The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	3297	85479	2263382	tRNA,transposase	Streptococcus_phage(23.53%)	57	NA	NA
WP_003612150.1|3297_4605_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.0	2.0e-91
WP_035165238.1|4762_5326_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003616015.1|5339_6206_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_072538165.1|12055_13105_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_013438997.1|13235_14519_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_072538166.1|14776_16000_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.3e-97
WP_035165234.1|16429_17032_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_035165232.1|17110_17830_-|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_016396985.1|17906_18776_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016396975.1|19082_20084_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003616007.1|20102_21032_+	carbamate kinase	NA	NA	NA	NA	NA
WP_035165231.1|21195_22419_+	arginine deiminase	NA	NA	NA	NA	NA
WP_035164983.1|24161_25211_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538167.1|26759_28127_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_013438997.1|28282_29566_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_003616000.1|31094_32264_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003611152.1|32256_33306_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003615999.1|33298_34312_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_035165229.1|34330_36403_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	1.8e-139
WP_002876914.1|36457_36691_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_035165228.1|36757_39127_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.2	3.9e-77
WP_003611142.1|39149_39611_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.6	7.9e-43
WP_011544204.1|39776_40145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615992.1|40144_40621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165225.1|40632_41868_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003615989.1|41867_42548_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	1.2e-15
WP_003615988.1|42550_42718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160962.1|42915_43098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|43090_43438_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|43493_43727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|43683_45027_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_016396090.1|45228_45453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538168.1|45424_47176_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035165222.1|48818_50702_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003615985.1|50785_51568_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165218.1|51776_52265_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_035165217.1|52437_52932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035165215.1|53142_53922_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.2	5.0e-13
WP_035165213.1|53931_55095_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003615977.1|55075_56290_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	1.5e-88
WP_003615975.1|56276_56717_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_016396957.1|56717_58145_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_035165211.1|58230_59445_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|60885_62064_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_078256838.1|62126_62306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172822841.1|68893_70375_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035165207.1|70859_72239_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_035165205.1|73129_74131_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_035165203.1|74149_74962_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_035165202.1|74990_75905_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003615959.1|75914_76283_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_035165200.1|76906_78277_-	amino acid permease	NA	NA	NA	NA	NA
WP_035165198.1|78469_79312_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_016396850.1|79504_80494_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.0	3.3e-54
WP_035165197.1|80573_83714_-	DUF3427 domain-containing protein	NA	A0A0A1ENT0	Lactobacillus_phage	29.4	3.0e-32
WP_016396848.1|83852_84161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078256804.1|84216_85479_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
>prophage 2
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	161609	214286	2263382	tRNA,transposase	unidentified_phage(30.0%)	45	NA	NA
WP_035164396.1|161609_162659_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003611827.1|162839_164228_+	amino acid permease	NA	NA	NA	NA	NA
WP_002876384.1|164431_165283_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_035165156.1|165306_165867_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035162569.1|165878_167597_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	2.1e-19
WP_016396785.1|167589_168417_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_035165520.1|168846_170241_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003615835.1|171917_172421_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_118979685.1|172512_172728_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_016396782.1|174074_174506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165157.1|174769_175891_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_035164983.1|176782_177832_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035165160.1|178659_179727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165162.1|179741_180923_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_035165164.1|180919_182140_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003615813.1|182180_182705_-	NUDIX hydrolase	NA	A0A1S6L1P8	Vibrio_phage	28.6	3.9e-06
WP_016396775.1|182836_184456_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002876367.1|184829_185198_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013440010.1|185199_185898_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.8e-14
WP_016396774.1|185897_186734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876356.1|186878_188381_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_035162587.1|188462_189488_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_072538176.1|189602_190652_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	8.1e-43
WP_035165137.1|190858_191734_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	35.7	6.4e-09
WP_035162591.1|193049_193616_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_035165136.1|193758_195183_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.4	1.4e-53
WP_002876476.1|195175_195619_+	ribonuclease iii family protein	NA	NA	NA	NA	NA
WP_035165133.1|195605_196355_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016396767.1|196466_197036_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002876482.1|197103_197319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615790.1|198341_200093_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_002876495.1|200268_200418_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003615789.1|200424_200595_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002876498.1|200686_201241_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002876501.1|201366_201792_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003615785.1|201875_202571_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_035162599.1|202733_203738_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_101868787.1|205077_205296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165129.1|205315_205717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876508.1|205977_206487_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002876509.1|206539_206905_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_013439993.1|208933_209206_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	1.1e-25
WP_095582936.1|209770_210973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013440320.1|211642_212821_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_078256804.1|213023_214286_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
>prophage 3
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	239297	301469	2263382	tRNA,transposase	unidentified_phage(13.64%)	48	NA	NA
WP_035164983.1|239297_240347_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_003615746.1|240549_241080_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002876548.1|241097_241820_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003615744.1|241824_242355_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615743.1|242357_243398_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	36.3	8.5e-53
WP_035165111.1|243464_245381_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	1.1e-58
WP_035165109.1|245672_246359_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002876557.1|246514_246799_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	44.1	1.9e-15
WP_003615736.1|246821_248435_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.0	1.5e-160
WP_003615735.1|248573_251144_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	25.7	7.1e-40
WP_016396738.1|251143_253114_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.5	2.6e-50
WP_035162520.1|253123_253717_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003615731.1|253731_254742_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.3	7.9e-11
WP_016396737.1|254830_255226_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_016396736.1|255319_256768_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	31.2	9.4e-58
WP_035165108.1|256767_257883_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_003615726.1|257945_258905_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003615724.1|258897_260259_+	DEAD/DEAH box helicase	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.4	1.4e-47
WP_003615721.1|260497_263131_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.2	7.9e-63
WP_003615719.1|263196_263454_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002876575.1|263453_263882_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016396732.1|263884_264208_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_035162552.1|264274_266635_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.4e-21
WP_035164396.1|266759_267809_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_016396729.1|267980_268292_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.9	1.1e-19
WP_013438997.1|268360_269644_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_016396728.1|269877_270273_-	YslB family protein	NA	NA	NA	NA	NA
WP_003615712.1|270511_271132_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.5	1.8e-10
WP_016396727.1|271173_272025_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016396726.1|272156_272576_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_035162517.1|272598_272976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165107.1|273376_274483_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003615703.1|274635_275637_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002876592.1|275743_276076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035162512.1|276086_277517_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_035162510.1|277464_278010_+	YutD family protein	NA	NA	NA	NA	NA
WP_035165105.1|278006_278777_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_002876598.1|278773_279379_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_016396720.1|279450_280110_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_078256836.1|280144_281071_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	21.9	2.0e-08
WP_035165099.1|287448_288645_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	1.1e-141
WP_035162207.1|288707_290156_+	MFS transporter	NA	NA	NA	NA	NA
WP_035164983.1|290362_291412_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_003615690.1|291760_294175_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.7	0.0e+00
WP_035165096.1|294269_295889_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_072538183.1|296086_297370_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	6.4e-58
WP_035162216.1|297704_300119_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.8	3.0e-125
WP_013440320.1|300290_301469_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	312123	356069	2263382	tRNA,transposase	Streptococcus_phage(25.0%)	38	NA	NA
WP_072538184.1|312123_313302_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072538185.1|314246_314630_+	sortase	NA	NA	NA	NA	NA
WP_035165082.1|314804_315509_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003615669.1|315634_316546_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_002879784.1|316640_317489_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_035162231.1|317629_319717_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_016396947.1|319758_320112_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_013439938.1|320114_321320_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_072538186.1|321316_323743_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003613948.1|323735_324686_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_035165513.1|325030_325393_+	shikimate kinase	NA	NA	NA	NA	NA
WP_172822842.1|325302_326022_+	chorismate synthase	NA	NA	NA	NA	NA
