The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	1074136	1137375	5687681	head,plate,tRNA,portal,capsid,terminase,protease,tail,integrase	Enterobacteria_phage(31.82%)	72	1086805:1086824	1145348:1145367
WP_007373603.1|1074136_1074616_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_007373604.1|1074695_1075505_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_007373605.1|1075594_1078093_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.7	1.5e-111
WP_172825167.1|1078394_1079324_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_071920345.1|1079389_1079638_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_071920346.1|1079686_1080838_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	78.3	3.1e-173
WP_071920347.1|1080988_1082170_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	67.8	2.8e-153
WP_071920348.1|1082170_1082686_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.4	1.2e-52
WP_071920349.1|1082742_1083042_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	75.8	2.2e-33
WP_156897435.1|1083038_1083209_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	59.1	7.9e-09
WP_074989280.1|1083189_1086153_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	41.9	1.7e-191
WP_071920352.1|1086164_1086653_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	1.1e-53
1086805:1086824	attL	TGTGCCAGAAGCGGAAGTTG	NA	NA	NA	NA
WP_071920353.1|1086944_1087652_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_071920354.1|1088021_1088411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071920355.1|1088565_1088886_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_071920356.1|1088879_1089338_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	34.9	6.7e-10
WP_156897408.1|1089502_1089925_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	48.2	9.2e-30
WP_071920358.1|1089921_1091187_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	53.7	1.4e-102
WP_071920359.1|1091183_1091792_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	64.4	1.5e-70
WP_071920360.1|1091784_1092681_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.1	7.8e-103
WP_071920361.1|1092667_1093036_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	62.6	2.0e-33
WP_071920362.1|1093032_1093617_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.5	5.6e-62
WP_071920363.1|1093616_1094258_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.0	6.2e-46
WP_071920364.1|1094254_1094716_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.7	2.5e-33
WP_071920365.1|1094712_1095276_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	53.9	5.0e-39
WP_172825185.1|1095272_1095752_-	glycoside hydrolase family protein	NA	A0A1R3Y5W5	Salmonella_virus	57.0	1.0e-48
WP_071920367.1|1095757_1096060_-	hypothetical protein	NA	O64361	Escherichia_phage	68.3	4.1e-32
WP_071920368.1|1096111_1096312_-|tail	tail protein X	tail	A0A0M4RTN6	Salmonella_phage	66.2	1.0e-15
WP_071920369.1|1096311_1096809_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.3	1.5e-60
WP_071920370.1|1096911_1097820_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	73.6	2.7e-87
WP_071920371.1|1097868_1098918_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.4	2.7e-107
WP_071920372.1|1098941_1099775_-|capsid	GPO family capsid scaffolding protein	capsid	B9A7B4	Serratia_phage	66.8	2.3e-101
WP_071920373.1|1099934_1101656_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	1.3e-226
WP_071920374.1|1101658_1102711_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.7	8.1e-144
WP_071920375.1|1103286_1103865_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	74.0	8.0e-77
WP_071920376.1|1103824_1104922_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	63.3	4.0e-133
WP_083565967.1|1105041_1107495_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	41.7	3.4e-140
WP_071921833.1|1107526_1108390_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	64.6	8.3e-102
WP_071920377.1|1108396_1108615_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	62.5	1.2e-17
WP_071920378.1|1108614_1108854_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	52.0	1.2e-10
WP_071920379.1|1108857_1109064_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	57.4	1.5e-14
WP_071920380.1|1109147_1109378_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	82.9	1.8e-32
WP_071920381.1|1109367_1109571_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	76.9	3.0e-23
WP_071921834.1|1109603_1109939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071920382.1|1110190_1110490_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	65.7	9.0e-32
WP_071920383.1|1110559_1111582_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	52.0	4.9e-93
WP_007373606.1|1111747_1112044_-	NINE protein	NA	M4ZS56	Bacillus_phage	65.6	1.8e-16
WP_007373607.1|1112215_1112623_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_007373608.1|1112626_1113085_-	NfeD family protein	NA	NA	NA	NA	NA
WP_035887325.1|1113081_1113999_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_007373610.1|1114085_1114940_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_007373611.1|1115001_1115772_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007373612.1|1115801_1116425_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_071920384.1|1116395_1117082_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.8e-06
WP_071920385.1|1117078_1119493_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007373615.1|1119689_1120841_+	porin	NA	NA	NA	NA	NA
WP_035887327.1|1121142_1121979_+	methionine ABC transporter ATPase	NA	NA	NA	NA	NA
