The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	187350	193111	4054259		Burkholderia_virus(28.57%)	7	NA	NA
WP_024430280.1|187350_187668_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	3.7e-15
WP_038729261.1|187667_188585_+	hypothetical protein	NA	A4PE40	Ralstonia_virus	40.2	1.2e-45
WP_009922654.1|188838_189381_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.4	3.3e-48
WP_009932249.1|189638_190091_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_024430279.1|190090_191170_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	98.6	4.1e-159
WP_004525721.1|191326_191575_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_011857935.1|192409_193111_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	4.8e-07
>prophage 2
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	410075	428873	4054259	integrase,transposase,protease,plate	Leptospira_phage(25.0%)	16	414096:414112	424368:424384
WP_004191998.1|410075_411539_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004521939.1|411739_412948_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	8.5e-12
WP_004202811.1|412969_413716_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|413936_414557_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
414096:414112	attL	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_004199894.1|414557_415940_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024430740.1|415962_416721_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|416813_417425_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_075018813.1|417488_418004_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004555439.1|418663_419668_+	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
WP_122655376.1|420039_421159_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	9.5e-50
WP_122659501.1|423309_423735_-|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	49.6	1.6e-26
WP_123903074.1|423659_424187_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_111952238.1|425583_426174_+	hypothetical protein	NA	NA	NA	NA	NA
424368:424384	attR	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_009922432.1|426277_426643_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	1.1e-52
WP_024430119.1|426744_427530_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|427526_428873_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	784819	794066	4054259		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|784819_786772_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|787037_788168_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_024429805.1|788201_790211_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.7	1.8e-51
WP_024429806.1|790394_791210_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|791274_791958_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_009971015.1|791954_792482_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024429807.1|792518_794066_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 4
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	1135331	1144156	4054259		Bacillus_phage(16.67%)	9	NA	NA
WP_009921653.1|1135331_1136732_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|1136763_1137687_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|1137745_1138738_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|1138809_1139127_+	competence protein ComE	NA	NA	NA	NA	NA
WP_075018847.1|1139139_1139457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532363.1|1139468_1140371_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_075018848.1|1140597_1141920_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004522362.1|1142047_1142971_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_024429140.1|1143313_1144156_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.6	4.7e-17
>prophage 5
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	1408926	1502188	4054259	protease,capsid,head,terminase,portal,integrase,plate,tail,tRNA	uncultured_Caudovirales_phage(21.74%)	106	1417724:1417742	1475899:1475917
WP_012730070.1|1408926_1410453_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.8	2.1e-84
WP_004199566.1|1410546_1411651_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_009973795.1|1412011_1413706_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.1	5.3e-28
WP_004193226.1|1413721_1414798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004532144.1|1415370_1416624_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038728458.1|1416643_1417366_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.1	6.2e-34
WP_004192516.1|1417370_1418159_+	TatD family hydrolase	NA	NA	NA	NA	NA
1417724:1417742	attL	GCTGCGGCTCGCGCGCGAG	NA	NA	NA	NA
WP_152614954.1|1418211_1420740_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_004524730.1|1420776_1421604_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004192790.1|1421860_1423522_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.9e-150
WP_004193658.1|1423518_1424373_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.9	2.3e-48
WP_004192585.1|1424476_1425760_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	6.4e-151
WP_004191789.1|1425851_1426283_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_004532146.1|1426492_1426840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191092.1|1426923_1427874_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_024430506.1|1427912_1428437_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004202011.1|1428613_1429465_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024430507.1|1429620_1430511_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004202010.1|1430753_1431593_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_004192132.1|1431657_1432287_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_004192745.1|1432385_1433051_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_004191887.1|1433059_1434262_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024430508.1|1434258_1434873_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191516.1|1434917_1435820_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_024430509.1|1435930_1437073_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_024430510.1|1437077_1437854_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	1.9e-09
WP_004550225.1|1438094_1438349_-	lipoprotein	NA	NA	NA	NA	NA
WP_075018859.1|1438580_1439744_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004524740.1|1439836_1440382_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004540138.1|1440361_1441660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430512.1|1441646_1444319_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_004547867.1|1444490_1445792_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	2.3e-148