WP_035162242.1|326103_327027_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_035162245.1|327153_327777_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	26.0	8.5e-08
WP_013439932.1|327766_328489_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_035162250.1|328752_329682_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003615649.1|329761_330112_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_025895565.1|330128_330566_-	HIT family protein	NA	Q19XP5	Mycobacterium_phage	32.6	3.9e-07
WP_035162252.1|330669_331410_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	3.0e-20
WP_002879805.1|331402_332620_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002879806.1|332696_333353_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002879808.1|333431_333752_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003611557.1|333774_334422_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_013439927.1|334540_335860_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_013439924.1|336622_336847_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_013440320.1|337665_338844_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035160962.1|339637_339820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|339812_340160_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|340215_340449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|340405_341749_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_035165075.1|342201_343383_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	35.9	5.2e-46
WP_095582932.1|343755_344958_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035165071.1|345146_346070_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	64.7	1.8e-107
WP_072538176.1|346160_347210_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	8.1e-43
WP_035165069.1|347364_348147_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003615571.1|349737_352116_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_035165068.1|352603_354742_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	45.6	1.6e-98
WP_013440320.1|354890_356069_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	390377	437708	2263382	tRNA,transposase,protease	Prochlorococcus_phage(20.0%)	41	NA	NA
WP_003611980.1|390377_391325_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	4.8e-10
WP_035165046.1|391314_392631_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_072538191.1|392636_393392_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_035165045.1|393381_395388_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	26.3	3.7e-20
WP_035165043.1|395388_396282_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003615506.1|396311_396995_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003615505.1|397190_397328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003618477.1|397559_397802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538192.1|397798_398509_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_072538193.1|398668_399703_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	3.6e-43
WP_035165041.1|399910_401482_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	3.2e-11
WP_003615500.1|401582_401768_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002879711.1|401943_402306_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_035161987.1|402325_403990_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_003615494.1|403989_406029_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_002879716.1|406054_407047_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003615490.1|407108_407351_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	55.2	5.6e-08
WP_035164983.1|407523_408573_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_013440320.1|408762_409941_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538195.1|410520_411744_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_072538196.1|411866_413120_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035162293.1|413313_414306_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_035162291.1|414522_414864_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_016396904.1|415056_415986_+	DegV family protein	NA	NA	NA	NA	NA
WP_035162289.1|416074_416875_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	2.9e-61
WP_035164347.1|416920_417220_-	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	A0A218MNE0	uncultured_virus	66.7	5.0e-06
WP_035164349.1|419302_419674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164351.1|419774_420995_-	MFS transporter	NA	NA	NA	NA	NA
WP_016396909.1|421245_422583_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016396910.1|422720_423977_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_035164353.1|423982_424900_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003614167.1|424980_425382_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003614169.1|425444_425672_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_003614162.1|425671_426343_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003615603.1|426335_426908_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002879260.1|426961_427111_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016396914.1|427197_429312_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003615605.1|429397_431980_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003615606.1|433688_434177_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_035164357.1|434247_436659_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003615610.1|436658_437708_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.9	1.1e-31
>prophage 6
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	470816	609131	2263382	tRNA,integrase,transposase,protease	Streptococcus_phage(20.51%)	114	540488:540547	607708:609292
WP_072538199.1|470816_471995_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_035165038.1|472133_473900_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172822843.1|474072_475815_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002879727.1|475939_476635_+	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	34.1	5.2e-22
WP_035165036.1|476634_480195_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003615484.1|480197_481469_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_035165034.1|481504_481687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615482.1|481738_482080_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003615481.1|482081_483512_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002879737.1|483605_483878_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003615480.1|483939_484443_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003615479.1|484442_485174_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_035165031.1|485193_488751_+	DEAD/DEAH box helicase	NA	M1GYP4	Paramecium_bursaria_Chlorella_virus	29.3	1.6e-37
WP_003612033.1|488872_489220_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003615476.1|489486_491337_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_035165029.1|491468_493367_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003615467.1|493366_494689_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_035165027.1|494712_496947_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_003615463.1|497003_497537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165026.1|497732_498593_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003615459.1|498699_499548_-	sugar transporter	NA	NA	NA	NA	NA
WP_002876773.1|499747_500368_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	58.2	1.9e-15
WP_072538167.1|500454_501822_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035165024.1|502038_502275_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_002876770.1|502387_502612_+	YneF family protein	NA	NA	NA	NA	NA
WP_003615455.1|502722_504483_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	4.8e-48
WP_035162034.1|504475_506266_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.4	1.6e-22
WP_003615452.1|506314_506749_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_035161955.1|506888_508037_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003615450.1|508029_509244_+	aspartate kinase	NA	NA	NA	NA	NA
WP_035161952.1|509244_510231_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003615448.1|510312_510927_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003615447.1|510997_512008_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003615446.1|512171_512933_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003615444.1|512995_514024_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002876740.1|514173_514899_+	UMP kinase	NA	NA	NA	NA	NA
WP_003615442.1|514898_515456_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_035165022.1|515458_516190_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.2	2.4e-17
WP_002876734.1|516195_516993_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_013439810.1|517002_518250_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_035165020.1|518289_519987_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_072538200.1|519999_524337_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.6	9.8e-18
WP_002876725.1|524445_524922_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_035165016.1|524941_526093_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002876722.1|526102_526402_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002876720.1|526428_526713_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_013439807.1|526717_529195_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.9	2.3e-19
WP_002876717.1|529207_529570_+	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_003615423.1|529620_530517_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_049768352.1|531412_531826_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035165013.1|532072_532630_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_003615419.1|532595_533780_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_035161940.1|533801_534713_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	2.8e-60
WP_072538202.1|535696_536875_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_076612173.1|537773_539036_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_013440320.1|539247_540426_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
540488:540547	attL	GAGATGAAGCCAATGCCGTGCGTCTTTTGGACACATGATGTCGTAAATAAAACTGGCAGC	NA	NA	NA	NA
WP_072538204.1|540669_541893_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	3.0e-97
WP_052109142.1|543545_543962_+	Arm DNA-binding domain-containing protein	NA	A0A1B0T6A8	Bacillus_phage	29.7	3.1e-06
WP_072538334.1|545469_546063_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	39.6	6.0e-35
WP_003615411.1|546176_547118_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	35.1	1.8e-09
WP_035161325.1|547253_548297_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_035161323.1|548308_548908_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_035165012.1|548969_550814_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	1.0e-141
WP_003615404.1|550896_552036_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	25.9	3.1e-16
WP_013439791.1|552157_553996_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	1.5e-20
WP_003615401.1|553976_554678_+	class A sortase	NA	NA	NA	NA	NA
WP_035165010.1|554674_556951_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.4	4.7e-72
WP_035161317.1|556940_557468_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.8	6.5e-25
WP_003615398.1|557547_557850_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003615397.1|557961_558849_+	cation transporter	NA	NA	NA	NA	NA
WP_002876681.1|559050_560076_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016396499.1|560192_561326_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_035165008.1|561434_562382_-	LCP family protein	NA	NA	NA	NA	NA
WP_035164407.1|564381_565725_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|565681_565915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|565970_566318_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|566310_566493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615387.1|567162_568017_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615385.1|568064_569567_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_172586620.1|569587_570319_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.9	1.2e-29
WP_003615383.1|570836_571445_+	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_002879863.1|571701_572979_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	51.4	9.3e-110
WP_035161302.1|573286_574123_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	39.7	5.6e-47
WP_003615376.1|574218_574806_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_035161299.1|575078_575876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615372.1|575946_576849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538205.1|577135_578170_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	6.1e-43
WP_035165003.1|578482_580216_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.6e-38
WP_035161295.1|580212_581985_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	2.3e-50
WP_003615366.1|582461_582653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165502.1|582751_583048_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002880208.1|583121_583367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165001.1|583401_584301_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.5	9.6e-53
