|2009793_2011047_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.2	4.2e-38
WP_072585543.1|2011183_2011861_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	3.4e-34
>prophage 5
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	2253816	2329981	4393047	capsid,tail,terminase,protease,head,tRNA,portal,integrase	Bacillus_phage(16.67%)	60	2319178:2319219	2333421:2333462
WP_072585734.1|2253816_2254557_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003363046.1|2254676_2254847_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003488016.1|2254928_2255132_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_072585735.1|2255143_2256058_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_072585736.1|2256059_2257004_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_072585737.1|2257019_2257349_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_072585738.1|2257429_2258125_-	deoxynucleoside kinase	NA	G3MB74	Bacillus_virus	35.4	1.5e-24
WP_072585739.1|2258148_2259600_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003491739.1|2259578_2259791_-	sigma factor G inhibitor Gin	NA	NA	NA	NA	NA
WP_080490463.1|2260035_2260188_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_072585740.1|2260347_2261508_+	M20 family peptidase	NA	NA	NA	NA	NA
WP_003488024.1|2261512_2262016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585741.1|2262369_2263311_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_072585742.1|2263347_2264256_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_072585743.1|2264441_2265185_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	35.8	1.8e-28
WP_072585744.1|2270743_2271487_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_072585745.1|2283243_2284686_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_072585746.1|2284682_2285246_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_072585747.1|2291627_2292224_+	uracil-DNA glycosylase	NA	F8WQ35	Bacillus_phage	27.3	2.2e-08
WP_072585748.1|2297821_2298766_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072585749.1|2298794_2299904_-	MFS transporter	NA	NA	NA	NA	NA
WP_072585750.1|2299987_2300692_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A1V0SAV8	Catovirus	29.9	4.8e-07
WP_003496967.1|2301077_2301239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585751.1|2301257_2302046_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_030032728.1|2302187_2302904_-	hydrolase	NA	NA	NA	NA	NA
WP_030032725.1|2303014_2303506_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_072585752.1|2303560_2304253_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_072585753.1|2304402_2304663_-	pro-sigmaK processing inhibitor BofA family protein	NA	NA	NA	NA	NA
WP_045898744.1|2304811_2305057_-	YaaL family protein	NA	NA	NA	NA	NA
WP_045898741.1|2305130_2305727_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_045898739.1|2305759_2306101_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_072585754.1|2306166_2307792_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	31.5	8.4e-47
WP_072585756.1|2308475_2308709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585757.1|2308721_2308946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585758.1|2308964_2309660_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072585759.1|2309631_2310378_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.5	7.0e-41
WP_072585760.1|2310393_2310600_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_072585761.1|2310612_2311203_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072585762.1|2312267_2312714_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	38.7	2.2e-05
WP_072585763.1|2312832_2314035_-	methionine gamma-lyase	NA	NA	NA	NA	NA
WP_167366090.1|2314202_2315765_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_030032710.1|2316159_2316480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072585764.1|2316556_2318155_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	30.5	1.5e-43
WP_072585765.1|2318257_2319145_+	phosphatidylserine decarboxylase	NA	A0A2K9L6Z6	Tupanvirus	29.1	2.7e-15
2319178:2319219	attL	TTTATGGTGCACCGGGCAGGATTCGAACCCGCGGCCAACTGG	NA	NA	NA	NA
WP_072585766.1|2319369_2319627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585767.1|2319637_2319967_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_072585768.1|2320011_2321661_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	51.9	3.6e-162
WP_072585769.1|2321662_2322001_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	8.4e-18
WP_061334455.1|2322095_2322401_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	48.9	9.0e-19
WP_080490417.1|2322582_2323125_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	48.0	3.1e-38
WP_072585771.1|2323140_2323524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585772.1|2323527_2323788_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J6E5	uncultured_Caudovirales_phage	34.7	5.1e-07
WP_072585773.1|2323845_2325081_-|capsid	phage major capsid protein	capsid	A0A1L2BY91	Clostridium_phage	24.2	2.4e-17