WP_007373617.1|1122036_1123059_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	A0A1V0SGN0	Hokovirus	28.1	5.7e-09
WP_007373618.1|1123051_1123711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071920386.1|1123782_1124868_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_156897409.1|1125206_1125728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071920387.1|1125852_1126920_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_007373622.1|1126916_1127426_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_071920388.1|1127555_1128278_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_007373624.1|1128280_1128775_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_074989282.1|1128948_1130334_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	33.2	1.8e-42
WP_071920390.1|1130467_1130989_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_071920391.1|1131218_1132235_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_071920392.1|1132316_1133816_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_007373629.1|1134102_1134315_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_007373630.1|1134316_1135183_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.2	3.8e-30
WP_071920393.1|1136169_1137375_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	1.4e-131
1145348:1145367	attR	CAACTTCCGCTTCTGGCACA	NA	NA	NA	NA
>prophage 2
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	1259128	1267260	5687681		uncultured_Caudovirales_phage(33.33%)	11	NA	NA
WP_007373714.1|1259128_1259461_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.5	6.1e-05
WP_007373715.1|1259623_1260316_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	5.5e-32
WP_007373716.1|1260327_1261734_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_007373717.1|1261908_1262229_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	48.0	7.7e-21
WP_007373718.1|1262272_1263562_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.3	2.0e-168
WP_007373719.1|1263574_1264000_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.9e-51
WP_007373720.1|1264086_1264341_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	49.1	9.4e-06
WP_007373721.1|1264551_1265679_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.3	8.5e-99
WP_071920439.1|1265843_1266302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007373724.1|1266545_1266902_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.9	3.2e-07
WP_007373725.1|1267005_1267260_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	49.1	6.1e-05
>prophage 3
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	2844911	2924083	5687681	protease,plate	Tupanvirus(20.0%)	60	NA	NA
WP_071920929.1|2844911_2846711_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_035888589.1|2846701_2847643_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_035888591.1|2847657_2849796_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_007371753.1|2849806_2850253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035888596.1|2850252_2850552_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_071920930.1|2850558_2851611_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_035888602.1|2851610_2852240_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_007371749.1|2852241_2853603_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_035888605.1|2853599_2854220_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_071920931.1|2854226_2857655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071920932.1|2857674_2860185_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	34.1	2.3e-83
WP_007371745.1|2860706_2861261_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007371744.1|2861803_2862592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007371743.1|2862913_2865097_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_007371742.1|2865442_2865652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371741.1|2865829_2866810_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007371739.1|2866888_2867899_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_007371738.1|2867943_2868297_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071920933.1|2868380_2869265_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035888619.1|2869306_2870338_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.1	1.8e-34
WP_007371735.1|2870365_2871886_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071920934.1|2872159_2873896_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_158262945.1|2873927_2874731_-|protease	serine protease	protease	NA	NA	NA	NA
WP_083566005.1|2875227_2876832_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_071920935.1|2877012_2877624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035888621.1|2877636_2878131_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_035888623.1|2878127_2878550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371728.1|2878593_2879982_-	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_007371727.1|2879993_2880338_-	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_007371726.1|2880334_2881906_-	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_035888626.1|2881950_2882778_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_007371723.1|2883005_2883704_-	glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	26.7	7.3e-08
WP_071920936.1|2884114_2885464_+	MFS transporter	NA	NA	NA	NA	NA
