The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013290	Janibacter indicus strain YFY001 chromosome, complete genome	3401189	2255516	2264840	3401189		Saccharomonospora_phage(16.67%)	10	NA	NA
WP_072625110.1|2255516_2257277_-	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	37.5	1.1e-87
WP_083546125.1|2257325_2258123_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_072625111.1|2258131_2258440_-	DUF3039 domain-containing protein	NA	A0A160DF89	Gordonia_phage	42.5	1.4e-06
WP_072625112.1|2258566_2259124_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_072626280.1|2259133_2260870_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.6	8.7e-34
WP_072626281.1|2261140_2261512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625113.1|2261575_2261950_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	51.2	2.3e-16
WP_072625114.1|2262052_2262223_+	CsbD family protein	NA	NA	NA	NA	NA
WP_072625115.1|2262882_2263365_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	1.0e-32
WP_072625116.1|2263457_2264840_-	peptidoglycan DD-metalloendopeptidase family protein	NA	S5M424	Bacillus_phage	37.4	6.7e-13
>prophage 2
NZ_CP013290	Janibacter indicus strain YFY001 chromosome, complete genome	3401189	3194512	3301920	3401189	transposase,holin,protease,integrase	Mycobacterium_phage(13.04%)	93	3184410:3184432	3310146:3310168
3184410:3184432	attL	TCGAGGCTCCTTCGTCGCACCTC	NA	NA	NA	NA
WP_072625886.1|3194512_3195319_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_072625887.1|3195465_3196491_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072626378.1|3196595_3197273_+	sprT domain-containing protein	NA	H9NCM0	Mycobacterium_phage	43.2	1.3e-25
WP_072626379.1|3197391_3197613_+	mycoredoxin	NA	NA	NA	NA	NA
WP_072625888.1|3197614_3198409_+	GTPase domain-containing protein	NA	NA	NA	NA	NA
WP_094078856.1|3198440_3199709_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_094078913.1|3199705_3201082_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_072625889.1|3201119_3201890_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072625890.1|3201889_3203146_-	glutaminase	NA	NA	NA	NA	NA
WP_072625891.1|3204134_3204542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072626382.1|3204545_3205715_-	ribonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	38.2	3.0e-22
WP_072625892.1|3205985_3207023_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	41.5	1.4e-66
WP_072625893.1|3207299_3207779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625894.1|3207775_3208741_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	39.1	8.8e-28
WP_072626383.1|3208893_3209514_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_072626384.1|3209892_3210588_+	cell wall lytic activity	NA	A0A2P1CIC9	Actinomyces_phage	40.6	9.2e-11
WP_072625895.1|3210936_3211785_+	cell wall lytic activity	NA	A0A2P1CIC9	Actinomyces_phage	37.0	8.1e-09
WP_072625896.1|3211926_3213666_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.1	1.2e-38
WP_072625897.1|3213717_3214299_-	class F sortase	NA	NA	NA	NA	NA
WP_072625899.1|3215637_3216309_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072626385.1|3216308_3217499_+	winged helix DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072625900.1|3217532_3218951_-	protein kinase	NA	NA	NA	NA	NA
WP_072625901.1|3219086_3219488_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_094078857.1|3219719_3221129_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072625902.1|3221135_3221927_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_072625903.1|3222034_3223585_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.3	5.4e-35
WP_072625904.1|3223581_3224190_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072625905.1|3224351_3225083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625906.1|3225151_3225496_+	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_083546226.1|3225570_3228867_-	hypothetical protein	NA	A0A0P0CJA9	Ostreococcus_lucimarinus_virus	30.3	1.1e-42
WP_072625907.1|3229072_3229705_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_072625908.1|3229877_3230762_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.1	8.6e-54
WP_007929433.1|3230839_3231178_-	zinc finger, DksA/TraR C4-type	NA	NA	NA	NA	NA
WP_072625909.1|3231310_3232390_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_072625910.1|3232582_3232885_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_072625911.1|3232881_3233451_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_072625912.1|3233452_3234619_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_125932881.1|3234744_3236943_+	DUF4185 domain-containing protein	NA	NA	NA	NA	NA
WP_072625914.1|3237162_3237873_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_072625915.1|3238215_3238782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094078914.1|3238849_3239452_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.6	2.2e-08
WP_125932882.1|3240093_3240450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625920.1|3240666_3240927_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	62.3	5.1e-15
WP_072625921.1|3240932_3242078_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164513616.1|3242174_3243068_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	52.6	8.6e-62
WP_072625922.1|3242997_3243351_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	50.5	5.7e-17
WP_094078859.1|3243671_3244942_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	35.9	3.0e-31
WP_072625925.1|3245006_3246359_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.9	6.3e-32
WP_083546228.1|3246231_3247017_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.3	2.2e-13
WP_083546230.1|3247356_3247659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125932883.1|3247761_3248202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625929.1|3248417_3248813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625930.1|3248840_3249278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164513617.1|3249647_3251327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625932.1|3251347_3252685_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_083546340.1|3252883_3253420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625934.1|3253499_3253919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094078915.1|3253929_3255765_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.6	3.2e-127
WP_094078861.1|3256245_3257516_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	36.3	1.0e-31
WP_072626112.1|3257946_3259071_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_164513618.1|3260587_3261541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625582.1|3261870_3263115_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.6	2.2e-79
WP_072625938.1|3263379_3264123_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_072625941.1|3265897_3267022_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_159451236.1|3267006_3267342_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_072626390.1|3267328_3267736_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_072625942.1|3267740_3268103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625943.1|3268277_3268550_+	DUF4235 domain-containing protein	NA	NA	NA	NA	NA
WP_072625944.1|3268960_3269671_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013599792.1|3272016_3273162_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072625946.1|3273512_3274337_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_072625947.1|3274363_3275155_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072625948.1|3275156_3276149_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	5.0e-18
WP_072625949.1|3276279_3277275_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_125932884.1|3278073_3278643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125932885.1|3279499_3279895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625951.1|3279982_3281044_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_072625952.1|3281054_3284255_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_072625953.1|3284254_3285472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625954.1|3285471_3287244_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	2.6e-33
WP_083546235.1|3287335_3287845_-	Abi family protein	NA	NA	NA	NA	NA
WP_072625956.1|3287751_3288141_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_072625957.1|3288137_3288548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625958.1|3288683_3290264_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_072625959.1|3290281_3290734_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_072625960.1|3290991_3291528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072625961.1|3291509_3292772_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	40.3	2.1e-69
WP_072625962.1|3293542_3294685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625963.1|3294731_3296462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625964.1|3296433_3297882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625965.1|3297878_3298982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072625966.1|3298978_3301303_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_083546236.1|3301299_3301920_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
3310146:3310168	attR	GAGGTGCGACGAAGGAGCCTCGA	NA	NA	NA	NA