WP_072585774.1|2325084_2325645_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1Q1PVX3	Staphylococcus_phage	29.2	5.1e-12
WP_072585775.1|2325631_2326840_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	37.2	1.2e-61
WP_072585776.1|2327038_2327848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045517685.1|2327971_2328166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045517687.1|2328181_2328487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155119546.1|2328483_2328621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072585777.1|2328640_2329981_-	hypothetical protein	NA	Q8SDW1	Staphylococcus_phage	27.3	1.4e-26
2333421:2333462	attR	TTTATGGTGCACCGGGCAGGATTCGAACCCGCGGCCAACTGG	NA	NA	NA	NA
>prophage 6
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	3073898	3099769	4393047		Clostridium_phage(84.0%)	33	NA	NA
WP_072586292.1|3073898_3074102_+	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	43.7	2.5e-09
WP_072586293.1|3074691_3074841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045896411.1|3075152_3075563_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_061321068.1|3075755_3075965_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045896409.1|3076026_3076239_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_167366137.1|3076331_3077237_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	40.0	9.4e-40
WP_167366136.1|3077226_3078027_+	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	35.7	2.6e-33
WP_072586296.1|3078083_3078404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586297.1|3078516_3079038_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.6	9.6e-37
WP_072586298.1|3079721_3080006_+	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	60.2	4.6e-25
WP_072586299.1|3080005_3080371_+	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	55.4	2.2e-32
WP_072586300.1|3080375_3080723_+	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	59.8	4.3e-33
WP_072586301.1|3080728_3081148_+	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	71.9	3.0e-57
WP_072586302.1|3081152_3082040_+	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	73.8	4.5e-119
WP_072586303.1|3082054_3082471_+	esterase	NA	A0A0A7S0S0	Clostridium_phage	68.9	9.9e-45
WP_072586304.1|3082505_3082673_+	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	68.5	1.5e-15
WP_072586305.1|3082855_3084397_+	hypothetical protein	NA	A0A0A7RU22	Clostridium_phage	37.4	1.5e-29
WP_045895947.1|3084418_3084799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586306.1|3084795_3086325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586307.1|3086317_3086680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586308.1|3086697_3087243_+	hypothetical protein	NA	A0A0A7RW86	Clostridium_phage	72.5	8.7e-73
WP_072586309.1|3087246_3088227_+	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	60.7	9.4e-110
WP_072586310.1|3088249_3089488_+	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	83.3	1.6e-202
WP_072586311.1|3089500_3091345_+	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	63.8	2.9e-136
WP_045896654.1|3091350_3091605_+	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	6.3e-34
WP_072586312.1|3091616_3092615_+	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.3	1.9e-142
WP_072586313.1|3092626_3093712_+	signal peptidase II	NA	A0A0A7RU66	Clostridium_phage	67.6	1.3e-136
WP_072586314.1|3093849_3094923_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	56.3	1.1e-68
WP_072586315.1|3095077_3096139_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	54.4	2.0e-65
WP_072586316.1|3096244_3097390_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	56.6	7.9e-68
WP_072586317.1|3098385_3098640_+	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	64.6	2.2e-23
WP_072587296.1|3098657_3098852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586318.1|3098998_3099769_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.2	1.4e-89
>prophage 7
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	3244079	3253658	4393047		Synechococcus_phage(42.86%)	7	NA	NA
WP_167366098.1|3244079_3246635_+	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	30.4	4.0e-11
WP_072586431.1|3247311_3247791_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	4.8e-27
WP_072586432.1|3247790_3248495_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	4.6e-42
WP_167366139.1|3248590_3250033_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	3.6e-57
WP_072586434.1|3250204_3251200_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.1	1.3e-66
WP_072586435.1|3251327_3251945_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	3.4e-25
WP_072586436.1|3252158_3253658_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	5.5e-69
>prophage 8
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	3612607	3697810	4393047	capsid,plate,tail,terminase,protease,head,holin,tRNA,portal,integrase	Clostridium_phage(27.5%)	101	3626957:3626979	3662811:3662833