WP_071920937.1|2885504_2887157_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_035887378.1|2887438_2888353_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_035887380.1|2888529_2890146_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_007371716.1|2890142_2890862_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_071920938.1|2890842_2891805_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_071920939.1|2891969_2894747_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.1	8.4e-71
WP_071920940.1|2895384_2896896_+	anion permease	NA	NA	NA	NA	NA
WP_035887388.1|2896947_2898597_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_071920941.1|2898894_2899152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071920942.1|2899497_2899800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371709.1|2899999_2900410_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.8	8.4e-20
WP_079517793.1|2900464_2900803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071920943.1|2900812_2905240_-	PAAR/RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.3	7.4e-29
WP_071920944.1|2905253_2905682_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_107146662.1|2905792_2906230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071920945.1|2906303_2908883_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	6.6e-46
WP_007371701.1|2908977_2909370_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_007371700.1|2909379_2909985_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_071920946.1|2909981_2911067_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_071920947.1|2911063_2913604_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_071920948.1|2913827_2914214_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_071920949.1|2914228_2916463_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.3	6.3e-45
WP_007371692.1|2916521_2916962_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_007371691.1|2917051_2918488_-	protein kinase	NA	M1HXR9	Acanthocystis_turfacea_Chlorella_virus	27.3	3.6e-09
WP_071920950.1|2918514_2921127_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.1	8.4e-81
WP_007371689.1|2921171_2922215_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_007371688.1|2922211_2924083_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	3261412	3271959	5687681		Enterobacteria_phage(50.0%)	10	NA	NA
WP_007371280.1|3261412_3262726_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.4	2.8e-53
WP_071921051.1|3262747_3263827_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	23.5	3.1e-13
WP_007371278.1|3263830_3264604_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_007371277.1|3264620_3265595_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_007371276.1|3265601_3266150_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.2	3.2e-51
WP_007371275.1|3266152_3267031_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_071921052.1|3267079_3267979_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.2	7.0e-27
WP_071921053.1|3267981_3269064_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.0e-101
WP_007371272.1|3269463_3270357_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.2	1.3e-44
WP_071921054.1|3270543_3271959_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.1	2.4e-18
>prophage 5
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	3354068	3362452	5687681	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_007371208.1|3354068_3356102_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.5e-53
WP_007371207.1|3356171_3356627_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	44.9	9.9e-30
WP_007371206.1|3356754_3357231_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.8	1.9e-63
WP_007371205.1|3357283_3358003_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_007371204.1|3357996_3359685_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.7	3.2e-259
WP_071921073.1|3359905_3360637_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	73.9	1.6e-82
WP_007371202.1|3360695_3360809_+	protein YohO	NA	NA	NA	NA	NA
WP_007371201.1|3360783_3361521_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007371200.1|3361504_3362452_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.6	8.1e-10
>prophage 6
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	3795182	3874109	5687681	plate,tRNA,integrase,tail,holin	Escherichia_phage(23.81%)	82	3833920:3833934	3875828:3875842
WP_007370784.1|3795182_3795701_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	42.2	7.3e-05
WP_035888209.1|3795759_3796395_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_007370782.1|3796680_3797529_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007370781.1|3797585_3797846_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_007370780.1|3797842_3798223_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_071921195.1|3798222_3798954_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_007370778.1|3799019_3799727_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_007370777.1|3799834_3800746_-	GTPase Era	NA	NA	NA	NA	NA
WP_007370776.1|3800742_3801423_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	1.3e-20
WP_007370775.1|3801634_3802609_-	signal peptidase I	NA	NA	NA	NA	NA
WP_035888216.1|3802624_3804424_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	7.2e-23