WP_009890227.1|1445742_1445985_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_024430513.1|1445993_1446467_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|1446475_1446805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430514.1|1446918_1448235_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_012730459.1|1448234_1448684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|1448680_1449286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|1449282_1449618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043277225.1|1449669_1449888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972304.1|1450016_1450472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|1450419_1450905_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_038707945.1|1451055_1451283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|1451371_1451899_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_004552751.1|1451912_1452266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014917505.1|1452572_1453043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004552754.1|1453162_1455655_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	4.7e-97
WP_004533678.1|1455850_1456438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935698.1|1456785_1457160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430517.1|1457526_1458096_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024430518.1|1458058_1460044_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	3.0e-179
WP_004533700.1|1460054_1460261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430519.1|1460257_1461751_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	1.3e-134
WP_024430520.1|1461747_1462848_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	36.3	7.9e-49
WP_004539732.1|1462874_1463219_+|head	head decoration protein	head	NA	NA	NA	NA
WP_080251186.1|1463253_1464279_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.2e-109
WP_004539695.1|1464282_1464573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|1464574_1465105_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_024430522.1|1465094_1465628_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	38.8	1.1e-22
WP_024430523.1|1465630_1466311_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	9.0e-19
WP_009964525.1|1466375_1466582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009927735.1|1466578_1466923_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	4.0e-23
WP_024430524.1|1466919_1467813_+|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	39.8	1.6e-47
WP_004547894.1|1467805_1468381_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_024430525.1|1468368_1469832_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.0	3.6e-214
WP_004552412.1|1469847_1470300_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.8	1.4e-44
WP_024430526.1|1470365_1471535_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.2	6.2e-161
WP_004533620.1|1471545_1472049_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	1.2e-41
WP_004533642.1|1472118_1472421_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_024430527.1|1472508_1474923_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.5	2.3e-69
WP_009909076.1|1474931_1475813_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	5.0e-30
WP_004540041.1|1475787_1475994_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
1475899:1475917	attR	CTCGCGCGCGAGCCGCAGC	NA	NA	NA	NA
WP_009890233.1|1476003_1477056_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	9.2e-79
WP_004533694.1|1477131_1477326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430528.1|1477318_1477816_+	lysozyme	NA	A4JX20	Burkholderia_virus	78.2	1.7e-67
WP_038731233.1|1477815_1478361_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.0	7.1e-83
WP_025369299.1|1478503_1479292_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	1.8e-151
WP_024430649.1|1479332_1480043_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.0	2.6e-37
WP_051227144.1|1480054_1480570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430648.1|1480541_1481015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043277222.1|1481007_1481511_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	38.7	3.3e-18
WP_024430646.1|1481510_1481936_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_009890263.1|1481997_1482279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009890265.1|1482278_1482743_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	60.4	9.7e-49
WP_024430645.1|1482824_1483394_+	DUF159 family protein	NA	A4JX27	Burkholderia_virus	82.3	2.0e-88
WP_144399193.1|1483691_1484162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430644.1|1484514_1484976_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	61.4	1.9e-44
WP_143292436.1|1485957_1486260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430642.1|1486738_1487878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024430641.1|1487874_1488708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009954883.1|1489946_1490162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009921282.1|1490065_1490317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527347.1|1490345_1490618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|1490897_1491701_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_071893098.1|1491744_1491996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202006.1|1491992_1492913_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004193377.1|1493103_1493889_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009921276.1|1493943_1494156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550230.1|1494224_1495025_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004193779.1|1495049_1495541_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_011851872.1|1495621_1496197_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004191389.1|1496253_1496919_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004192752.1|1497207_1498605_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004205123.1|1498652_1499591_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004193249.1|1499694_1500666_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_024430640.1|1500709_1502188_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	1705080	1709486	4054259		Burkholderia_virus(57.14%)	9	NA	NA
WP_043277238.1|1705080_1705266_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	87.8	3.2e-19
WP_071897863.1|1705249_1705435_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_076804729.1|1705455_1705767_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.2	4.5e-26
WP_038763587.1|1706187_1706790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430096.1|1707131_1707638_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	3.0e-19
WP_024430095.1|1707634_1708060_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_009937072.1|1708340_1708736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|1708989_1709217_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004527234.1|1709252_1709486_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
>prophage 7
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	2559993	2628630	4054259	capsid,head,holin,portal,terminase,integrase,tail	Burkholderia_virus(88.75%)	95	2573534:2573582	2628760:2628808