WP_072538167.1|584361_585729_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164999.1|585888_587079_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	33.6	5.2e-46
WP_072538196.1|587251_588505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538195.1|588627_589851_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_072538207.1|590439_591489_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	4.0e-42
WP_072538208.1|591602_592283_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002880203.1|592418_593264_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
WP_003613715.1|593267_593498_+	YozE family protein	NA	NA	NA	NA	NA
WP_003615353.1|593572_594430_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_035164995.1|594419_595190_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.0	2.0e-27
WP_003615351.1|595280_596120_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003615350.1|596246_598421_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.9	1.0e-92
WP_035164994.1|598552_599872_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_072538209.1|599871_600759_+	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	31.5	2.5e-21
WP_003613136.1|600867_601401_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003615348.1|601403_602798_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IEP8	Erwinia_phage	27.8	4.0e-37
WP_035164992.1|602883_603780_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_130137519.1|604344_604653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164985.1|605244_605952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538204.1|606361_607585_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	3.0e-97
WP_035164983.1|608081_609131_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
607708:609292	attR	GCTGCCAGTTTTATTTACGACATCATGTGTCCAAAAGACGCACGGCATTGGCTTCATCTCCACTTTATATAGTAAAAGAAAAAGTGTTGAACGACTACTCCGTCGAGTAATCATCCAACACCAGATTAGTATGTTTTGTTTTTTCTATCTTTCTTGCCCTTTTCTTTTCTCAGCTTGTCTGCCTTGACCAGGCAGGTGGAGAAGGCTAAACTTATTAGTTAAGTTGATTAATTTTTTTCGCCGATTGTAAAATTAAACTGAACACTGTTCCGATCCAGTAAGAAAAATCGTTTTCACTGGATTAGAGCACAAAAAATCCATTTCAACCATCTGGTAGAATATGAATTACCACAAACATTTCTAGAGAGGTTAAAATGGATCATTCATATTCTAACACTAAACCACACCAAAAGGGCAAGCACCTTACGCTAAACGACCGGACTACAATCCAGGAGCTGCACTCTAAGGGCTACTCTAATCGTGCTATAGCTAGAGAACTTAACTGCTCACCAAGCACGGTCGGATATGAGCTCAAAAGAGGCACAGTATCCGTGTATACCGGCAATGTGAAGCGGTATAAAGCTGTCGAAGGGCAAAGCACTTACGAACTACATAGAAGCGAATGCGGCCGCAAGAGCTTGTTTCTTCGCAGACATAAGTTCATCGACTATGTTTCCCACTGCTTCCATAATCGAGGCTGGTCTCTTGATGCTTGCGTGGGTTATGCTTTGGCCAAGGGAATCTTCCAGAAGGATCAGGTCGTATCAACCAAAACTCTGTATAACTACGTTGACTTGGGCCTAATGGATATCAAGAACGGTGATCTTCCAGAGAAGGTCAAGCGCAATACTAAGACTCGTCGTGCCCGTGTAAACAAGCGTATCCTGGGACGAAGCATCGATGAACGTAGTCCTAGAATCGAAAGCCGTAAGGACTTTGGTCACTGGGAATGCGATCTGGTTCTTGGACACAAGACTAAGGACGACGATGTGTTGCTTACTCTGTGCGAACGAAAGACGCGTCAGTTCTTCATGATCAAGATCGAGGATAAGACCTCAGCTAGAGTTATGAAGGCATTTGATAAGCTTCGAGAGTACTACGGATCCAAATGGAATCAAATCTTTAAGTCTATCACAACCGACAACGGATCTGAGTTCGCAGATCTATCCGATCTTGAACAAGTTTCCAAGACTCTTGTGTACTACGCTCACCCTTATACATCCTGTGATAAAGGCAGCGTAGAACGGCACAACGGGCTTATCAGACGCTATATTCCCAAGGGAGACCGTATGGATAAGTATAGTGTGGAAGATATTGCTAAGATCGAGGTATGGTGCAACTCTCTTCCTCGGAAGATCTTAAACTACAAGACTCCAGAAGAGTACTTTGACACCGAACTTGACCGCATTTACCGGCGTAGATAGTCAAAATCTGCCAGATGTTATGGTAAGTGTTCAATTTATTCTTGCAATTGGCGGATTAATTTTTTTAGAAAAAAAGCTGAGGTAAAAGCGTGAACGGATTAATTAAAGCAAGCGATGTCAATCAAGCCGGCCACCTGCAGATTGCCGGGGTAGATGCCCTG	NA	NA	NA	NA
>prophage 7
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	619745	692152	2263382	tRNA,integrase,transposase	Vibrio_phage(13.33%)	51	655747:655806	681784:681851
WP_003615321.1|619745_620657_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_035164978.1|620649_622716_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_035161268.1|622747_624586_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.4	2.3e-56
WP_003615317.1|624557_625676_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.8	1.2e-36
WP_003613006.1|625717_626839_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.4	5.8e-39
WP_035164975.1|626874_628011_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.5	3.9e-35
WP_035164409.1|628168_628351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|628343_628691_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|628746_628980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|628936_630280_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013440320.1|630403_631582_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003612998.1|631782_631905_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617847.1|631911_632157_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_143434649.1|632367_633773_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	2.4e-42
WP_072538214.1|635353_636544_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155760731.1|636567_636714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164970.1|637406_638492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164969.1|638425_638746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164968.1|638972_640355_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	33.7	8.1e-51
WP_035164983.1|641258_642308_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_013440320.1|645699_646878_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_011543955.1|649015_649639_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|651281_652460_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|654508_655687_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
655747:655806	attL	TTTTTATACCCAATTGGAATTTAGTTTAAGGAACTGTTCATCCTTACACATAAAATTATA	NA	NA	NA	NA
WP_003615282.1|657541_657874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160962.1|658191_658374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|658366_658714_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|658769_659003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|658959_660303_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538218.1|661314_661647_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	44.2	1.3e-15
WP_035164960.1|661692_662499_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_016396558.1|662498_662939_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_002878610.1|663084_663777_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035164957.1|663769_664567_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_035164956.1|664610_665849_+	peptidase T	NA	NA	NA	NA	NA
WP_002878604.1|666235_666427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615265.1|666496_667063_-	signal peptidase I	NA	NA	NA	NA	NA
WP_035164955.1|667106_667943_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_052109140.1|668163_668475_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035164953.1|668543_669134_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_035164951.1|670771_672655_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_035164949.1|672658_675682_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.4	2.8e-136
WP_051112117.1|675724_676732_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	6.8e-15
WP_035164946.1|676797_678096_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.6	2.1e-53
WP_016396563.1|678171_679188_-	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_035161213.1|679555_680170_-	DedA family protein	NA	NA	NA	NA	NA
WP_035164945.1|680603_681104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161211.1|681184_681688_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164942.1|681942_687672_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	30.8	6.4e-09
681784:681851	attR	TATAATTTTATGTGTAAGGATGAACAGTTCCTTAAACTAAATTCCAATTGGGTATAAAAATTTATTTA	NA	NA	NA	NA
WP_035164940.1|687974_689147_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_072538219.1|691045_692152_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.0	3.0e-88
>prophage 8
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	700279	759458	2263382	integrase,transposase,protease	unidentified_phage(33.33%)	50	747295:747354	758354:759595
WP_003615229.1|700279_701032_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003615228.1|701110_701722_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_002880372.1|701869_702067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164935.1|702176_702917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615224.1|702916_703891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538220.1|703883_705308_+	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_035164933.1|705352_706201_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002880363.1|706247_706442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164983.1|711191_712241_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035164931.1|713044_713779_+	methylase	NA	A0A126HHW9	Vibrio_phage	36.3	4.2e-06
WP_035164929.1|714590_715364_+	YdcF family protein	NA	NA	NA	NA	NA
WP_035164926.1|715377_715881_+	DUF4256 domain-containing protein	NA	NA	NA	NA	NA
WP_035164924.1|715900_716569_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_072538195.1|717028_718252_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_035164922.1|718573_719014_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164920.1|719026_719461_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_035164918.1|719588_720920_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016396592.1|721282_721633_+	VWA domain containing CoxE-like protein	NA	NA	NA	NA	NA
WP_016396593.1|721641_722910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538223.1|722956_723943_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_035164916.1|723944_725318_-	aspartate kinase	NA	NA	NA	NA	NA
WP_003615201.1|725830_726544_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164914.1|726604_727759_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_072538224.1|727782_728712_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_035164911.1|728714_729494_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_035164909.1|729530_730712_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003614261.1|730828_731416_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	9.1e-28
WP_035164907.1|731447_731984_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003615189.1|732209_732767_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035164396.1|732975_734025_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_002880312.1|734714_734921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165380480.1|735211_735388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615178.1|736285_737206_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003615177.1|737198_737744_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076612173.1|738425_739688_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_035161164.1|739753_741628_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003615174.1|741650_742403_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	9.3e-33
WP_016396605.1|743105_743504_-	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.9	2.4e-11
WP_172822838.1|743516_743927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396607.1|744085_744550_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_016396608.1|744766_745627_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035164903.1|745623_746538_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.8	7.8e-26
WP_072538225.1|746842_747319_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
747295:747354	attL	TACGCCAATTGCAAGAATAAATTGAACACTTACCATAACATCTGGCAGATTTTGACTATC	NA	NA	NA	NA
WP_035164396.1|747349_748399_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003615159.1|748756_749398_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	34.9	2.3e-24
WP_016396610.1|749720_750458_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035165474.1|750604_751894_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_035164899.1|754007_757208_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_035164897.1|757572_758322_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035164396.1|758408_759458_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
758354:759595	attR	TACGCCAATTGCAAGAATAAATTGAACACTTACCATAACATCTGGCAGATTTTGACTATCTACGCCGGTAAATGCGGTCAAGTTCGGTGTCAAAGTACTCTTCTGGAGTCTTGTAGTTTAAGATCTTCCGAGGAAGAGAGTTGCACCATACCTCGATCTTAGCAATATCTTCCACACTGTACTTATCCATACGGTCTCCCTTGGGAATATAGCGTCTGATAAGCCCGTTGTGCCGTTCTACGCTGCCTTTATCACAGGATGTATAAGGGTGAGCGTAGTACACAAGAGTCTTGGAAACTTGCTCAAGATCGGATAGATCTGCGAACTCAGATCCGTTGTCGGTTGTGATAGACTTAAAGATTTGATTCCATTTGGATCCGTAGTACTCTCGAAGCTTATCAAATGCCTTCATAACGCTAGCTGAGGTCTTATCCTCAATCTTGATCATGAAGAACTGACGCGTCTTTCGTTCGCACAGAGTAAGCAACACATCGTCGTCCTTAGTCTTGTGTCCAAGAACCAGATCGCATTCCCAGTGACCAAAGTCCTTACGGCTTTCGATTCTAGGACTACGTTCATCGATGCTTCGTCCCAGGATACGCTTGTTTACACGGGCACGACGAGTCTTAGTATTACGCTTGACCTTCTCTGGAAGATCACCGTTCTTGATGTCCATTAGGCCCAAGTCAACGTAGTTATACAGAGTTTTGGTTGATACGACCTGATCCTTCTGGAAGATTCCCTTGGCCAAAGCATAACCCACGCAAGCATCAAGAGACCAGCCTCGATTATGGAAGCAGTGGGAAACATAGTCGATGAACTTATGTCTGCGAAGAAACAAGCTCTTGCGGCCGCATTCGCTTCTATGTAGTTCGTAAGTGCTTTGCCCTTCGACAGCTTTATACCGCTTCACATTGCCGGTATACACGGATACTGTGCCTCTTTTGAGCTCATATCCGACCGTGCTTGGTGAGCAGTTAAGTTCTCTAGCTATAGCACGATTAGAGTAGCCCTTAGAGTGCAGCTCCTGGATTGTAGTCCGGTCGTTCAGCGTAAGGTGCTTGCCCTTTTGGTGTGGTTTAGTGTTAGAATATGAATGATCCATTTTAACCTCTCTAGAAATGTTTGTGGTAATTCATATTCTACCAGATGGTTGAAATGGATTTTTTGTGCTCTAATCCAGTGAAAACGATTTTTCTTACTGGATCGGAACAGTGTTCAGTTTAATTTTACAATCGGCGA	NA	NA	NA	NA
>prophage 9
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	765570	840646	2263382	tRNA,transposase	Streptococcus_phage(25.0%)	55	NA	NA