WP_071921196.1|3804569_3805049_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_071921197.1|3805045_3805999_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_071921198.1|3805998_3806652_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_007370770.1|3806683_3807259_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_007370769.1|3807679_3809302_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_007370768.1|3809286_3810024_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_007370767.1|3810153_3811482_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	1.3e-42
WP_007370766.1|3811525_3811909_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	3.1e-32
WP_007370765.1|3812221_3812911_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	51.4	4.6e-55
WP_007370764.1|3812955_3814053_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_007370763.1|3814259_3814679_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	2.0e-13
WP_007370762.1|3814748_3815447_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_071921199.1|3815479_3818140_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_007370760.1|3818253_3819609_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_035888232.1|3819654_3819978_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_035888236.1|3819974_3821273_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.8	5.3e-44
WP_071921201.1|3826984_3829558_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.6	1.1e-125
WP_035888442.1|3829687_3830419_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_007370752.1|3830415_3831396_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_007370751.1|3831527_3832265_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_007370750.1|3832530_3832869_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_071921202.1|3833116_3834277_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
3833920:3833934	attL	GAATCTGGCGAACCA	NA	NA	NA	NA
WP_007370748.1|3834273_3835146_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_007370747.1|3835212_3836334_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_007370746.1|3836343_3837414_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.1e-90
WP_071921203.1|3837594_3838959_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_071921204.1|3839021_3839432_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_071921205.1|3839619_3840669_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	73.9	1.1e-153
WP_035888483.1|3840675_3841524_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	62.4	3.7e-94
WP_007370740.1|3841639_3842017_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	69.2	6.0e-41
WP_035888424.1|3842055_3842394_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	68.5	3.3e-38
WP_007370738.1|3842461_3842689_+	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	40.0	4.2e-05
WP_007370737.1|3842688_3842910_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	69.0	6.9e-21
WP_071921206.1|3842910_3844884_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	72.5	1.9e-266
WP_035888419.1|3844955_3845141_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	55.7	6.0e-10
WP_035888416.1|3845339_3845543_+|tail	tail protein X	tail	Q858W3	Yersinia_virus	66.7	3.5e-19
WP_064564426.1|3845533_3845755_+|holin	holin	holin	A0A218M4L5	Erwinia_phage	43.8	5.0e-11
WP_071921207.1|3845738_3846248_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	76.2	5.1e-67
WP_071921208.1|3846244_3846670_+	protein lysB	NA	A0A218M4K2	Erwinia_phage	54.6	6.6e-28
WP_035888407.1|3846765_3847233_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	60.1	1.1e-47
WP_035888404.1|3847320_3847956_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	80.1	4.4e-92
WP_043952630.1|3847952_3848300_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	73.0	7.3e-41
WP_007370725.1|3848304_3849213_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	79.8	5.2e-131
WP_007370724.1|3849205_3849814_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.0	4.5e-86
WP_071921209.1|3849968_3850994_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	63.2	3.7e-117
WP_071921210.1|3852190_3852787_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	56.3	1.1e-60
WP_071921211.1|3852992_3854114_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.7	5.9e-116
WP_071921212.1|3854113_3854707_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	50.3	7.0e-44
WP_007370717.1|3854836_3856018_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	88.3	1.3e-201
WP_007370716.1|3856030_3856549_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	90.1	4.5e-87
WP_035888387.1|3856611_3856893_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	80.7	9.4e-31
WP_061493592.1|3856925_3857045_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	7.5e-14
WP_035888385.1|3857037_3858750_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	38.8	8.3e-29
WP_035888383.1|3858746_3859208_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	63.4	7.4e-49
WP_071921213.1|3859204_3860347_+	hypothetical protein	NA	Q7Y4C6	Escherichia_virus	53.1	1.1e-106
WP_071531981.1|3860421_3860613_+	ogr/Delta-like zinc finger family protein	NA	Q37973	Salmonella_virus	71.9	1.3e-20