WP_024430357.1|2559993_2560416_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.5	4.9e-15
WP_024430356.1|2560412_2560919_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	38.7	1.1e-18
WP_024430720.1|2560911_2561385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204999.1|2561356_2561863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534505.1|2561871_2562585_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	43.8	1.5e-32
WP_122879358.1|2562605_2562812_-	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	86.7	3.7e-16
WP_038738024.1|2562959_2563205_+|integrase	tyrosine-type recombinase/integrase	integrase	A4PE72	Ralstonia_virus	80.0	1.2e-18
WP_004521810.1|2563498_2564329_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_024430719.1|2564876_2565785_+	aldose epimerase	NA	NA	NA	NA	NA
WP_004192768.1|2566081_2566783_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	44.8	9.9e-13
WP_004531123.1|2566860_2567034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075018913.1|2567096_2568764_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	2.3e-68
WP_004555943.1|2569028_2569379_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_004521813.1|2569386_2570778_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_024430717.1|2571032_2571224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011203877.1|2571298_2571562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004266561.1|2571912_2572731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004550641.1|2572882_2573341_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
2573534:2573582	attL	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
WP_024430716.1|2573779_2574451_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	99.6	7.5e-135
WP_011325405.1|2574536_2575178_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	100.0	1.2e-118
WP_004526688.1|2575310_2576402_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	100.0	1.5e-212
WP_004552924.1|2576429_2577164_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
WP_004552925.1|2577160_2577721_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	100.0	7.5e-104
WP_051227149.1|2577902_2578637_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	99.6	3.6e-130
WP_004526686.1|2578889_2579678_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	100.0	6.9e-156
WP_004552927.1|2579820_2580366_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	100.0	4.3e-88
WP_004552928.1|2580365_2580857_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	100.0	7.8e-89
WP_004552929.1|2580849_2581062_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_004552930.1|2581104_2581839_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	100.0	1.2e-146
WP_004552931.1|2581838_2582105_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	100.0	2.5e-49
WP_024429296.1|2582149_2585455_-|tail	phage tail protein	tail	Q6JIL2	Burkholderia_virus	99.5	0.0e+00
WP_024429295.1|2585451_2586036_-|tail	tail assembly protein	tail	A4JX15	Burkholderia_virus	99.5	2.0e-99
WP_015984981.1|2586032_2586785_-	C40 family peptidase	NA	A4JX14	Burkholderia_virus	100.0	2.7e-149
WP_015985005.1|2586834_2587518_-|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	100.0	1.3e-134
WP_024429294.1|2587514_2588903_-|tail	tail fiber domain-containing protein	tail	A4JX12	Burkholderia_virus	99.8	1.6e-272
WP_004548805.1|2588911_2589250_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
WP_024429293.1|2589246_2593311_-|tail	phage tail tape measure protein	tail	A4JX10	Burkholderia_virus	97.6	0.0e+00
WP_004526674.1|2593324_2593609_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	100.0	6.8e-45
WP_024429292.1|2593608_2594073_-|tail	tail assembly protein	tail	Q6JIM0	Burkholderia_virus	96.1	9.6e-81
WP_024429291.1|2594099_2594558_-	hypothetical protein	NA	Q8W6T9	Burkholderia_virus	84.9	2.8e-64
WP_004526671.1|2594619_2594967_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	100.0	4.5e-59
WP_024429290.1|2594963_2595386_-	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	99.3	1.0e-68
WP_024429289.1|2595378_2595705_-|head	phage head closure protein	head	A4JX04	Burkholderia_virus	87.0	1.8e-49
WP_024429288.1|2595704_2596271_-	hypothetical protein	NA	A4JX03	Burkholderia_virus	71.3	2.8e-74
WP_024429287.1|2596277_2596463_-	hypothetical protein	NA	A4JX02	Burkholderia_virus	62.3	6.2e-15
WP_024429286.1|2596523_2597831_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	82.1	2.4e-193
WP_024429285.1|2597932_2598901_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	97.2	5.0e-164
WP_024429284.1|2598897_2600157_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	99.8	3.8e-241
WP_024429283.1|2600161_2600347_-	hypothetical protein	NA	A4JWZ8	Burkholderia_virus	98.4	2.6e-21
WP_024429282.1|2600343_2602059_-|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	99.6	0.0e+00
WP_004549538.1|2602062_2602539_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	99.4	2.1e-86
WP_024429281.1|2602676_2603033_-	HNH endonuclease	NA	Q6JIE9	Burkholderia_virus	84.7	2.2e-53
WP_038738294.1|2603121_2603700_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	40.2	1.4e-20
WP_143281104.1|2603701_2604613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525420.1|2604874_2605159_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_004549731.1|2605142_2605412_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_004548453.1|2605460_2605904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429361.1|2605900_2606161_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	82.6	2.0e-35
WP_038725178.1|2606136_2606469_-	hypothetical protein	NA	Q6JIF6	Burkholderia_virus	97.3	1.8e-57
WP_038738296.1|2606498_2606897_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	98.5	1.4e-72
WP_043289604.1|2606911_2607259_-	DUF2591 domain-containing protein	NA	F8TVJ2	EBPR_siphovirus	39.7	1.1e-09
WP_143297881.1|2607255_2607600_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024429363.1|2607609_2608146_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	77.1	6.8e-70
WP_038738301.1|2608142_2609135_-	hypothetical protein	NA	A4JX55	Burkholderia_virus	98.8	2.9e-175
WP_004526650.1|2609288_2609549_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	100.0	4.2e-41
WP_015967391.1|2609545_2610367_-	chromosome partitioning protein	NA	Q8W6P2	Burkholderia_virus	100.0	8.0e-147
WP_024429365.1|2610401_2611364_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	99.3	3.5e-170
WP_024429366.1|2611801_2612116_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	98.1	1.6e-50
WP_009896483.1|2612262_2612703_-	hypothetical protein	NA	Q6JIG6	Burkholderia_virus	100.0	2.9e-79
WP_024429367.1|2612917_2613136_+	hypothetical protein	NA	Q6JIG7	Burkholderia_virus	97.2	7.3e-31
WP_024429368.1|2613132_2613465_-	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	97.3	7.6e-56
WP_004552953.1|2613581_2613896_-	transcriptional regulator	NA	Q6JIG9	Burkholderia_virus	100.0	3.0e-54
WP_015973603.1|2613959_2614361_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	100.0	1.7e-65
