The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016020	Bacillus weihaiensis strain Alg07 chromosome, complete genome	4344873	1525851	1532758	4344873		Staphylococcus_phage(50.0%)	9	NA	NA
WP_072579333.1|1525851_1526286_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	46.0	3.1e-17
WP_072579334.1|1526830_1527478_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.7	8.0e-41
WP_072579335.1|1527515_1528709_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.5	2.3e-110
WP_072579336.1|1528765_1529233_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.7	1.1e-44
WP_072579337.1|1529374_1529743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072581788.1|1530050_1530572_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_072579338.1|1531009_1531105_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_099092745.1|1531410_1532157_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.4	1.2e-08
WP_072579340.1|1532161_1532758_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	1.8e-15
>prophage 2
NZ_CP016020	Bacillus weihaiensis strain Alg07 chromosome, complete genome	4344873	2174513	2182633	4344873		Bacillus_virus(66.67%)	7	NA	NA
WP_072579905.1|2174513_2175935_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	29.0	1.6e-17
WP_072579906.1|2176296_2177661_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_072579907.1|2178010_2178730_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	79.7	1.5e-48
WP_072579908.1|2178901_2179681_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	39.4	9.6e-33
WP_072579909.1|2179703_2180252_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.5	1.3e-28
WP_072579910.1|2180319_2181813_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.7	1.1e-114
WP_072579911.1|2181814_2182633_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	66.3	5.8e-97
>prophage 3
NZ_CP016020	Bacillus weihaiensis strain Alg07 chromosome, complete genome	4344873	3055448	3091552	4344873	portal,integrase,holin,coat	Bacillus_phage(28.57%)	43	3051868:3051916	3067921:3067969
3051868:3051916	attL	GATGATCCGAGAGGGATTCGAACCCCCGACCCCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_083584504.1|3055448_3056696_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_072580644.1|3056829_3058431_-	DNA packaging protein	NA	A0A2I7RNR6	Vibrio_phage	26.2	6.6e-28
WP_072580645.1|3058474_3058870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580646.1|3058869_3059094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580647.1|3059347_3060301_-	hypothetical protein	NA	A0A0H3V0V6	Geobacillus_virus	45.5	4.9e-71
WP_072580648.1|3060345_3060525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145925802.1|3060584_3061454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580650.1|3061704_3061878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072580651.1|3061946_3062819_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_072580652.1|3062898_3063315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580653.1|3063398_3063617_-|holin	holin	holin	NA	NA	NA	NA
WP_072580654.1|3064299_3065529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580655.1|3066261_3066492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580656.1|3066506_3066764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580657.1|3066760_3066877_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_072580658.1|3066888_3067803_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.8	5.4e-27
WP_072580659.1|3068190_3070146_-	TRAP transporter permease	NA	NA	NA	NA	NA
3067921:3067969	attR	GATGATCCGAGAGGGATTCGAACCCCCGACCCCTACCCTGTCAAGGTAG	NA	NA	NA	NA
WP_072580660.1|3070135_3070645_-	DUF1850 domain-containing protein	NA	NA	NA	NA	NA
WP_072580661.1|3070707_3071715_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_072580662.1|3071811_3072789_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_072580664.1|3073068_3074229_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_072580665.1|3074215_3075340_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.9	5.0e-14
WP_072580666.1|3075831_3076404_-	SCO family protein	NA	NA	NA	NA	NA
WP_072580667.1|3076413_3077412_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_072580668.1|3077430_3078186_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072580669.1|3078169_3078958_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.6e-30
WP_072580670.1|3079353_3079635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580671.1|3079805_3080534_+	esterase family protein	NA	NA	NA	NA	NA
WP_072580672.1|3080660_3081179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072580673.1|3081179_3081605_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072580674.1|3082019_3082700_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_072580675.1|3082916_3083162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580676.1|3083333_3085616_+	ATP-dependent helicase	NA	S5M596	Bacillus_phage	34.6	2.1e-83
WP_072580677.1|3085687_3085942_-	sporulation protein	NA	NA	NA	NA	NA
WP_072580678.1|3086167_3086293_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_072580679.1|3086375_3086588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072580680.1|3086584_3087292_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_083584505.1|3087538_3088324_+	vanadium-dependent haloperoxidase	NA	A0A1V0SGK0	Hokovirus	33.3	4.5e-06
WP_072580682.1|3088725_3089076_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_072580683.1|3089397_3089817_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_072580684.1|3089865_3090150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072580685.1|3090244_3090733_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_072580686.1|3091075_3091552_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP016020	Bacillus weihaiensis strain Alg07 chromosome, complete genome	4344873	3832333	3842791	4344873		Synechococcus_phage(37.5%)	11	NA	NA
WP_072581291.1|3832333_3833374_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	43.8	1.6e-67
WP_072581292.1|3833434_3834850_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	2.9e-51
WP_072581293.1|3834825_3837054_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	4.4e-163
WP_072581294.1|3837037_3837721_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_072581295.1|3837717_3837972_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	37.3	6.5e-07
WP_099092788.1|3837959_3838691_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	41.7	7.6e-48
WP_072581296.1|3838832_3840125_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.8	5.0e-18
WP_072581297.1|3840140_3841268_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_072581298.1|3841254_3841743_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.6	4.8e-22
WP_072581299.1|3842038_3842239_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_072581300.1|3842368_3842791_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	65.5	3.1e-38
>prophage 1
NZ_CP016021	Bacillus weihaiensis strain Alg07 plasmid unnamed, complete sequence	16403	3672	13736	16403	integrase	Bacillus_phage(28.57%)	13	1988:2001	4876:4889
1988:2001	attL	TTTTCCCATTGTTC	NA	NA	NA	NA
WP_072581982.1|3672_4536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	29.4	1.1e-08
WP_158515123.1|4577_4730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072581983.1|4760_5168_-	hypothetical protein	NA	NA	NA	NA	NA
4876:4889	attR	TTTTCCCATTGTTC	NA	NA	NA	NA
WP_072581984.1|5716_6289_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_083584526.1|6527_6758_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	46.9	3.2e-05
WP_083584525.1|6956_7550_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	43.7	6.9e-07
WP_072581985.1|7882_8560_-	hypothetical protein	NA	Q0H249	Geobacillus_phage	60.5	5.5e-69
WP_072581986.1|8540_9713_-	AAA family ATPase	NA	Q0H250	Geobacillus_phage	42.6	1.9e-80
WP_145925833.1|9724_10057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072581988.1|10421_10646_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	43.1	4.6e-12
WP_158515124.1|10870_11026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072581999.1|11109_11538_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_072581989.1|11621_13736_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	60.8	1.7e-31