WP_002914145.1|3860767_3861115_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_007370710.1|3861158_3861926_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_071921214.1|3861956_3862505_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_007370708.1|3862523_3862772_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_035888381.1|3863164_3864526_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_007370706.1|3864694_3865483_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_035888378.1|3865501_3866788_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_007370704.1|3866829_3867426_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_035888376.1|3867548_3868439_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_007370701.1|3868525_3870187_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_007370700.1|3870335_3870677_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_007370699.1|3870737_3871031_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071921216.1|3871020_3871497_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_007370697.1|3871616_3872099_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_071921217.1|3872867_3874109_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.5	1.1e-102
3875828:3875842	attR	TGGTTCGCCAGATTC	NA	NA	NA	NA
>prophage 7
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	4373335	4436216	5687681	protease,plate,tRNA,integrase	Edwardsiella_phage(33.33%)	59	4411683:4411697	4422728:4422742
WP_071921397.1|4373335_4373842_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_007370212.1|4373928_4374627_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_007370211.1|4374719_4375451_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_071921398.1|4375464_4376412_+	glutathione synthase	NA	NA	NA	NA	NA
WP_007370209.1|4376530_4377094_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_007370208.1|4377093_4377510_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_007370207.1|4377663_4378356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007370206.1|4378421_4380680_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035889571.1|4380676_4381657_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_007370204.1|4381674_4382379_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_007370203.1|4382397_4382964_+	YggT family protein	NA	NA	NA	NA	NA
WP_007370202.1|4382960_4383251_+	YggU family protein	NA	NA	NA	NA	NA
WP_007370201.1|4383259_4383853_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_007370200.1|4383845_4384982_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_007370199.1|4385033_4386137_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_007370198.1|4386382_4387102_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_007370197.1|4387157_4387484_-	YggL family protein	NA	NA	NA	NA	NA
WP_007370196.1|4387483_4388203_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_007370194.1|4388345_4389395_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_007370193.1|4389423_4389699_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_007370192.1|4389804_4390887_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_007370191.1|4391125_4392379_+	MFS transporter	NA	NA	NA	NA	NA
WP_007370190.1|4392562_4393393_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_007370189.1|4393370_4393910_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_071921399.1|4393906_4395433_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_007370187.1|4395443_4396319_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_007370186.1|4396315_4396609_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_071921400.1|4396626_4397646_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_007370184.1|4397662_4398532_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_035889290.1|4398554_4399919_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_007370182.1|4400254_4401892_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_007370181.1|4401881_4402574_+	response regulator	NA	NA	NA	NA	NA
WP_007370180.1|4402604_4404740_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_007370179.1|4405140_4405857_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_071921402.1|4406316_4407276_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071921403.1|4407310_4408894_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_071921404.1|4409101_4409659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921405.1|4409833_4410823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921406.1|4410908_4412120_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
4411683:4411697	attL	GCTGACCTGGGGCTG	NA	NA	NA	NA
WP_071921407.1|4412192_4412726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921408.1|4412712_4413255_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	66.7	1.3e-47
WP_071921409.1|4413239_4413725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921410.1|4413736_4414150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921411.1|4414655_4415243_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.9	5.5e-49
WP_146159944.1|4415753_4416302_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_071921413.1|4416360_4416939_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_083566035.1|4417087_4417834_+	molecular chaperone	NA	NA	NA	NA	NA
WP_083566037.1|4417854_4420578_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_071921415.1|4420574_4421570_+	fimbrial protein	NA	NA	NA	NA	NA
WP_071921416.1|4421772_4422480_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172825178.1|4422802_4423600_+	fimbrial protein	NA	NA	NA	NA	NA
4422728:4422742	attR	GCTGACCTGGGGCTG	NA	NA	NA	NA
WP_083566040.1|4423672_4424560_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_172825179.1|4425107_4428875_+	hypothetical protein	NA	Q9LA58	Enterobacterial_phage	39.1	9.8e-123