WP_024429369.1|2614357_2614621_-	hypothetical protein	NA	Q6JIH1	Burkholderia_virus	97.7	7.9e-40
WP_024429370.1|2614704_2615994_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	99.1	5.2e-233
WP_004526641.1|2616148_2617042_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	99.3	4.3e-170
WP_004526640.1|2617543_2617819_+	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	100.0	7.2e-44
WP_015967385.1|2617828_2617960_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	100.0	5.2e-16
WP_009946436.1|2617961_2618069_+	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	100.0	1.3e-12
WP_011853575.1|2618303_2618651_+	hypothetical protein	NA	A4JX37	Burkholderia_virus	100.0	1.7e-58
WP_075018996.1|2619091_2619790_-	hypothetical protein	NA	Q6JII1	Burkholderia_virus	96.6	2.2e-105
WP_004537646.1|2619931_2620081_+	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_015967381.1|2620077_2620890_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	100.0	5.1e-146
WP_024429396.1|2621163_2621871_+	hypothetical protein	NA	Q8W6Q8	Burkholderia_virus	90.6	7.5e-109
WP_024429397.1|2621884_2622556_+	hypothetical protein	NA	Q6JII5	Burkholderia_virus	96.0	8.3e-118
WP_080124839.1|2622816_2623035_+	hypothetical protein	NA	Q6JII7	Burkholderia_virus	98.6	1.0e-32
WP_024429399.1|2623049_2624633_+	hypothetical protein	NA	Q6JII8	Burkholderia_virus	64.1	1.6e-143
WP_004526632.1|2624629_2624887_+	hypothetical protein	NA	Q6JIJ0	Burkholderia_virus	100.0	1.7e-42
WP_128972389.1|2624879_2625122_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	98.8	1.2e-39
WP_004526630.1|2625111_2625450_+	hypothetical protein	NA	Q6JIJ2	Burkholderia_virus	100.0	3.1e-60
WP_080251143.1|2625407_2626418_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	99.1	3.8e-199
WP_024429401.1|2626490_2626736_-	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	98.8	1.0e-36
WP_004552963.1|2626744_2626954_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	100.0	1.8e-34
WP_004526625.1|2627305_2627530_+	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	100.0	2.9e-35
WP_004526624.1|2627529_2628630_+|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	100.0	5.4e-215
2628760:2628808	attR	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
>prophage 8
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	2993566	3027032	4054259	protease,capsid,head,terminase,portal,integrase,tail	Pseudomonas_phage(20.0%)	34	2987970:2987985	3001693:3001708
2987970:2987985	attL	ACGTCCTGTTCAGCGC	NA	NA	NA	NA
WP_024430024.1|2993566_2994784_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	45.1	9.6e-88
WP_144399179.1|2995072_2996077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154219364.1|2996468_2997338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430022.1|2997440_2997701_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075018923.1|2997704_2998070_+	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	47.9	8.0e-06
WP_038769830.1|2998066_2998372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204959.1|2998530_2998734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430019.1|2998711_2998936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430018.1|2998932_2999115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430017.1|2999107_2999359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430016.1|2999351_2999630_+	hypothetical protein	NA	Q3HQY6	Burkholderia_phage	68.4	3.0e-21
WP_075018924.1|2999565_2999859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430014.1|2999855_3000083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004541756.1|3000082_3000631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430012.1|3001302_3001605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075018925.1|3001601_3001892_+	HNH endonuclease	NA	NA	NA	NA	NA
3001693:3001708	attR	GCGCTGAACAGGACGT	NA	NA	NA	NA
WP_024430011.1|3001996_3002437_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	59.7	3.5e-40
WP_024430010.1|3002418_3003939_+|terminase	phage terminase	terminase	B5WZR8	Pseudomonas_phage	79.0	3.5e-228
WP_024430009.1|3003989_3005885_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	44.8	2.3e-133
WP_020850751.1|3005897_3006077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430008.1|3006076_3007366_+|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	45.8	2.0e-88
WP_024430007.1|3007355_3007673_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071897679.1|3007818_3008463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024430006.1|3008459_3009566_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	28.4	4.6e-20
WP_071897713.1|3009979_3010384_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	48.2	4.5e-10
WP_009952729.1|3010317_3012075_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004526362.1|3012099_3012324_-	CDI system lipoprotein BcpO	NA	NA	NA	NA	NA
WP_004526361.1|3012335_3012575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071897716.1|3012697_3022093_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.4	1.7e-35
WP_004526357.1|3023762_3024239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075018926.1|3024337_3024709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|3024705_3024930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|3025258_3026395_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|3026492_3027032_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 9
NZ_CP016909	Burkholderia pseudomallei strain Burk178-Type1 chromosome 1, complete sequence	4054259	3189271	3200243	4054259	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|3189271_3191572_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|3191568_3191883_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|3192415_3192619_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_024429959.1|3192747_3194364_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009929279.1|3194376_3194559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3194531_3195791_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3196057_3196636_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3196899_3197118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|3197309_3197819_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|3198128_3200243_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 1
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	87352	151907	3236690	transposase,plate,holin	Leptospira_phage(16.67%)	46	NA	NA
WP_024430630.1|87352_89548_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_075019027.1|89739_89895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529608.1|91444_92461_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004558008.1|92479_92932_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004523728.1|93393_94311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004544882.1|94297_95152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024430632.1|95148_96180_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_144399218.1|96822_97942_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004528499.1|98062_98368_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_075019191.1|98697_101475_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	2.6e-88
