The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	8841	21774	3989393		Bacillus_phage(50.0%)	21	NA	NA
WP_072588193.1|8841_10068_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	30.9	7.2e-43
WP_033575321.1|10181_10391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081369838.1|10423_10690_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.8e-07
WP_072588194.1|10706_11702_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.6	1.5e-70
WP_072588195.1|11836_13231_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	2.6e-129
WP_072588196.1|13227_13452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588197.1|13448_13976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851654.1|13976_14288_-	hypothetical protein	NA	F8WPL8	Bacillus_phage	55.0	2.2e-20
WP_072588198.1|14284_15085_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	49.1	1.6e-62
WP_072588199.1|15104_15308_-	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	60.3	5.4e-12
WP_072588200.1|15304_16297_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	43.0	1.4e-57
WP_072588201.1|16513_16882_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.5	2.3e-21
WP_045208710.1|17105_17606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588202.1|17653_17977_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	9.8e-08
WP_155759821.1|17966_18131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588203.1|18326_18704_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072588204.1|18710_19163_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.1	5.6e-09
WP_003154673.1|19437_19932_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
WP_014304903.1|19949_20681_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	5.8e-56
WP_003154678.1|20673_21114_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154679.1|21114_21774_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
>prophage 2
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	106495	142065	3989393	portal,plate,holin,terminase,tail	Bacillus_phage(34.38%)	46	NA	NA
WP_014304858.1|106495_107374_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	2.8e-81
WP_003154813.1|107387_107651_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|107664_107928_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_046559521.1|107979_108741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|108797_108995_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_014304856.1|109000_109372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154821.1|109384_111007_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_003154822.1|111009_111282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154823.1|111278_111857_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_003154824.1|111840_112887_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_003154825.1|112879_113305_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_007610818.1|113408_113675_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154829.1|113674_114652_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_072588211.1|114665_115325_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_072588212.1|115317_120441_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	2.0e-41
WP_015239684.1|120428_120581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|120622_121069_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|121145_121589_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_072588213.1|121590_122988_-|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.6	6.9e-82
WP_003154839.1|122987_123197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588214.1|123193_123640_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_072588215.1|123643_124141_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.0	2.7e-36
WP_003154844.1|124137_124494_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003154846.1|124490_124874_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|124890_125826_-|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_072588216.1|125852_126698_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.1	2.2e-54
WP_088005490.1|126717_128109_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.6	3.0e-138
WP_052585744.1|128157_129456_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.6	8.5e-151
WP_069013286.1|129452_130250_-|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.2	2.7e-59
WP_069448680.1|130362_130875_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	42.0	6.5e-22
WP_003154859.1|130987_131191_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_046559510.1|131180_131522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014304842.1|131786_132587_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	8.0e-59
WP_014304841.1|132486_133314_-|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_003154869.1|133303_133483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|133674_134013_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154873.1|134161_134752_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_032858666.1|134906_135512_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.3	1.5e-41
WP_003154878.1|135621_135999_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154880.1|136036_136990_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|137132_137267_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_155759822.1|137256_138393_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.7e-94
WP_044053119.1|138597_139065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304837.1|139213_139978_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014304836.1|140053_140245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154898.1|140706_142065_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	1.2e-14
>prophage 3
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	688745	698636	3989393		Synechococcus_phage(50.0%)	9	NA	NA
WP_025853962.1|688745_690284_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