WP_071921420.1|4430474_4430996_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_071921421.1|4430992_4432468_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_071921422.1|4432531_4433026_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_071921423.1|4433072_4433480_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_071921424.1|4433505_4435236_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_071921425.1|4435199_4436216_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 8
NZ_CP015113	Kosakonia radicincitans strain GXGL-4A chromosome, complete genome	5687681	4638629	4682037	5687681	lysis,head,plate,tRNA,portal,integrase,capsid,terminase,tail,holin	Erwinia_phage(27.91%)	51	4644734:4644785	4679219:4679270
WP_071921543.1|4638629_4639643_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.9e-107
WP_001144069.1|4639880_4640096_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_035887854.1|4640266_4642012_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.5e-73
WP_007370062.1|4642169_4644014_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	1.1e-34
WP_035887857.1|4644070_4644577_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4644734:4644785	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_071921544.1|4644922_4645141_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	81.9	2.5e-31
WP_071921545.1|4645474_4645909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921546.1|4646232_4646949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921547.1|4647349_4648504_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.3	1.7e-163
WP_071921548.1|4648503_4648980_-|tail	phage tail protein	tail	O64315	Escherichia_phage	71.3	1.1e-60
WP_071921549.1|4648995_4651437_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	74.4	1.4e-260
WP_071531957.1|4651429_4651549_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	3.3e-14
WP_007370054.1|4651581_4651857_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	86.8	3.3e-36
WP_007369252.1|4651923_4652442_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	92.4	8.2e-89
WP_071921550.1|4652455_4653646_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	90.2	5.0e-206
WP_071921551.1|4653916_4654771_+	benzoate transporter	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	32.5	8.6e-27
WP_071921552.1|4654795_4655302_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	30.6	3.2e-13
WP_071921553.1|4655304_4656870_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	77.6	3.8e-89
WP_035942029.1|4656880_4657411_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	85.1	2.2e-89
WP_071921554.1|4657403_4658312_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	80.8	1.0e-134
WP_071921555.1|4658316_4658661_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	71.3	1.0e-39
WP_071921899.1|4658657_4659293_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	85.3	1.8e-98
WP_071921900.1|4659410_4659953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921556.1|4659949_4660351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071921557.1|4660351_4660795_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	3.6e-45
WP_071921558.1|4660787_4661255_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	81.3	7.2e-68
WP_071921559.1|4661217_4661376_-|lysis	phage lysis protein	lysis	A0A218M4L1	Erwinia_phage	74.0	6.4e-13
WP_071921560.1|4661772_4662282_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	78.4	1.1e-69
WP_007369270.1|4662265_4662502_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	51.7	1.5e-10
WP_035889146.1|4662694_4663201_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	75.0	2.7e-68
WP_071921561.1|4663298_4664042_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	68.7	3.9e-84
WP_071921562.1|4664045_4665203_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.3	5.3e-128
WP_071921563.1|4665236_4666097_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	72.0	4.4e-111
WP_071921564.1|4666274_4668044_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	84.9	8.8e-300
WP_071921565.1|4668043_4669066_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.4	7.9e-152
WP_071921566.1|4669115_4670894_-	DUF262 domain-containing protein	NA	A7XFF4	Enterobacteria_phage	32.5	2.2e-08
WP_071921567.1|4671104_4671524_-	hypothetical protein	NA	Q6K1E9	Salmonella_virus	67.6	1.0e-49
WP_083566050.1|4671664_4672147_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	64.0	7.5e-44
WP_071921568.1|4672219_4674442_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	84.8	0.0e+00
WP_071921569.1|4674442_4674664_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	78.1	1.2e-25
WP_023327788.1|4674663_4674891_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	73.3	1.7e-22
WP_007370020.1|4674958_4675297_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	82.1	1.2e-45
WP_071921570.1|4675260_4675461_-	DUF2724 domain-containing protein	NA	A0A218M4I1	Erwinia_phage	80.3	2.1e-24
WP_071921571.1|4675468_4675978_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	85.8	3.4e-79
WP_001630878.1|4676008_4676272_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_071921572.1|4676404_4676980_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.8	4.9e-66
WP_071921573.1|4676979_4678020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	94.8	5.5e-185
WP_071921574.1|4678007_4679027_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.1	2.8e-08
WP_071921902.1|4679848_4680787_+	hypothetical protein	NA	NA	NA	NA	NA
4679219:4679270	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_007370012.1|4680826_4681219_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007370011.1|4681317_4682037_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	35.7	5.4e-06