WP_043289808.1|101488_103729_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.7	4.0e-23
WP_004523723.1|103867_105406_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_024429211.1|105415_105679_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004523721.1|106093_106513_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|106532_106859_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004531587.1|107330_108023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075019193.1|108608_109232_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_004523716.1|109324_110920_-	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.3	1.9e-06
WP_024429213.1|112068_113526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260193.1|113869_114229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043276816.1|115077_117267_+	hypothetical protein	NA	A0A2C9CZG8	Yersinia_phage	46.1	5.1e-07
WP_075019028.1|117333_118821_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_004523708.1|118856_119072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071897942.1|119082_119637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523706.1|120222_120768_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024429217.1|120832_121570_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_075019194.1|121793_124427_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038726065.1|124419_124992_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_075019195.1|125056_125713_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_024429220.1|125715_127392_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004523700.1|127769_128309_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004523699.1|128342_129842_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004529642.1|130041_130524_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004529643.1|130651_131194_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_024429221.1|131199_132549_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004531577.1|132545_133847_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024429222.1|133861_137770_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004529647.1|137959_138529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004523693.1|141270_141540_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_024429224.1|141552_145005_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038725374.1|144897_146256_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.2	7.6e-110
WP_024429225.1|146288_147317_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004529651.1|147371_148442_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_024429226.1|148460_149510_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004523687.1|149506_151387_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004523686.1|151388_151907_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	572982	577544	3236690	transposase,integrase	Burkholderia_virus(85.71%)	9	562219:562233	593448:593462
562219:562233	attL	CTGGAGAGCTTGCCG	NA	NA	NA	NA
WP_004542585.1|572982_574182_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	99.5	1.1e-224
WP_043276559.1|574178_574328_-	hypothetical protein	NA	Q8W6Q6	Burkholderia_virus	98.0	8.2e-18
WP_024430860.1|575429_575696_+	hypothetical protein	NA	Q8W6Q4	Burkholderia_virus	97.6	1.1e-41
WP_024430861.1|575680_575902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557715.1|575928_576036_-	hypothetical protein	NA	Q6JIH6	Burkholderia_virus	97.1	8.2e-12
WP_021252031.1|576037_576169_-	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	95.3	2.2e-14
WP_038726742.1|576178_576454_-	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	98.9	4.7e-43
WP_004549731.1|577006_577276_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|577259_577544_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
593448:593462	attR	CTGGAGAGCTTGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	730173	801602	3236690	plate,holin	Vibrio_phage(33.33%)	56	NA	NA
WP_004188389.1|730173_730941_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|730979_731981_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|731977_732751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009933059.1|732747_733437_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_024430690.1|733801_735316_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_075019054.1|735285_735582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530037.1|737025_737964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|737997_738546_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004530038.1|738542_740054_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|740197_740725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|740804_741236_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|741249_743112_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|743108_744098_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|744100_746971_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004525548.1|746961_749253_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038774636.1|749418_751707_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004548408.1|751710_753927_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004202229.1|753926_754997_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|754999_755716_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_024430144.1|755758_756148_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|756153_756747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525552.1|756743_758105_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_075019055.1|758130_759846_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|759842_763346_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|763404_763764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545583.1|763786_764218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530793.1|764442_764814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009923697.1|764911_765085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|765364_766264_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004199051.1|766350_766479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850331.1|766486_767806_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004524286.1|767802_769389_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011205425.1|769701_770697_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024430146.1|770822_771014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528656.1|771010_772594_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|773332_774586_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024430154.1|775099_776365_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_075019056.1|776497_778063_