WP_013440320.1|765570_766749_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440320.1|768377_769556_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_016396647.1|771426_772626_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_035164894.1|773049_773709_+	DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_035164892.1|773729_774395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396650.1|774458_774779_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_072538226.1|775141_776848_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614608.1|776816_777485_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_016396652.1|778238_779549_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003615103.1|780740_781319_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_172822839.1|781342_782512_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003615100.1|782649_783798_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.5	1.7e-41
WP_035164889.1|784020_785097_+	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	1.6e-06
WP_035164888.1|785165_786449_-	dihydroorotase	NA	NA	NA	NA	NA
WP_035161096.1|786448_787459_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_035161094.1|787863_788382_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003615092.1|788571_788913_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003615090.1|788971_789595_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_035164983.1|789793_790843_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035164886.1|791190_792273_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.8	2.2e-80
WP_035161091.1|792291_793467_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	47.8	1.6e-103
WP_003615080.1|793667_794579_+	EamA family transporter	NA	NA	NA	NA	NA
WP_072538167.1|795656_797024_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035161089.1|798517_799930_-|transposase	transposase	transposase	A0A2I7RKG5	Vibrio_phage	34.0	1.4e-10
WP_003611707.1|799996_800458_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	58.1	4.8e-40
WP_002876831.1|800610_802302_+	fibronectin/fibrinogen-binding protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.2	1.9e-09
WP_002876840.1|802368_803712_-	PFL family protein	NA	NA	NA	NA	NA
WP_002876842.1|803711_803993_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_072538227.1|804086_807278_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002876844.1|807277_808333_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_016396669.1|808334_809249_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002876847.1|809250_809703_-	signal peptidase II	NA	NA	NA	NA	NA
WP_035164884.1|809714_811394_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_035164882.1|811386_811743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171031045.1|811897_813124_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_016396673.1|813139_814264_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003615059.1|814781_815246_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_013439504.1|815321_815882_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003615052.1|816042_816675_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	36.9	9.5e-23
WP_035164880.1|816661_818974_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_016396676.1|819120_821049_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_003613508.1|821097_822099_+	D-2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	33.8	2.3e-39
WP_003615044.1|822259_822688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120490347.1|822681_823167_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_003615040.1|823201_824005_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002878412.1|824039_824669_-	endonuclease III	NA	NA	NA	NA	NA
WP_002878410.1|824690_825338_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_035164878.1|825428_826727_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.6	2.1e-53
WP_002878598.1|826788_827283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164877.1|827275_830068_-	DEAD/DEAH box helicase	NA	A0A1X9I5C8	Streptococcus_phage	33.3	7.1e-62
WP_035164875.1|830096_833780_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	26.4	6.4e-26
WP_072538229.1|833806_837346_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_035161077.1|837479_838391_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_003615028.1|838446_839406_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_035164983.1|839596_840646_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
>prophage 10
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	850306	900644	2263382	transposase	Streptococcus_phage(25.0%)	47	NA	NA
WP_072538230.1|850306_852058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078256844.1|852244_852526_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072538232.1|852999_853257_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_072538230.1|853504_855256_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016396090.1|855227_855452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003613446.1|855617_856478_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|857035_858214_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003626333.1|858613_859288_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016396698.1|859268_859928_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003613477.1|860303_860711_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615002.1|860703_860901_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_078256824.1|861198_861468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614996.1|861889_862426_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003614994.1|862437_863529_-	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003614993.1|863518_864856_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003614992.1|864839_865913_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	40.7	3.2e-34
WP_003614991.1|865909_866260_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_072538235.1|866952_868008_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	6.2e-43
WP_013440320.1|868028_869207_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538236.1|869948_871172_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	1.1e-96
WP_172822840.1|872621_873254_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_072538166.1|873535_874759_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.3e-97
WP_035172629.1|875590_876412_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003614986.1|876511_877093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003614984.1|877099_878128_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003614981.1|879914_880529_+	membrane protein	NA	NA	NA	NA	NA
WP_035164853.1|880525_881302_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_035164851.1|881280_882099_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	2.0e-12
WP_035164848.1|882088_882856_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.9	3.3e-09
WP_035164846.1|883102_884653_+	YfcC family protein	NA	NA	NA	NA	NA
WP_016396711.1|885013_885565_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_155760732.1|885645_887069_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.4	5.1e-40
WP_155114309.1|887158_887302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003614970.1|887378_888035_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_035164842.1|888783_890442_-	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	35.1	2.3e-31
WP_002878532.1|890441_891119_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.2e-32
WP_003614960.1|891204_891843_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002878529.1|891861_892620_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	2.9e-18
WP_003614664.1|892619_893495_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003614665.1|893497_894406_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003614957.1|894425_895310_-	phosphate ABC transporter substrate-binding protein	NA	Q58MA7	Prochlorococcus_phage	24.5	1.8e-06
WP_035161066.1|895816_896581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614953.1|896660_896810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172822844.1|896747_897224_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002878518.1|897365_897608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164838.1|897698_899312_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013438997.1|899360_900644_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
>prophage 11
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	974510	1045264	2263382	tRNA,transposase	Streptococcus_phage(12.0%)	57	NA	NA
WP_072538167.1|974510_975878_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164983.1|976022_977072_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_003617644.1|977249_978503_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002877566.1|978619_978895_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	69.7	5.8e-25
WP_003617643.1|979098_980406_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003617641.1|980482_981688_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_003617639.1|981776_982454_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_035164793.1|982506_982902_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013439397.1|983011_983716_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002877577.1|983937_984657_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003617634.1|984656_985259_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.3	4.8e-16
WP_035164791.1|985248_985983_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.4	9.7e-11
WP_002877582.1|985972_986326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035162482.1|986336_987242_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	1.5e-37
WP_003617625.1|987225_988104_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_003617623.1|988294_988717_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_035162484.1|989399_991169_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	35.7	2.1e-11
WP_035164789.1|991208_992168_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_052109134.1|992376_995856_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	29.9	1.2e-103
WP_003617612.1|995990_996191_+	YjzD family protein	NA	NA	NA	NA	NA
WP_002877611.1|996308_997385_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	66.4	7.1e-127
WP_035162488.1|997407_998655_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	62.8	4.6e-138
WP_002877626.1|998669_999443_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	56.4	1.1e-76
WP_016396294.1|999518_999917_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_002879208.1|1000012_1000576_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003617602.1|1000723_1000975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617601.1|1001000_1001192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396297.1|1001188_1003090_-	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	46.8	2.2e-107
WP_016396298.1|1003175_1004741_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_003614010.1|1004808_1005000_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_035164784.1|1005114_1005909_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_035164782.1|1005919_1006849_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_035164780.1|1006885_1008820_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.8	1.1e-24
WP_003614004.1|1008872_1010195_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_016396303.1|1010263_1012066_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003617587.1|1012338_1013277_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_035162491.1|1013333_1015103_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.1	4.3e-81
WP_035164778.1|1015176_1016127_-	dihydrofolate reductase	NA	A0A1V0SBV6	Catovirus	30.3	3.2e-30
WP_016396307.1|1016128_1017103_-	amidohydrolase	NA	NA	NA	NA	NA
WP_016396308.1|1017231_1018431_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.0	3.6e-47
WP_002879191.1|1018442_1018916_-	arginine repressor	NA	NA	NA	NA	NA
WP_003617563.1|1019135_1020833_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.7	2.0e-75
WP_002879186.1|1021066_1021981_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164776.1|1022104_1023310_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_052109133.1|1023541_1023868_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
WP_016396311.1|1030488_1031886_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	6.7e-53
WP_072538240.1|1032074_1033124_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_016396312.1|1033307_1034021_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_035161910.1|1034017_1035073_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.2e-27
WP_003617549.1|1035109_1035970_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035164772.1|1036369_1038757_-	HAD-IC family P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.6	2.6e-36
WP_003617545.1|1038790_1039279_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	40.9	1.2e-25
WP_003617542.1|1039292_1040249_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	2.0e-112
WP_016396315.1|1040422_1041415_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.7	6.7e-39
WP_052109132.1|1041675_1042368_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	48.7	3.9e-46
WP_013440320.1|1042762_1043941_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538242.1|1044010_1045264_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1177851	1244098	2263382	tRNA,transposase,protease	Streptococcus_phage(27.78%)	60	NA	NA