WP_072586694.1|3612607_3615247_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.4	8.0e-63
WP_003385813.1|3615362_3615614_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_072586695.1|3615820_3616234_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003495302.1|3616247_3616502_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003385810.1|3616623_3617076_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_072586696.1|3617123_3618833_+	ribonuclease J	NA	NA	NA	NA	NA
WP_072586697.1|3619479_3621306_+	translational GTPase TypA	NA	A0A1B0RXH7	Streptococcus_phage	38.5	7.8e-17
WP_072586698.1|3621382_3622414_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_072586699.1|3622496_3623153_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_072586700.1|3623145_3624372_+	U32 family peptidase	NA	Q6DW11	Phage_TP	37.3	1.7e-52
WP_072586701.1|3624520_3625141_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	3.7e-35
WP_072586702.1|3625226_3626897_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
3626957:3626979	attL	ATATTATATTAATAAGCACTATT	NA	NA	NA	NA
WP_072586703.1|3627047_3628130_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	29.6	4.6e-25
WP_072586704.1|3628191_3628638_-	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	43.7	5.9e-27
WP_072586705.1|3628656_3629082_-	helix-turn-helix domain-containing protein	NA	D2XR39	Bacillus_phage	58.0	5.8e-32
WP_072586706.1|3629307_3629511_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072586707.1|3629527_3629827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586708.1|3629847_3630645_+	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	42.5	1.1e-44
WP_072586709.1|3630656_3630917_+	ubiquitin	NA	NA	NA	NA	NA
WP_072586710.1|3630918_3631101_+	hypothetical protein	NA	A0A0A7RTQ2	Clostridium_phage	50.8	1.2e-07
WP_072586711.1|3631361_3632129_+	phage replication initiation protein	NA	A0A0S2MYA8	Enterococcus_phage	65.2	1.0e-42
WP_072586712.1|3632129_3632672_+	hypothetical protein	NA	A0A2K9V2Y3	Faecalibacterium_phage	28.6	1.1e-08
WP_072586713.1|3632672_3633200_+	nitrate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_072586714.1|3633177_3633465_+	MazG-like family protein	NA	NA	NA	NA	NA
WP_072586715.1|3633501_3634245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586716.1|3634296_3634641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586717.1|3634685_3635117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012342098.1|3635146_3635299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119553.1|3635327_3635495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586718.1|3635745_3636009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586719.1|3636048_3637098_+	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	27.8	2.1e-35
WP_072586720.1|3637202_3637916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586721.1|3637912_3638098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366103.1|3638084_3638234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366104.1|3638245_3638416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004442245.1|3638405_3638792_+	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	69.3	2.6e-47
WP_053530596.1|3639051_3639264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053530597.1|3639264_3639870_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L2BY87	Clostridium_phage	74.6	3.1e-87
WP_072586722.1|3640167_3640665_+	Xaa-His dipeptidase	NA	D2J052	Enterococcus_phage	28.4	2.8e-09
WP_080490430.1|3640719_3641082_+	HNH endonuclease	NA	I2E8Y8	Clostridium_phage	34.4	1.9e-07
WP_072586724.1|3641242_3641725_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	33.3	8.3e-11
WP_072586725.1|3641724_3643506_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	41.9	1.6e-123
WP_047403548.1|3643517_3644774_+|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	37.9	3.3e-75
WP_047403549.1|3644760_3645522_+|protease	Clp protease ClpP	protease	A0A0A7RTN2	Clostridium_phage	57.0	1.5e-67
WP_072586726.1|3645559_3646735_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	29.9	1.2e-34
WP_012704689.1|3646779_3647037_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	42.7	3.2e-09
WP_080490431.1|3647055_3647391_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_072586727.1|3647400_3647610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586728.1|3647611_3648025_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_072587307.1|3648072_3648492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586729.1|3648667_3648985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586730.1|3648989_3650078_+|tail	phage tail sheath protein	tail	A0A0K2SUH8	Clostridium_phage	31.5	1.3e-38
WP_080490432.1|3650089_3650512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586732.1|3650528_3650954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586733.1|3651190_3653821_+|tail	phage tail tape measure protein	tail	A0A1V0DYA9	Dinoroseobacter_phage	36.6	1.5e-37