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004538946.1|778251_779268_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|779757_780957_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|781134_782160_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004530801.1|782592_783867_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_004186989.1|783939_784911_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|785061_785595_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|785655_787719_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|787721_789647_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|789651_790824_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|790820_791606_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_144399211.1|791630_792899_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_004530056.1|792919_794065_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523141.1|794174_795038_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|795218_796874_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|796960_797836_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004523143.1|797979_798879_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|799014_800568_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_075019210.1|800603_801602_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	1427531	1533774	3236690	tail,head,portal,plate,capsid,protease,terminase,holin	Burkholderia_virus(46.15%)	107	NA	NA
WP_004199327.1|1427531_1428404_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004199325.1|1428615_1429320_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011205503.1|1429489_1430536_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199295.1|1431283_1431442_+	lipoprotein	NA	NA	NA	NA	NA
WP_004199294.1|1431457_1431979_+	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
WP_004542736.1|1431975_1432800_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_004536762.1|1432857_1433844_+	YceI family protein	NA	NA	NA	NA	NA
WP_004528277.1|1433883_1434243_+	lipoprotein	NA	NA	NA	NA	NA
WP_043276786.1|1434457_1434688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524116.1|1434709_1435219_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004524117.1|1435215_1436220_+	FecR family protein	NA	NA	NA	NA	NA
WP_075019228.1|1436538_1439004_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004548936.1|1439222_1440203_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024429157.1|1440195_1441281_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024429158.1|1441277_1443104_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.2e-09
WP_004551656.1|1443100_1444150_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_154219343.1|1444238_1444667_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011205512.1|1444781_1445522_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_041188241.1|1445855_1446107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202590.1|1446269_1447529_-	monooxygenase	NA	NA	NA	NA	NA
WP_004524126.1|1447748_1449212_-	MFS transporter	NA	NA	NA	NA	NA
WP_004198472.1|1449629_1449878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071898081.1|1450324_1450525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524130.1|1450517_1450790_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|1450893_1452288_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_024429160.1|1452284_1452974_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	37.3	4.4e-37
WP_004532847.1|1452980_1456214_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004539131.1|1456258_1457728_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_133961587.1|1457738_1459097_-	TolC family protein	NA	NA	NA	NA	NA
WP_004524133.1|1459358_1459643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|1460041_1460182_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_024429162.1|1460856_1461345_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|1461676_1462162_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_015600260.1|1462357_1462687_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	92.7	1.2e-53
WP_038760824.1|1462919_1463072_+	hypothetical protein	NA	R4JMC2	Burkholderia_phage	70.0	3.1e-12
WP_043276762.1|1463059_1463929_+	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	86.3	1.5e-130
WP_128972238.1|1463925_1464426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024429164.1|1464456_1464642_+	hypothetical protein	NA	A4JWW7	Burkholderia_virus	86.9	5.4e-19
WP_009897093.1|1464638_1464860_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	100.0	1.6e-38
WP_038760828.1|1464863_1465079_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	95.8	3.9e-29
WP_038760831.1|1465090_1465228_+	hypothetical protein	NA	A4JWW4	Burkholderia_virus	93.3	8.9e-19
WP_009971784.1|1465389_1465602_+	hypothetical protein	NA	A4JWW3	Burkholderia_virus	100.0	1.1e-34
WP_044365827.1|1467154_1467361_+	DNA methyltransferase	NA	A4JWW1	Burkholderia_virus	94.1	2.0e-30
WP_024429166.1|1467360_1469154_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	92.6	0.0e+00
WP_004542802.1|1469169_1469436_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	98.8	3.5e-43
WP_024429167.1|1469432_1469639_+	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	89.4	4.9e-29
WP_051781513.1|1470025_1471390_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	5.1e-21
WP_009979045.1|1471500_1473750_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_080002914.1|1473676_1474390_+	cellulose biosynthesis protein BcsS	NA	NA	NA	NA	NA
WP_075019229.1|1474994_1475318_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	97.2	9.1e-54
WP_004202809.1|1475320_1475677_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_038789201.1|1475720_1476776_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	99.1	1.3e-205
WP_024429661.1|1476772_1478542_-|terminase	terminase ATPase subunit family protein	terminase	A4JWU9	Burkholderia_virus	99.5	0.0e+00
WP_015985028.1|1478685_1479495_+|capsid	GPO family capsid scaffolding protein	capsid	A4JWQ0	Burkholderia_virus	100.0	1.3e-144
WP_024429662.1|1479528_1480542_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	99.1	1.8e-188
WP_004524435.1|1480538_1481228_+|terminase	phage terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	99.6	1.6e-116
WP_024429663.1|1481327_1481807_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	99.4	7.6e-81
WP_004524437.1|1481806_1482058_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	100.0	7.6e-40
WP_004524438.1|1482054_1482261_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004524439.1|1482275_1482620_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	100.0	2.9e-50
WP_004524440.1|1482621_1482894_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_024429664.1|1482890_1483703_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	99.6	7.7e-150
WP_024429665.1|1483699_1484140_+	hypothetical protein	NA	K4NXJ2	Burkholderia_phage	97.3	4.0e-68