WP_002879996.1|1177851_1178337_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_035164698.1|1178347_1179337_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003617311.1|1179357_1180041_-	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	43.7	1.4e-43
WP_003617309.1|1180201_1181086_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003617307.1|1181082_1181652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164696.1|1181608_1182175_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_072538245.1|1182348_1183398_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
WP_002879988.1|1183901_1184660_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002879986.1|1184678_1185890_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_035164695.1|1185985_1187002_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_035165447.1|1187039_1188083_-	sugar-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003614741.1|1188534_1189299_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	26.3	1.8e-12
WP_002879980.1|1189291_1190188_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003617297.1|1190206_1191187_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035164693.1|1191530_1193024_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_002879977.1|1193207_1193792_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	56.0	2.2e-53
WP_035164691.1|1193859_1194792_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	34.2	1.8e-46
WP_003617289.1|1194799_1195819_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	50.5	6.4e-85
WP_002879973.1|1195828_1196707_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.9	1.3e-09
WP_003617280.1|1198554_1199097_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_035164688.1|1199193_1202052_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	1.3e-305
WP_035164686.1|1202041_1204084_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002879964.1|1204204_1205137_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.1	5.4e-75
WP_035164684.1|1205208_1206225_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003617271.1|1206230_1207064_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_035165444.1|1207063_1208023_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_003617266.1|1207997_1208300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120490266.1|1208310_1209427_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_035164681.1|1209514_1211917_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002879957.1|1212076_1212634_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_076612173.1|1213050_1214313_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_003617258.1|1214858_1216136_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	43.1	3.1e-81
WP_013439246.1|1216179_1216839_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.5	2.0e-39
WP_003617254.1|1216891_1218091_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_003617251.1|1218194_1219838_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_002877009.1|1219986_1221096_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.2	5.6e-119
WP_002877019.1|1221302_1221866_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_035164677.1|1221910_1223053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035164676.1|1223121_1223850_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003617243.1|1223846_1225100_-	insulinase family protein	NA	NA	NA	NA	NA
WP_035164674.1|1225096_1226320_-	insulinase family protein	NA	NA	NA	NA	NA
WP_035164672.1|1226325_1228692_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.5	1.1e-84
WP_002877037.1|1228711_1229107_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_002877038.1|1229137_1229695_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003617232.1|1229691_1230882_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003614100.1|1230891_1231272_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_035164670.1|1231436_1232447_+	lactonase family protein	NA	NA	NA	NA	NA
WP_072538167.1|1232553_1233921_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164668.1|1234054_1234882_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_035164666.1|1234953_1235142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164664.1|1235227_1236121_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.9	7.7e-10
WP_035164662.1|1236135_1236933_-	NAD kinase	NA	NA	NA	NA	NA
WP_002877053.1|1236929_1237562_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_035161747.1|1237665_1238268_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003617218.1|1238348_1238993_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003617215.1|1239005_1239866_-	competence protein	NA	NA	NA	NA	NA
WP_072538247.1|1240179_1241403_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	1.9e-96
WP_035162386.1|1241625_1242375_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_035164660.1|1242477_1242882_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_072538248.1|1243048_1244098_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	8.1e-43
>prophage 13
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1284109	1421082	2263382	tRNA,transposase	unidentified_phage(17.86%)	104	NA	NA
WP_013440320.1|1284109_1285288_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538250.1|1285319_1286597_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.9	7.0e-57
WP_002877995.1|1286709_1287432_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002877998.1|1287440_1288376_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_076612173.1|1288481_1289744_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_003617150.1|1289932_1290625_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003617149.1|1290637_1291288_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_035164637.1|1291303_1292224_-	ribokinase	NA	NA	NA	NA	NA
WP_035164635.1|1292290_1292788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617143.1|1292935_1293181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617141.1|1293197_1293833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538342.1|1293933_1295136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035164632.1|1295579_1296497_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_035164631.1|1296493_1297891_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_035164629.1|1297899_1300065_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_003617134.1|1300068_1301580_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_035164628.1|1301785_1302631_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002878011.1|1302672_1303341_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002878013.1|1303352_1303994_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003617129.1|1303993_1304833_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003617127.1|1304854_1305595_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.1e-33
WP_003617126.1|1306137_1306794_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	9.9e-39
WP_016395746.1|1306793_1307420_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.8	7.2e-39
WP_016395747.1|1307749_1308319_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003617119.1|1308526_1309612_-	M42 family peptidase	NA	NA	NA	NA	NA
WP_035164622.1|1309625_1311047_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003617115.1|1311124_1311910_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002878038.1|1312176_1312890_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_035164620.1|1313024_1314224_+	MFS transporter	NA	NA	NA	NA	NA
WP_035162331.1|1315987_1316353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617107.1|1316514_1316637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164618.1|1316696_1318319_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	3.2e-46
WP_035162383.1|1318712_1321442_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_003617099.1|1321566_1322712_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003611502.1|1322714_1323164_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_035164615.1|1325218_1327273_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035164614.1|1327409_1329221_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.7	6.0e-94
WP_003617090.1|1329429_1329915_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164396.1|1330117_1331167_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003617088.1|1331292_1331649_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_035162323.1|1332397_1333726_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	40.1	4.6e-59
WP_003617081.1|1335724_1336231_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035164612.1|1336274_1336946_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_035164610.1|1337091_1338432_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003617074.1|1338636_1339518_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.4	9.8e-50
WP_072538168.1|1340698_1342450_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003617067.1|1342973_1344188_-	MFS transporter	NA	NA	NA	NA	NA
WP_072538167.1|1345139_1346507_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164983.1|1349066_1350116_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538342.1|1351628_1352831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013440320.1|1352986_1354165_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013438997.1|1357274_1358558_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.3	2.9e-58
WP_003617057.1|1358848_1359112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025895527.1|1359133_1359421_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035162311.1|1359536_1360304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143434646.1|1360366_1361772_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	3.7e-43
WP_003617051.1|1361854_1362505_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_035161028.1|1362529_1362811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161027.1|1362861_1363089_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_035164601.1|1363114_1365040_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	1.1e-93
WP_072538245.1|1365278_1366328_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
WP_035164600.1|1366440_1367001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538257.1|1369419_1370598_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_072538167.1|1370708_1372076_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035164983.1|1373882_1374932_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_003617037.1|1376534_1377170_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_035161025.1|1377449_1378307_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_035164599.1|1378489_1379845_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	47.9	8.4e-109
WP_035161007.1|1379847_1380561_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_035161060.1|1380621_1381548_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.9	1.1e-14
WP_016395794.1|1381583_1383014_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_072538259.1|1383019_1384462_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003617020.1|1384461_1384767_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_035161006.1|1384778_1385924_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_035164597.1|1385920_1387936_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.7	1.6e-100
WP_035164595.1|1387946_1390208_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	5.7e-126
WP_003617011.1|1390297_1390951_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	48.6	1.2e-28
WP_002878090.1|1390964_1391588_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003614813.1|1391821_1392283_-	SprT family protein	NA	NA	NA	NA	NA
WP_035164593.1|1392322_1392841_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	5.6e-13
WP_035161001.1|1393885_1396552_-	calcium-translocating P-type ATPase, PMCA-type	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.8	9.2e-75
WP_002878098.1|1396757_1397588_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.9	5.2e-69
WP_003616998.1|1397692_1398394_-	glycosyl transferase	NA	A0A1V0SL98	Klosneuvirus	29.2	9.6e-08
WP_003616997.1|1398390_1399491_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002878101.1|1399490_1400225_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_002878102.1|1400275_1401703_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003616992.1|1401706_1402846_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_035161000.1|1403008_1403710_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164591.1|1403776_1404844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616985.1|1404858_1405971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1406087_1407266_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164589.1|1407516_1409124_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003616980.1|1409644_1410700_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_035164587.1|1410686_1411868_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003616978.1|1412192_1412363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160995.1|1412652_1413144_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003616975.1|1413246_1413723_+	MFS transporter	NA	NA	NA	NA	NA
WP_072538260.1|1413738_1414416_+	MFS transporter	NA	NA	NA	NA	NA
WP_011678031.1|1414475_1415099_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003620886.1|1415213_1415360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538240.1|1417646_1418696_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