WP_003155752.1|690280_690868_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_003155753.1|690864_691905_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	2.4e-63
WP_003155754.1|691996_693427_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_015388590.1|693402_695631_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	3.2e-158
WP_015388591.1|695614_696298_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014417102.1|696294_696549_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_003155762.1|696548_697268_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_007408896.1|697343_698636_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
>prophage 4
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	1585632	1637009	3989393	lysis,coat,tRNA,holin	Bacillus_phage(42.86%)	56	NA	NA
WP_072588360.1|1585632_1586877_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_063174455.1|1587136_1587634_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150888.1|1587812_1588673_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	3.2e-05
WP_024085954.1|1588730_1590476_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.5	3.5e-43
WP_015387525.1|1590637_1591972_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003150894.1|1591999_1592383_-	VOC family protein	NA	NA	NA	NA	NA
WP_046560142.1|1592477_1593665_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.1	5.3e-75
WP_014306072.1|1593849_1594611_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003150901.1|1594767_1594962_-	YwbE family protein	NA	NA	NA	NA	NA
WP_014306070.1|1595091_1595772_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_007407725.1|1595753_1596140_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003150908.1|1596246_1597155_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025853642.1|1597157_1597976_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_014306068.1|1597972_1598647_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003150911.1|1598838_1599033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014306066.1|1599051_1600308_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003150913.1|1600395_1600998_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_043867536.1|1601018_1601693_-	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_014306063.1|1601692_1602373_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003150917.1|1602590_1602752_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_003150919.1|1603087_1603711_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032857211.1|1603790_1604177_+	GtrA family protein	NA	NA	NA	NA	NA
WP_072588361.1|1604415_1605957_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003150926.1|1605973_1606219_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014306059.1|1606721_1607687_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_012118743.1|1607714_1609664_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150930.1|1609678_1610293_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003150932.1|1610294_1610663_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003150937.1|1610706_1610967_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003150939.1|1611221_1611719_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150942.1|1611920_1613108_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003150944.1|1613211_1613961_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_015387532.1|1614124_1615126_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014306056.1|1615167_1617579_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
WP_003150952.1|1618104_1618419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150954.1|1618442_1619273_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_003150956.1|1619490_1620873_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_032857162.1|1620869_1622309_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.5	6.3e-22
WP_003150958.1|1622408_1622648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150959.1|1622678_1623491_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003150960.1|1623640_1623979_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085940.1|1623971_1624607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150962.1|1624651_1625179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025853634.1|1625263_1626070_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012118732.1|1626084_1626768_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
WP_015387535.1|1626826_1627249_+	YwdI family protein	NA	NA	NA	NA	NA
WP_003150968.1|1627267_1628587_+	purine permease	NA	NA	NA	NA	NA
WP_003150969.1|1628650_1629022_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003150971.1|1629068_1629614_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_024085938.1|1629894_1630665_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_015387538.1|1630669_1632094_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_072588362.1|1632115_1633285_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_072588363.1|1633285_1634149_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032857154.1|1634148_1635270_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_155759823.1|1635259_1636003_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306046.1|1636004_1637009_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	2988183	2994436	3989393		Staphylococcus_phage(66.67%)	9	NA	NA
WP_024085544.1|2988183_2989299_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
WP_032857114.1|2989279_2989927_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	3.3e-39
WP_003153371.1|2989941_2991138_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_003153372.1|2991170_2991635_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|2991751_2992126_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_012117889.1|2992191_2992713_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|2992800_2992890_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153377.1|2993097_2993853_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153378.1|2993842_2994436_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