WP_004531054.1|1484244_1484661_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_024429666.1|1484657_1485125_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	93.5	8.8e-74
WP_004553025.1|1485381_1485528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024429667.1|1485524_1486283_-	site-specific DNA-methyltransferase	NA	A4JWT4	Burkholderia_virus	94.3	4.5e-136
WP_024429668.1|1486456_1487137_+|plate	phage baseplate assembly protein V	plate	A4JWY4	Burkholderia_virus	96.5	3.4e-119
WP_024429669.1|1487133_1487496_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	99.2	5.0e-61
WP_024429670.1|1487492_1488398_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	99.7	6.7e-163
WP_043276251.1|1488390_1488945_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	98.9	4.2e-99
WP_075019089.1|1488946_1491319_+|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	99.2	0.0e+00
WP_024429672.1|1491335_1492007_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	96.0	2.0e-111
WP_024429673.1|1492062_1493235_+|tail	phage tail sheath protein	tail	Q45YG5	Burkholderia_virus	99.0	1.3e-222
WP_004524455.1|1493250_1493760_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	100.0	4.9e-94
WP_004531064.1|1493817_1494162_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_004552648.1|1494170_1494284_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	100.0	5.4e-14
WP_075019090.1|1494280_1497247_+	hypothetical protein	NA	A4JWX4	Burkholderia_virus	99.7	0.0e+00
WP_004524457.1|1497264_1497690_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	100.0	1.2e-72
WP_024429675.1|1497689_1498790_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	98.6	7.6e-201
WP_006027238.1|1498863_1499082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909378.1|1499162_1499483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004528294.1|1500491_1501607_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_004524142.1|1502317_1502647_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011205535.1|1502660_1503212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075019091.1|1503651_1504488_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_024429676.1|1504855_1505431_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_004549047.1|1505427_1507275_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_024429677.1|1507278_1510086_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	26.5	1.0e-07
WP_024429678.1|1510380_1511514_-	CapA family protein	NA	S4VS02	Pandoravirus	55.9	3.6e-113
WP_004528305.1|1512126_1512387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429679.1|1513843_1514467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429680.1|1514518_1517032_-	cation-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.9	3.6e-57
WP_004528311.1|1517129_1517609_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_011205539.1|1518631_1519441_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004557575.1|1519690_1521121_-	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_004547623.1|1521203_1522004_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024429682.1|1522231_1522972_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004528318.1|1522987_1523977_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_004528319.1|1523978_1524434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205540.1|1524430_1524994_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.9	1.9e-14
WP_004531806.1|1525492_1526287_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004533011.1|1526343_1527492_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_004551671.1|1527695_1528532_-	EamA family transporter	NA	NA	NA	NA	NA
WP_024429683.1|1529236_1530727_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_004532965.1|1531026_1531635_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024429684.1|1531773_1533774_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	6.4e-105
>prophage 5
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	2055933	2108559	3236690	transposase,plate	Bacillus_virus(16.67%)	43	NA	NA
WP_144399227.1|2055933_2056551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004198523.1|2056719_2056905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430807.1|2056990_2057890_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004552420.1|2057867_2057999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525360.1|2058370_2059225_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	47.4	1.0e-59
WP_024430806.1|2059479_2060505_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004546897.1|2060616_2061834_+	UPF0261 family protein	NA	NA	NA	NA	NA
WP_004201924.1|2061836_2062679_+	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_004184911.1|2062724_2063165_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_004200986.1|2063571_2065134_+	nitrite reductase, copper-containing	NA	NA	NA	NA	NA
WP_004553512.1|2065158_2065995_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_004525356.1|2065991_2066606_+	SCO family protein	NA	NA	NA	NA	NA
WP_075019248.1|2066867_2067500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525351.1|2067643_2068669_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.1	2.4e-07
WP_011205625.1|2068937_2070197_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_075019114.1|2070219_2071785_+	intracellular motility protein A	NA	B0FIT1	Escherichia_phage	37.0	2.5e-08
WP_004184741.1|2071864_2072242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075019115.1|2072526_2074383_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004206312.1|2074379_2075117_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024430804.1|2075113_2076946_-	histidine kinase	NA	NA	NA	NA	NA
WP_004200975.1|2077205_2077700_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004528790.1|2077723_2079223_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004525344.1|2079442_2079952_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004525343.1|2079944_2080406_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004525342.1|2080442_2082185_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_043289839.1|2083180_2086282_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	2.1e-78
WP_038755508.1|2086308_2089332_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-22
WP_024430800.1|2089357_2092000_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_024430799.1|2092017_2093082_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_024430798.1|2093078_2093834_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004200966.1|2093862_2094255_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004200965.1|2094264_2095062_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011853440.1|2095094_2096492_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184888.1|2096488_2097154_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_024430797.1|2097165_2101107_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_075019116.1|2101686_2103132_+	peptidase	NA	NA	NA	NA	NA