WP_002878121.1|1419336_1419732_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002878124.1|1419744_1420188_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003616967.1|1420293_1421082_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1570237	1643559	2263382	tRNA,integrase,transposase	Enterococcus_phage(14.29%)	57	1572835:1572858	1643591:1643614
WP_035164983.1|1570237_1571287_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_072538167.1|1571430_1572798_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
1572835:1572858	attL	CAATTTATTCTTGCAATTGGCGAA	NA	NA	NA	NA
WP_003616729.1|1574522_1575173_-	HD domain-containing protein	NA	S4W232	Pandoravirus	25.7	1.2e-07
WP_072538271.1|1575961_1577185_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	1.1e-96
WP_002877198.1|1577391_1577574_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_095582917.1|1578073_1579276_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002877898.1|1579602_1580868_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	5.1e-84
WP_035164511.1|1581125_1582187_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_035164509.1|1582265_1585268_-	LTA synthase family protein	NA	NA	NA	NA	NA
WP_002877895.1|1585346_1585964_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003616714.1|1585966_1587250_-	LCP family protein	NA	NA	NA	NA	NA
WP_002877893.1|1587501_1588191_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003616713.1|1588354_1589104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164506.1|1589149_1590115_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_016395914.1|1590219_1592058_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_035164501.1|1592169_1593711_-	SLAP domain-containing protein	NA	A0A0A7AQV3	Bacillus_phage	38.4	2.1e-23
WP_016395916.1|1593732_1594935_-	SLAP domain-containing protein	NA	Q9ZXE4	Bacillus_phage	41.6	3.6e-10
WP_013440320.1|1595084_1596263_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_002877881.1|1596580_1596817_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_002877879.1|1596876_1597086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164499.1|1598172_1598433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052109155.1|1598626_1599232_-|integrase	site-specific integrase	integrase	Q38608	Lactococcus_phage	34.9	5.7e-17
WP_013440320.1|1599355_1600534_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_172822846.1|1600648_1601017_-|integrase	phage integrase SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_013440320.1|1602606_1603785_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538272.1|1603845_1604424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1604538_1605717_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164495.1|1605831_1609413_-	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	28.2	1.0e-49
WP_052109126.1|1610043_1611531_-	hypothetical protein	NA	D2J048	Enterococcus_phage	37.3	3.8e-54
WP_035164493.1|1611527_1612385_-	primase C-terminal domain-containing protein	NA	A0A2H4JEH3	uncultured_Caudovirales_phage	23.9	6.9e-08
WP_035164491.1|1612381_1612696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078256813.1|1612849_1613161_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_035164488.1|1613160_1613355_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052109125.1|1613524_1614478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072538273.1|1614719_1615862_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.0	1.5e-58
WP_035164487.1|1616033_1616972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051975836.1|1617127_1617502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538274.1|1617651_1619700_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.1	7.0e-67
WP_035164479.1|1620005_1621958_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	1.3e-70
WP_002877868.1|1621982_1622321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016395924.1|1622407_1623628_-	MFS transporter	NA	NA	NA	NA	NA
WP_035164477.1|1623727_1625044_-	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_003616694.1|1625043_1625601_-	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_035160921.1|1625619_1626342_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	54.6	1.7e-47
WP_035164475.1|1626413_1628624_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	8.8e-249
WP_035160919.1|1628989_1630249_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_003616687.1|1630282_1632232_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	36.9	2.7e-15
WP_003616684.1|1632328_1633729_-	metallophosphoesterase	NA	A0A2P0ZKZ2	Lactobacillus_phage	23.1	6.6e-08
WP_003616682.1|1633786_1634272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076612173.1|1634365_1635628_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_003616681.1|1635985_1637611_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003611688.1|1637866_1638679_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003616679.1|1638678_1639479_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002877846.1|1639481_1640252_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	3.3e-25
WP_003616675.1|1640369_1641311_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003611675.1|1641731_1642205_-	universal stress protein	NA	NA	NA	NA	NA
WP_035164396.1|1642509_1643559_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
1643591:1643614	attR	CAATTTATTCTTGCAATTGGCGAA	NA	NA	NA	NA
>prophage 16
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1660079	1717980	2263382	transposase,protease	unidentified_phage(20.0%)	51	NA	NA
WP_072538207.1|1660079_1661129_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	4.0e-42
WP_072538275.1|1661242_1662919_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_035164461.1|1664146_1665769_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_035164460.1|1665929_1666796_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035160912.1|1666761_1667556_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_035164458.1|1667552_1668662_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003616200.1|1668795_1669431_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016395952.1|1669479_1670568_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_035164457.1|1670715_1672035_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_003616206.1|1672072_1672723_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616207.1|1672762_1673596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016395955.1|1673606_1674287_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_171031037.1|1674468_1675470_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	31.9	9.8e-38
WP_003616211.1|1675563_1676223_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052109124.1|1676206_1677079_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016395982.1|1677212_1678169_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_035164454.1|1678256_1679024_-	viroplasmin family protein	NA	A0A1L6Z550	Klebsiella_phage	35.3	1.1e-17
WP_076612173.1|1679247_1680510_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_013438965.1|1680558_1681503_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035164452.1|1681504_1682968_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003611605.1|1683019_1683499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164450.1|1683609_1684308_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003616220.1|1684294_1684666_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_003611679.1|1684748_1685375_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_035164448.1|1685763_1687347_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_035164446.1|1687350_1688112_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.3e-28
WP_035164444.1|1688817_1689936_-	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	45.0	1.7e-19
WP_035164442.1|1690165_1691077_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_072538165.1|1691630_1692680_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_052109123.1|1693177_1694335_+	cation transporter	NA	NA	NA	NA	NA
WP_003616234.1|1694492_1695047_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.0	7.8e-13
WP_003621366.1|1695063_1695963_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_035164407.1|1696094_1697438_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1697394_1697628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1697683_1698031_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1698023_1698206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616238.1|1698809_1699424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538165.1|1701474_1702524_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	1.1e-42
WP_003611191.1|1702859_1703507_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.2e-49
WP_003611175.1|1703528_1704227_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.0e-54
WP_003616420.1|1704470_1705928_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003616418.1|1705947_1706694_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-27
WP_003616417.1|1706912_1708223_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.7	2.0e-51
WP_035174920.1|1710188_1710668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1711100_1712279_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538342.1|1713028_1714231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538277.1|1714426_1715617_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_035164409.1|1715868_1716051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1716043_1716391_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|1716446_1716680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|1716636_1717980_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
>prophage 17
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1723525	1784659	2263382	integrase,transposase	unidentified_phage(22.22%)	55	1761333:1761392	1789087:1790453
WP_143434642.1|1723525_1724930_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	5.4e-42
WP_003612438.1|1725012_1725192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616281.1|1725225_1725927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616283.1|1726607_1727093_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003616285.1|1727277_1728198_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072538343.1|1728341_1728497_-	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_035164431.1|1728818_1730045_+	MFS transporter	NA	NA	NA	NA	NA
WP_035164429.1|1730764_1731688_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002877686.1|1731739_1732678_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_035164427.1|1732844_1733969_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.5	6.4e-70
WP_035164426.1|1734104_1735013_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	43.3	2.0e-05
WP_035164425.1|1735252_1735954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164422.1|1736034_1737942_+	DNA mismatch repair protein MutS	NA	F2QAG1	Chrysochromulina_ericina_virus	30.1	4.3e-18
WP_035164420.1|1738067_1739630_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.5	6.7e-09
WP_035160853.1|1739626_1741204_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	7.2e-11
WP_035160850.1|1741366_1742962_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_035165409.1|1743423_1743546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164419.1|1743868_1744348_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_072538280.1|1744337_1744763_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003616298.1|1744807_1745239_-	peptide deformylase	NA	NA	NA	NA	NA
WP_035164396.1|1745430_1746480_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_002879587.1|1746679_1748077_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_003616300.1|1748365_1749367_+	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	35.2	2.5e-49
WP_002879589.1|1749624_1750188_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003616303.1|1750180_1750729_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003616304.1|1750730_1751180_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_035160848.1|1751244_1753464_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A068F3I8	Mycobacterium_phage	34.2	5.3e-84
WP_016396011.1|1753759_1754617_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	6.6e-51
WP_002879651.1|1754735_1755644_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_035164416.1|1755832_1756375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025895623.1|1756454_1757282_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.6	4.1e-98
WP_013438900.1|1757339_1757498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002879656.1|1757547_1758261_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_035164414.1|1758658_1759204_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_072538240.1|1759986_1761036_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	1.1e-42
1761333:1761392	attL	GGAACTGTATAATTTTATGTGTAAGGATGAACAGTTCCTTAAACTAAATTCCAATTGGGT	NA	NA	NA	NA
WP_013440320.1|1761458_1762637_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164411.1|1762697_1762994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160836.1|1763387_1763579_-	RRXRR domain-containing protein	NA	NA	NA	NA	NA
WP_003616318.1|1763938_1764766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616319.1|1764841_1765495_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_035164403.1|1765498_1766074_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003616322.1|1766335_1767169_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	37.9	4.6e-41