>prophage 6
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	3137624	3143511	3989393		Bacillus_phage(100.0%)	8	NA	NA
WP_014305242.1|3137624_3137963_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.2	1.1e-25
WP_044053349.1|3138529_3138997_+	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	57.1	1.4e-42
WP_014305240.1|3139002_3139362_+	hypothetical protein	NA	O64028	Bacillus_phage	60.5	3.7e-32
WP_044053348.1|3139422_3140442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153655.1|3140754_3140937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153656.1|3140926_3142063_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.7	8.2e-166
WP_025852486.1|3142424_3142877_+	hypothetical protein	NA	O64117	Bacillus_phage	77.3	3.7e-61
WP_032858634.1|3143136_3143511_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	51.2	3.8e-27
>prophage 7
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	3439865	3446079	3989393		Bacillus_phage(50.0%)	7	NA	NA
WP_015417523.1|3439865_3440834_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_015388200.1|3440882_3441107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053226.1|3441140_3441899_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.6	4.0e-52
WP_072588502.1|3441948_3442569_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	5.4e-47
WP_003154059.1|3442617_3443607_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_003154060.1|3443624_3445727_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_014305044.1|3445686_3446079_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
>prophage 8
NZ_CP018152	Bacillus amyloliquefaciens strain LM2303 chromosome, complete genome	3989393	3904980	3983471	3989393	integrase,portal,protease,holin,terminase,capsid,tail	Bacillus_phage(45.59%)	110	3915747:3915766	3980409:3980428
WP_024085230.1|3904980_3905604_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	54.5	1.7e-27
WP_003154667.1|3905876_3906071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154669.1|3906234_3906420_+	YkvS family protein	NA	NA	NA	NA	NA
WP_014304904.1|3906492_3906768_-	DUF3219 family protein	NA	NA	NA	NA	NA
WP_072588528.1|3907378_3908542_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.7	4.3e-45
WP_072588529.1|3908624_3909422_-	hypothetical protein	NA	A0A288WFX2	Bacillus_phage	29.5	1.9e-15
WP_025851527.1|3909596_3909803_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046341224.1|3909822_3910074_+	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	50.8	2.8e-10
WP_025851531.1|3910149_3910485_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	2.6e-11
WP_072588530.1|3910500_3910866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351583.1|3910993_3911251_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_072588531.1|3911272_3912211_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	66.8	2.4e-99
WP_013351581.1|3912289_3912499_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_013351580.1|3912502_3912691_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3912691_3912961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369850.1|3912975_3914538_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	52.4	1.5e-56
WP_072588533.1|3914571_3917136_-	peptidase G2	NA	D6R401	Bacillus_phage	74.5	0.0e+00
3915747:3915766	attL	ATACGTTTATCTTCCGGCTT	NA	NA	NA	NA
WP_072588534.1|3917150_3918551_-	endopeptidase	NA	A6M966	Geobacillus_virus	31.2	3.8e-40
WP_025851545.1|3918562_3919987_-	glycoside hydrolase family 73	NA	A0A2H4JBY6	uncultured_Caudovirales_phage	43.6	4.0e-61
WP_072588535.1|3919993_3922216_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	36.8	3.8e-58
WP_072588536.1|3922395_3923157_-	hypothetical protein	NA	A0A1W6JL91	Lactococcus_phage	36.5	7.2e-41
WP_014470937.1|3923257_3923866_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	42.2	7.0e-31
WP_069473325.1|3924198_3924570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588538.1|3924627_3925182_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	2.3e-49
WP_072588539.1|3925206_3925596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851553.1|3925602_3926010_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	8.0e-31
WP_081369851.1|3926006_3926327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588541.1|3926342_3926729_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	2.1e-20
WP_072588542.1|3926743_3926962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154021547.1|3926964_3927219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473319.1|3927270_3928374_-	hypothetical protein	NA	A0A2I7S650	Vibrio_phage	27.0	1.4e-29
WP_072588543.1|3928385_3929057_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	49.5	2.9e-17
WP_072588544.1|3929150_3929975_-|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	51.6	3.8e-72
WP_072588545.1|3929974_3931606_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	57.4	3.7e-167
WP_029973272.1|3931608_3932040_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	6.5e-31
WP_072588546.1|3932056_3933811_-|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.4	2.8e-250
WP_072588547.1|3933893_3934442_+|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	52.2	8.2e-39
WP_072588548.1|3934639_3935125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588549.1|3935806_3936088_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	57.5	7.5e-20
WP_072588550.1|3936202_3936646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851577.1|3937628_3937859_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013351551.1|3938326_3938527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072588551.1|3938632_3939070_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	67.4	2.2e-50
WP_013351549.1|3939200_3939380_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_072588553.1|3939669_3940482_+	hypothetical protein	NA	O64130	Bacillus_phage	62.5	8.9e-98