WP_038735265.1|2103291_2103585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528803.1|2103589_2104222_+	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_153260200.1|2105282_2106137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934666.1|2106107_2106410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004551886.1|2106843_2107287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557777.1|2107371_2107659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004557778.1|2107920_2108559_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	2462334	2529095	3236690	tRNA,portal,integrase,transposase,protease	Burkholderia_phage(18.18%)	43	2505822:2505837	2530552:2530567
WP_144399223.1|2462334_2463455_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	9.5e-50
WP_071898247.1|2463636_2464137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540369.1|2465254_2466676_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	1.5e-20
WP_024430676.1|2467015_2467858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080251205.1|2467928_2468708_-	SapC family protein	NA	NA	NA	NA	NA
WP_124518497.1|2468717_2471048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399222.1|2471172_2487468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075019142.1|2487757_2488138_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080002865.1|2490817_2491429_-	MepB family protein	NA	NA	NA	NA	NA
WP_063828370.1|2495154_2496705_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004190933.1|2498059_2500102_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_024430707.1|2500160_2500499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024430708.1|2500545_2502420_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	1.1e-66
WP_004190948.1|2502514_2502961_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190342.1|2503127_2503340_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024430709.1|2503419_2504643_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004557829.1|2504788_2505829_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.3e-93
2505822:2505837	attL	CGCGATAGCGCGCGAA	NA	NA	NA	NA
WP_004195713.1|2506227_2507037_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004540286.1|2507187_2509092_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|2509175_2510060_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|2510056_2510350_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|2510619_2511726_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_075019145.1|2511876_2513340_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.1	1.8e-80
WP_024429604.1|2513462_2514332_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|2514390_2515266_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004204467.1|2515425_2515647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009934941.1|2515719_2515812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009926480.1|2515986_2517780_+	membrane protein	NA	NA	NA	NA	NA
WP_144399221.1|2517773_2518010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190401.1|2518015_2519398_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024429603.1|2519716_2522488_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	1.1e-70
WP_004530319.1|2522489_2523239_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_071898251.1|2523235_2523505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009969172.1|2523656_2523941_+	membrane protein	NA	NA	NA	NA	NA
WP_038735303.1|2524590_2525082_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_009926491.1|2525417_2525594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203322.1|2525518_2525782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009950024.1|2525780_2525954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004525133.1|2525960_2527187_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_124518488.1|2527303_2527492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529037.1|2527741_2527879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557831.1|2528124_2528412_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	93.3	4.9e-43
WP_004544833.1|2528408_2529095_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	83.0	1.4e-96
2530552:2530567	attR	CGCGATAGCGCGCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP016910	Burkholderia pseudomallei strain Burk178-Type1 chromosome 2, complete sequence	3236690	2860649	2917717	3236690	transposase,plate	Ralstonia_phage(22.22%)	32	NA	NA
WP_004529292.1|2860649_2861378_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.7	8.4e-23
WP_004529293.1|2861581_2862022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144399411.1|2862581_2863702_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	6.2e-49
WP_024429915.1|2863732_2864107_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_011205722.1|2864325_2866095_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_134868702.1|2866324_2866597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009941131.1|2866605_2866935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429917.1|2866941_2876253_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071811406.1|2876404_2876602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|2876602_2876866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075019266.1|2877458_2882090_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.9	8.3e-23
WP_004524859.1|2882103_2883372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024429919.1|2883387_2885592_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.7	7.1e-41
WP_004540568.1|2887609_2888209_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|2888233_2888644_-	RidA family protein	NA	NA	NA	NA	NA
WP_004530174.1|2890073_2890421_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.0	4.7e-40
WP_043277381.1|2890417_2890825_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	44.4	1.7e-09
WP_043277340.1|2891272_2893306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004546333.1|2893546_2895718_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|2895722_2896574_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004544732.1|2896574_2897528_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|2897560_2898802_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|2898837_2900082_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_075019267.1|2900124_2902185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075019167.1|2902535_2903594_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552182.1|2904988_2905774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075019268.1|2906505_2907105_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_004203275.1|2908971_2911176_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_024429924.1|2911172_2913839_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.0e-78
WP_024429925.1|2913817_2915296_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004553897.1|2915292_2917164_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009935240.1|2917168_2917717_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