WP_003616324.1|1767334_1767841_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003616326.1|1769098_1770433_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035164401.1|1770830_1771163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160831.1|1771155_1771941_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.6	1.0e-10
WP_016396022.1|1771962_1772610_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_035160830.1|1772572_1772902_-|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_003616334.1|1773538_1774006_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	28.5	6.0e-06
WP_013440320.1|1774426_1775605_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164983.1|1776271_1777321_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_013440320.1|1777737_1778916_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_141305880.1|1779187_1781476_-	hypothetical protein	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	29.0	1.3e-69
WP_003616342.1|1781605_1781809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164396.1|1783609_1784659_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
1789087:1790453	attR	GGAACTGTATAATTTTATGTGTAAGGATGAACAGTTCCTTAAACTAAATTCCAATTGGGTATAAAAAAAGGGACTCCCTTTCCGTATAATTGATTTGAACACTATCAATACGAAAGGGAATCCACTATGACTGATTTTAACAAAGAATGCCTCAATGCGCTATTGAACAAAGAGAAATTCGATGAATTCATGCGTACTCAGCTTGAAGAAGGACTCGATCAACTCCTAGAAAGCGAATTGACTGCCTTTCTTGGTTATGATCCCTATGCTCGAGAGGGTTGGAACTCTGGAAACTCTAGAAACGGTAGCTACTTTAGACAAGTTAAAACTCAATTCGGACCGATCAAAGTTCAAGTTCCTCGGGACAGAAAAGGTGAGTTTCACCAACATACTCTCCCAGCATACGGCCAACACACTGATACGCTAGAATCAACCGTGATTCAGCTCTATTCACATGGCGTAACGACCCGGGAGATCTCTGATTTGATTGAGAAAATGTATGGCAGCTATTACTCAGCTGGCACTGTCTCCAACATCTCTAAGCAGGTTGCCAGCCAGGTCGAAAGCTATCACCAACGTCAGCTGAGCGACAAGTTCTTCTGCGTGTATCTCGACGCCACTTACATTCCTCTGCGTAGAGATACGTACCAGCGTGAGGCAGTCTATGTGGCTGTTGGGATTAAGCCTAATGGCCATAAGGAGATCATTGATTATCGTATTGCCCCGGTGGAGAATATCGAAATTTGGGGTGAAATGATTTCCAACTTCAAGGAACGCGGCCTTGAGCAGGTTGAGCTATTCCTATCAGATGGGTTTGTAGGCATTAAAGACATGCTAAAGCAGTATTACCCAAAATCTAAATTCCAACGTTGCCTAGTTCATGTCATGCGAAATATCAAGGGAAAAGTCCGTGTAAGCGATCGTAAAGAGGCTCTGGACGACTTCAAGCAAGTTCATAAGCAATCTAGCTTAAAAGAGGCAGAAACGGTTCTCCACGCTTTCTATGACAAATACGACTCAAAATACTCAAGCATGATCAAGAATCTGCAGAAGATTGAGGAAGACCTGCTGGTCTTTTACCAGTACCCTAAGCAGATTCGGCCCTCGATCTACTCAACGAACATGATCGAGTCGATAAACAACATGATCAAACGCAAGACAAAGCCAAAGTCAGAATTTCCAACTGAAGAGTCCCTAGACAACTTCTTAGGTGTACAGGCTATCGGCTACAACGACCGGAATGCCAATCGGACTCATAAAGGCTTTGGTCAGGTGACAGACACGTTGGAATCATACTTCGATTAAAACATAATTAAAGAATCAACCTATCGGAAAGATTTATTTACACAAAAGAATTGACAGTGTCT	NA	NA	NA	NA
>prophage 18
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1787709	1858760	2263382	tRNA,transposase	uncultured_virus(12.5%)	57	NA	NA
WP_072538245.1|1787709_1788759_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BWC8	unidentified_phage	33.1	3.6e-43
WP_013440320.1|1789212_1790391_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164385.1|1790631_1792074_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_035164383.1|1792252_1793167_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_171030688.1|1793329_1794052_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_035164381.1|1794479_1794965_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002880600.1|1795015_1795798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164379.1|1795794_1796559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164377.1|1797117_1797996_-	ROK family protein	NA	NA	NA	NA	NA
WP_035161029.1|1798032_1798995_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_013440320.1|1799562_1800741_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164407.1|1801115_1802459_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1802415_1802649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1802704_1803052_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1803044_1803227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1803529_1804708_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003616356.1|1810533_1811106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880537.1|1811571_1811760_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_035164344.1|1811839_1812685_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003616360.1|1812823_1813252_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616361.1|1813342_1813822_-	YcxB family protein	NA	NA	NA	NA	NA
WP_003616362.1|1813910_1814621_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_035164342.1|1814769_1817535_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	31.2	1.4e-30
WP_035164340.1|1818147_1818981_-	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_076612173.1|1819443_1820706_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_002880554.1|1820841_1821363_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.4	2.3e-14
WP_072538287.1|1821579_1822248_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_013440320.1|1824395_1825574_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035164330.1|1825805_1826960_+	SLAP domain-containing protein	NA	Q38317	Lactobacillus_phage	56.2	2.3e-59
WP_003616368.1|1827180_1827426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880561.1|1827428_1828196_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003616370.1|1828192_1828831_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	31.6	1.0e-19
WP_035164329.1|1829124_1830063_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	32.2	1.4e-17
WP_035164328.1|1831266_1832100_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013440320.1|1833421_1834600_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_016396056.1|1835152_1835857_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_003616378.1|1835967_1836192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095582907.1|1836554_1837256_+	helix-turn-helix domain-containing protein	NA	C1KFS0	Lactobacillus_virus	38.8	8.4e-28
WP_072538290.1|1837431_1837842_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	37.9	1.8e-14
WP_035164327.1|1838113_1839271_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_016396059.1|1839319_1840690_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	49.7	3.6e-115
WP_013438865.1|1840713_1841169_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_035164326.1|1841191_1843213_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_002879432.1|1843353_1843590_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003616385.1|1843616_1844195_-	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	71.3	9.3e-41
WP_003612647.1|1844235_1844529_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002879428.1|1844744_1847216_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.5	2.4e-109
WP_003616387.1|1847228_1849190_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.3	9.2e-141
WP_003616388.1|1849173_1850319_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003623647.1|1850318_1850549_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003616390.1|1850773_1851901_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	27.4	8.2e-25
WP_003616391.1|1852081_1853446_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_002879421.1|1853921_1854062_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_002879420.1|1854110_1854476_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003616393.1|1854475_1855345_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_016396064.1|1855452_1856838_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_035164325.1|1856864_1858760_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1864793	1920774	2263382	transposase	Bacillus_phage(20.0%)	50	NA	NA
WP_013440320.1|1864793_1865972_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035160962.1|1866968_1867151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1867143_1867491_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|1867546_1867780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538230.1|1868619_1870371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016396090.1|1870342_1870567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011544373.1|1871359_1871773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165392.1|1871830_1872499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616399.1|1872528_1873311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165391.1|1873323_1873737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538293.1|1873760_1874270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003613078.1|1874259_1874889_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.8	3.5e-25
WP_003616402.1|1874899_1875610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165388.1|1875611_1876280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035164396.1|1876517_1877567_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	33.1	6.2e-43
WP_003616406.1|1878699_1879017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616407.1|1879216_1879900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165387.1|1881888_1884366_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_016396079.1|1884376_1884532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616411.1|1884818_1886174_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_035165386.1|1886170_1886965_+	response regulator	NA	NA	NA	NA	NA
WP_035162107.1|1887042_1888581_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_013440320.1|1889792_1890971_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035160868.1|1891304_1891874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003611906.1|1891980_1892601_-	helix-turn-helix domain-containing protein	NA	Q9G0C2	Lactococcus_phage	38.6	1.1e-31
WP_035160872.1|1892767_1892962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160873.1|1893122_1895252_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_035160876.1|1895274_1895853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165385.1|1896572_1897901_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	37.7	2.1e-56
WP_035165384.1|1898034_1898904_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016395957.1|1898967_1899792_-	glycosyl transferase 8 family protein	NA	NA	NA	NA	NA
WP_016395958.1|1899819_1900596_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003616262.1|1900856_1901585_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	3.4e-40
WP_035165382.1|1901631_1903527_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.3	4.6e-36
WP_051112105.1|1903507_1905097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616258.1|1905097_1905898_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_002877724.1|1905916_1906714_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	32.0	2.5e-28
WP_035165381.1|1906808_1908092_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	2.0e-19
WP_003616256.1|1908583_1909063_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_035165380.1|1909176_1909992_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035161041.1|1910929_1911430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013438946.1|1911447_1911828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165379.1|1911998_1912340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877735.1|1912404_1912770_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003611643.1|1912904_1913573_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_035165378.1|1913582_1914938_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.7	5.2e-10
WP_035165377.1|1915240_1916725_+	MFS transporter	NA	NA	NA	NA	NA
WP_003624103.1|1916778_1917627_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013440320.1|1918148_1919327_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538295.1|1919550_1920774_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.5	7.4e-96
>prophage 20
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	1939087	1997441	2263382	transposase,protease	Staphylococcus_phage(23.08%)	41	NA	NA
WP_003616451.1|1939087_1939744_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_035165557.1|1939829_1940990_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_035162141.1|1943126_1943597_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_013440320.1|1944748_1945927_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003613636.1|1946813_1947116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|1947183_1948362_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_003613642.1|1948682_1948832_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_035165370.1|1948847_1950350_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.3	2.2e-41
WP_035165369.1|1950346_1951579_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.3	2.4e-22
WP_002879627.1|1951656_1951899_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003613649.1|1951888_1953175_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_003613653.1|1953349_1953574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396121.1|1953733_1954123_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_035165368.1|1954259_1956260_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	33.9	4.4e-29
WP_035165367.1|1956263_1956890_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035164407.1|1963187_1964531_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1964487_1964721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1964776_1965124_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1965116_1965299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616467.1|1966713_1967328_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	4.6e-30