WP_155759825.1|3940521_3940683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072588554.1|3940808_3941609_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	55.0	1.4e-71
WP_081369847.1|3941696_3942248_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	45.2	1.8e-17
WP_072588556.1|3942177_3942567_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	46.7	7.9e-20
WP_072588557.1|3942614_3943793_-	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.6	2.8e-145
WP_155759826.1|3943909_3944299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072588559.1|3944271_3945420_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	75.5	2.3e-139
WP_072588560.1|3945416_3945989_-	hypothetical protein	NA	M4HPU2	Bacillus_phage	38.7	4.9e-34
WP_072588561.1|3945985_3946231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588562.1|3946227_3947187_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	61.1	1.6e-45
WP_155759827.1|3947187_3947358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588563.1|3947299_3947848_-	hypothetical protein	NA	U5J9G1	Bacillus_phage	35.8	6.3e-15
WP_072588564.1|3947864_3948431_-	hypothetical protein	NA	A0A142F1S8	Bacillus_phage	58.8	5.7e-27
WP_155759828.1|3948459_3948633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369848.1|3948636_3949356_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	68.8	7.4e-88
WP_072588565.1|3949356_3949635_-	hypothetical protein	NA	A0A2D0YUP5	Vibrio_phage	47.2	1.6e-14
WP_081369849.1|3949859_3950471_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.4	1.1e-44
WP_155759829.1|3950467_3950614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588591.1|3950724_3951699_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	78.0	6.4e-143
WP_072588568.1|3951938_3954056_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	78.7	0.0e+00
WP_072588569.1|3954045_3954402_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	55.9	3.8e-29
WP_025851616.1|3954407_3954593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588570.1|3954589_3954835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029974713.1|3954840_3955062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588571.1|3955061_3955427_-	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	35.1	2.0e-12
WP_072588572.1|3955426_3955678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588573.1|3955678_3955876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588574.1|3955876_3956410_-	hypothetical protein	NA	A0A2H4IZL3	uncultured_Caudovirales_phage	43.5	2.5e-32
WP_072588575.1|3956563_3957622_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.1	3.5e-78
WP_072588576.1|3957622_3958327_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	44.8	1.0e-33
WP_072588577.1|3958328_3960575_-	hypothetical protein	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	47.5	2.6e-171
WP_155759818.1|3960609_3960765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155759819.1|3960761_3960941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588189.1|3960930_3962193_-	hypothetical protein	NA	A0A2H4J459	uncultured_Caudovirales_phage	29.1	7.7e-24
WP_025851634.1|3962193_3962628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588190.1|3962652_3963456_-	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	36.6	5.6e-36
WP_155759820.1|3963693_3964107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369837.1|3964562_3965252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588193.1|3965455_3966682_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	30.9	7.2e-43
WP_033575321.1|3966795_3967005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081369838.1|3967037_3967304_+	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	42.6	1.8e-07
WP_072588194.1|3967320_3968316_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.6	1.5e-70
WP_072588195.1|3968450_3969845_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	2.6e-129
WP_072588196.1|3969841_3970066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588197.1|3970062_3970590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025851654.1|3970590_3970902_-	hypothetical protein	NA	F8WPL8	Bacillus_phage	55.0	2.2e-20
WP_072588198.1|3970898_3971699_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	49.1	1.6e-62
WP_072588199.1|3971718_3971922_-	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	60.3	5.4e-12
WP_045208710.1|3973717_3974218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588202.1|3974265_3974589_-	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	37.8	9.8e-08
WP_155759821.1|3974578_3974743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072588203.1|3974938_3975316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072588204.1|3975322_3975775_-	hypothetical protein	NA	A0A1P8CX70	Bacillus_phage	33.1	5.6e-09
WP_072588528.1|3976311_3977475_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	31.7	4.3e-45
WP_072588529.1|3977557_3978355_-	hypothetical protein	NA	A0A288WFX2	Bacillus_phage	29.5	1.9e-15
WP_025851527.1|3978529_3978736_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046341224.1|3978755_3979007_+	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	50.8	2.8e-10
WP_025851531.1|3979082_3979418_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.7	2.6e-11
WP_072588530.1|3979433_3979799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351583.1|3979926_3980184_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_072588531.1|3980205_3981144_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	66.8	2.4e-99
3980409:3980428	attR	AAGCCGGAAGATAAACGTAT	NA	NA	NA	NA
WP_013351581.1|3981222_3981432_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	2.6e-09
WP_013351580.1|3981435_3981624_-	XkdX family protein	NA	NA	NA	NA	NA
WP_014470931.1|3981624_3981894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369850.1|3981908_3983471_-	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	52.4	1.5e-56
