The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018155	Tenacibaculum todarodis strain LPB0136 chromosome, complete genome	3019213	1885761	1948679	3019213	protease,transposase,integrase	Staphylococcus_phage(25.0%)	54	1907727:1907746	1952714:1952733
WP_072555919.1|1885761_1886829_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.6	2.7e-30
WP_158009622.1|1887233_1887395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072556954.1|1887544_1888066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555920.1|1888223_1889069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555921.1|1889239_1891225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083426204.1|1891399_1892407_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_072555922.1|1892565_1893144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555923.1|1893354_1895097_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_072555924.1|1895284_1896568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158009623.1|1896771_1898001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162272276.1|1898365_1900588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555927.1|1900814_1901528_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_072554704.1|1901691_1902684_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072555928.1|1902903_1903320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158009625.1|1903316_1903985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555930.1|1904040_1904400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555931.1|1904411_1904966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555932.1|1904993_1905503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555933.1|1905662_1906742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555934.1|1907201_1907642_+	hypothetical protein	NA	NA	NA	NA	NA
1907727:1907746	attL	GAAAATCCTCGCGGATTTTC	NA	NA	NA	NA
WP_072555935.1|1907857_1908100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555936.1|1908090_1908408_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_072555937.1|1908785_1909469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555938.1|1910135_1910801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555939.1|1911122_1912391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555940.1|1912629_1913217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555941.1|1913384_1915343_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072555942.1|1915665_1916760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555943.1|1916908_1917799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072554704.1|1917966_1918959_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_072555944.1|1919179_1919656_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_072555945.1|1919806_1920610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162272277.1|1920796_1921273_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_072555947.1|1921604_1922147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072554704.1|1922314_1923307_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158009626.1|1923542_1923995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555950.1|1924492_1925134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072555951.1|1925271_1925712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158009627.1|1925961_1926129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072555953.1|1927147_1928173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072556956.1|1928238_1931067_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_072555954.1|1931068_1932283_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.4	1.7e-28
WP_072555955.1|1932286_1933888_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.9	9.8e-157
WP_072555956.1|1933997_1934891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072555957.1|1934896_1935181_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072555958.1|1935282_1937331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072555959.1|1937334_1938552_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.0	9.8e-16
WP_083426207.1|1938943_1939990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072555961.1|1941390_1942527_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	A0A0C5K8U0	Enterococcus_phage	25.9	1.7e-14
WP_072555962.1|1942653_1942992_-	gliding motility protein GldC	NA	NA	NA	NA	NA
WP_072555963.1|1942991_1943951_-	gliding motility lipoprotein GldB	NA	NA	NA	NA	NA
WP_072555964.1|1944098_1944887_+	NAD(+) synthase	NA	A0A0K0KVL1	Prochlorococcus_phage	49.4	6.3e-56
WP_072555965.1|1945348_1947367_-	DNA primase	NA	A0A1B0WMR3	Flavobacterium_phage	34.5	4.2e-56
WP_072555966.1|1947440_1948679_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	51.5	1.5e-109
1952714:1952733	attR	GAAAATCCTCGCGGATTTTC	NA	NA	NA	NA