WP_035165365.1|1967347_1968526_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	1.3e-97
WP_003616470.1|1968540_1969005_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	1.5e-25
WP_016396126.1|1969390_1969573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169309614.1|1969633_1969744_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013440320.1|1976017_1977196_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_013440303.1|1977259_1978570_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016396128.1|1978562_1979438_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003613384.1|1979502_1980312_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_035165361.1|1982676_1982919_-	recombinase family protein	NA	M4QQC6	Vibrio_phage	55.8	1.4e-06
WP_003616492.1|1983453_1983651_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	9.8e-19
WP_035165360.1|1983852_1984518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035172677.1|1984590_1984788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538195.1|1986383_1987607_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_078256805.1|1989305_1990019_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_072538287.1|1990193_1990862_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_072538298.1|1990830_1992537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035164407.1|1993059_1994403_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|1994359_1994593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|1994648_1994996_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|1994988_1995171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165359.1|1995350_1997441_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	39.2	8.4e-124
>prophage 21
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	2011153	2073367	2263382	transposase	Streptococcus_phage(18.18%)	57	NA	NA
WP_072538196.1|2011153_2012407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_072538195.1|2012529_2013753_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_035164407.1|2014359_2015703_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|2015659_2015893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2015948_2016296_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035160962.1|2016288_2016471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2016790_2017969_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_076612173.1|2018155_2019418_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_016396148.1|2019531_2020320_-	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	2.1e-19
WP_072538300.1|2020782_2023314_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.9e-72
WP_035160962.1|2023520_2023703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2023695_2024043_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_013439920.1|2024098_2024332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164407.1|2024288_2025632_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_072538195.1|2026910_2028134_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	1.6e-95
WP_013440320.1|2029157_2030336_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538302.1|2031061_2033308_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.3	5.4e-60
WP_072538303.1|2034342_2035710_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	28.8	6.0e-30
WP_013440320.1|2036124_2037303_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538304.1|2037468_2038503_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.0	7.5e-41
WP_078256840.1|2038755_2040018_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.3	6.1e-29
WP_035165352.1|2040094_2041306_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_035165351.1|2041399_2042035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165349.1|2042099_2042837_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	32.5	1.9e-22
WP_035165348.1|2043018_2044422_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_035165347.1|2044742_2045249_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616571.1|2045291_2046350_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002879538.1|2046351_2047026_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.0e-35
WP_052109150.1|2047178_2047790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165346.1|2047792_2048824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011678650.1|2048886_2049090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165345.1|2049089_2050379_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_035165343.1|2050387_2051194_+	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	24.0	1.4e-07
WP_013440268.1|2051300_2051798_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_035165342.1|2051972_2052767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165341.1|2052753_2053452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538305.1|2053444_2054098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035164983.1|2054211_2055261_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.8	3.1e-42
WP_035165338.1|2055344_2056007_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	2.4e-24
WP_016396167.1|2056029_2056452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165337.1|2056529_2057930_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_052109149.1|2058205_2058754_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616594.1|2058881_2059421_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	46.2	9.3e-35
WP_002879530.1|2059436_2059985_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	44.6	3.3e-32
WP_095582939.1|2060316_2061519_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002879529.1|2061685_2062468_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_035165335.1|2062479_2063439_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_035165333.1|2063662_2064187_-	CvpA family protein	NA	NA	NA	NA	NA
WP_016396172.1|2064358_2065078_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_072538307.1|2065096_2065921_+	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	41.8	6.6e-16
WP_003616606.1|2065922_2066702_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.4	5.1e-26
WP_003613278.1|2066679_2067570_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.4	9.0e-19
WP_002879522.1|2067562_2067826_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_002879521.1|2067902_2069003_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002879518.1|2069017_2069788_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_016396175.1|2069926_2071654_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.2e-44
WP_013440320.1|2072188_2073367_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	2091694	2137507	2263382	transposase	Streptomyces_phage(13.33%)	41	NA	NA
WP_035165320.1|2091694_2092993_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	39.0	2.5e-70
WP_035161504.1|2093334_2094474_+	LCP family protein	NA	NA	NA	NA	NA
WP_002879494.1|2094592_2094970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165318.1|2094984_2096529_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.2	2.0e-45
WP_035165317.1|2096582_2097338_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_016396190.1|2097340_2097832_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_035165316.1|2098057_2098525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002879488.1|2098981_2099497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161515.1|2099499_2100126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165314.1|2100176_2101715_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002879482.1|2101778_2102108_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_002879481.1|2102197_2102740_+	AAA family ATPase	NA	A0A2R2ZH49	Clostridioides_phage	28.0	3.0e-09
WP_035165313.1|2102864_2103350_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	39.7	1.6e-14
WP_035165311.1|2103634_2104681_+	lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003616168.1|2104850_2105324_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	38.5	5.5e-15
WP_035165310.1|2105511_2106294_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	3.4e-14
WP_003614608.1|2106701_2107370_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_072538309.1|2107338_2109045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035165308.1|2110265_2111024_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	40.2	2.3e-15
WP_035165307.1|2111069_2111849_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_035165306.1|2111897_2113178_-	GTPase HflX	NA	NA	NA	NA	NA
WP_013440320.1|2113614_2114793_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_072538310.1|2114946_2116395_+	flippase	NA	NA	NA	NA	NA
WP_072538312.1|2118275_2120027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011544347.1|2119998_2120223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016395838.1|2120904_2122272_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_041812036.1|2122510_2123734_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_072538313.1|2124104_2124419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072538347.1|2124463_2125126_+	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_072538314.1|2125235_2126231_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_072538315.1|2126244_2126826_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_013440194.1|2126827_2127205_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_072538316.1|2127206_2127911_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_072538317.1|2127922_2128447_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_070487999.1|2128534_2129533_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	1.0e-87
WP_095582951.1|2130455_2131064_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	7.2e-44
WP_002880229.1|2131077_2132052_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	6.2e-29
WP_003612761.1|2132903_2133329_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_072538319.1|2133381_2133816_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_078256804.1|2134753_2136016_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_035164407.1|2136163_2137507_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
>prophage 23
NZ_CP018215	Lactobacillus delbrueckii subsp. lactis strain KCCM 34717 chromosome, complete genome	2263382	2144017	2188837	2263382	transposase,protease	unidentified_phage(25.0%)	37	NA	NA
WP_013440320.1|2144017_2145196_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165297.1|2145401_2146316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614385.1|2146437_2146578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165295.1|2146592_2146904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616107.1|2147754_2148768_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_035165293.1|2148902_2149271_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035165536.1|2149522_2149819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165292.1|2150134_2151022_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_035165290.1|2154783_2156013_+	LCP family protein	NA	NA	NA	NA	NA
WP_035165289.1|2156252_2157233_+	LCP family protein	NA	NA	NA	NA	NA
WP_072538323.1|2157562_2158597_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	32.9	4.0e-42
WP_035165287.1|2158739_2159855_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	71.2	2.0e-156
WP_013440320.1|2160512_2161691_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_078256804.1|2162915_2164178_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	35.7	9.4e-30
WP_035165284.1|2164185_2165307_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_035165282.1|2165361_2166075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013440320.1|2166179_2167358_-|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165281.1|2167682_2168522_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_035165279.1|2168524_2169511_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_035165277.1|2169536_2170544_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	24.6	4.9e-05
WP_013440320.1|2171280_2172459_+|transposase	IS256-like element ISLdl2 family transposase	transposase	NA	NA	NA	NA
WP_035165276.1|2173276_2174266_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_035165275.1|2174296_2175286_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_072538326.1|2175467_2176457_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.9	4.3e-38
WP_008460463.1|2177461_2177911_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.6	2.0e-19
WP_035164407.1|2178166_2179510_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.9	1.6e-48
WP_013439920.1|2179466_2179700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035160960.1|2179755_2180103_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035164409.1|2180095_2180278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165272.1|2180441_2180864_-	GtrA family protein	NA	NA	NA	NA	NA
WP_035165271.1|2181123_2181831_+	VanZ family protein	NA	NA	NA	NA	NA
WP_035165270.1|2181841_2183365_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060611715.1|2185591_2185879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165265.1|2185898_2186402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616066.1|2186708_2187401_-	glycerophosphoryl diester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	23.6	2.6e-13
WP_035165262.1|2187506_2188160_-	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_003612123.1|2188174_2188837_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