WP_072586734.1|3653866_3654301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586735.1|3654300_3655230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586736.1|3655242_3655563_+	DUF2577 family protein	NA	NA	NA	NA	NA
WP_072586737.1|3655567_3656005_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_080490433.1|3656016_3657126_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	34.1	1.4e-40
WP_072586738.1|3657138_3657621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587309.1|3657583_3658114_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_072586739.1|3658128_3658575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119554.1|3658673_3659684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587310.1|3659769_3660030_+|holin	phage holin family protein	holin	A0A0A7RUL4	Clostridium_phage	67.9	2.4e-25
WP_155119555.1|3660072_3660837_+	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	59.3	1.0e-50
WP_045520192.1|3661270_3661459_+	hypothetical protein	NA	A0A0A7RTH9	Clostridium_phage	72.7	5.9e-13
WP_072586741.1|3661460_3661706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586743.1|3662847_3663552_+	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	29.0	1.2e-13
3662811:3662833	attR	ATATTATATTAATAAGCACTATT	NA	NA	NA	NA
WP_072586744.1|3663691_3664468_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_072586745.1|3664469_3665522_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_072586747.1|3666171_3667446_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_072586748.1|3667603_3668857_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003484662.1|3668879_3669989_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_072586749.1|3670323_3671121_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_003399432.1|3671132_3671840_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	44.3	2.5e-19
WP_003393807.1|3671914_3672688_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0A0RV91	Bacillus_phage	40.2	1.1e-44
WP_003484669.1|3672835_3673099_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_003494421.1|3673230_3673686_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_072586750.1|3673961_3674681_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_072586751.1|3674691_3675390_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.6	3.0e-46
WP_072586752.1|3675401_3677111_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	39.1	5.4e-36
WP_072586753.1|3677358_3678231_+	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	30.3	2.0e-07
WP_072586754.1|3678437_3679361_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_072586755.1|3679360_3680245_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_072586756.1|3680257_3681007_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	1.7e-15
WP_072586757.1|3681036_3681690_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_072586758.1|3682122_3683457_+	DUF512 domain-containing protein	NA	NA	NA	NA	NA
WP_072586759.1|3683459_3684779_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_072586760.1|3684952_3685951_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_072586761.1|3686299_3687781_+	stage IV sporulation protein A	NA	NA	NA	NA	NA
WP_072586762.1|3688909_3689113_-	helix-turn-helix transcriptional regulator	NA	Q331Y7	Clostridium_botulinum_C_phage	56.7	1.0e-15
WP_072586763.1|3689636_3690638_+	asparaginase	NA	NA	NA	NA	NA
WP_072586764.1|3690831_3691710_+	YicC family protein	NA	NA	NA	NA	NA
WP_003484705.1|3691725_3692001_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_003388624.1|3692000_3692630_+	guanylate kinase	NA	U5TH34	Cowpox_virus	31.3	1.7e-16
WP_045897806.1|3692610_3692829_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_072586765.1|3692830_3694018_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.1	9.8e-45
WP_072586766.1|3694175_3696383_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_072586767.1|3696408_3696852_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	46.7	1.9e-17
WP_167366144.1|3696892_3697810_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.2	1.5e-08
>prophage 9
NZ_CP013243	Clostridium botulinum strain CDC_1632 chromosome, complete genome	4393047	4221721	4233421	4393047		Clostridium_botulinum_D_phage(50.0%)	6	NA	NA
WP_072587107.1|4221721_4223602_-	botulinum neurotoxin hemagglutinin HA70 subunit	NA	Q786X9	Clostridium_botulinum_D_phage	67.5	6.6e-237
WP_003404194.1|4223615_4224056_-	hemagglutinin component HA17	NA	Q786Y1	Clostridium_botulinum_D_phage	63.7	2.3e-47
WP_072587108.1|4224118_4225003_-	ricin-type beta-trefoil lectin domain protein	NA	Q38196	Clostridium_botulinum_phage	34.6	3.1e-35
WP_003404193.1|4225228_4225765_+	botulinum neurotoxin transcription-activating sigma factor BotR	NA	Q9ZWV5	Clostridium_botulinum_D_phage	52.8	5.6e-40
WP_072587328.1|4225926_4229520_+	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	69.2	0.0e+00
WP_072587109.1|4229545_4233421_+	botulinum neurotoxin type B	NA	Q332E0	Clostridium_botulinum_C_phage	33.4	5.2e-188
