The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013305	Vibrio cholerae strain CRC1106 chromosome 1, complete sequence	2999012	566792	574016	2999012		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_000698379.1|566792_567545_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
WP_000002982.1|567537_568164_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000177568.1|568163_569099_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000116737.1|569172_570180_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_001894770.1|570272_572861_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_001279365.1|573128_574016_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
>prophage 2
NZ_CP013305	Vibrio cholerae strain CRC1106 chromosome 1, complete sequence	2999012	805595	812788	2999012		Faustovirus(16.67%)	9	NA	NA
WP_000775253.1|805595_806810_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
WP_000331703.1|806846_807230_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000301571.1|807290_807614_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_001105747.1|807662_808178_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196560.1|808201_810052_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001124187.1|810065_810404_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000872176.1|810452_810647_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000107237.1|810866_812156_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_001162850.1|812359_812788_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
>prophage 3
NZ_CP013305	Vibrio cholerae strain CRC1106 chromosome 1, complete sequence	2999012	1551161	1583771	2999012	coat	Vibrio_phage(47.37%)	24	NA	NA
WP_149591715.1|1551161_1553267_-	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
WP_001906284.1|1553693_1554041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001881196.1|1554066_1554528_+	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_000517826.1|1554551_1568189_+	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_000593522.1|1568646_1569021_-	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_001881225.1|1569017_1569794_-	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000021616.1|1569892_1571092_-	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_000979342.1|1571088_1571382_-	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_001268534.1|1571378_1572566_-|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000493022.1|1572672_1572921_-	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001911548.1|1573056_1573416_-	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000743997.1|1573417_1574497_-	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_000693566.1|1574622_1574961_+	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000053920.1|1575472_1575697_-	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_001911551.1|1575790_1576141_-	hypothetical protein	NA	U5TMH5	Satellite_phage	100.0	1.0e-63
WP_000743997.1|1576142_1577222_-	replication initiation factor domain-containing protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_000693566.1|1577347_1577686_+	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000170634.1|1578175_1578760_-	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_001161489.1|1578752_1578920_-	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_001052672.1|1578997_1579690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000512956.1|1579819_1580089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001881266.1|1580108_1581677_-	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
WP_000005769.1|1581853_1582405_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161489.1|1583603_1583771_-	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
>prophage 4
NZ_CP013305	Vibrio cholerae strain CRC1106 chromosome 1, complete sequence	2999012	2322767	2405853	2999012	tRNA,plate,capsid,terminase,head,tail,portal,integrase	Vibrio_phage(83.67%)	84	2339180:2339203	2372290:2372313
WP_000186559.1|2322767_2323250_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000809002.1|2323383_2325045_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000400335.1|2325586_2326438_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.7	2.6e-47
WP_000933144.1|2326457_2327270_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000272895.1|2327285_2327669_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_000117270.1|2327668_2328529_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000647701.1|2328532_2329621_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	46.4	2.4e-05
WP_000054219.1|2329650_2330910_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000993150.1|2331068_2331686_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000581228.1|2331682_2332555_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001113134.1|2332585_2333530_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	1.7e-44
WP_000081944.1|2333698_2334289_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505884.1|2334299_2335391_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000290380.1|2337730_2338864_-	flagellin	NA	NA	NA	NA	NA
2339180:2339203	attL	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
WP_000779002.1|2339887_2341519_-	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
WP_000457681.1|2341515_2341989_-	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000267787.1|2341976_2342870_-	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_071908294.1|2342872_2343397_-|tail	phage tail protein	tail	A9ZT45	Vibrio_virus	99.4	4.1e-96
WP_000083759.1|2343396_2345259_-|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000005870.1|2345255_2345915_-	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000044509.1|2345911_2347111_-|plate	baseplate J/gp47 family protein	plate	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_001113003.1|2347107_2347440_-	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000343647.1|2347429_2349247_-|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_000165786.1|2349443_2349725_-	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_001881877.1|2349721_2350024_-	hypothetical protein	NA	U3PCH1	Vibrio_phage	100.0	1.5e-50
WP_000990572.1|2349932_2350274_-	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_000705022.1|2350248_2350836_-	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_001077689.1|2350822_2351050_-	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000382491.1|2351046_2351256_-	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_000063627.1|2351270_2351729_-	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000312540.1|2351728_2352838_-	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000461677.1|2352839_2353499_-	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000122189.1|2353485_2353974_-|tail	phage tail protein	tail	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000493401.1|2353970_2354432_-|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000059165.1|2354538_2355255_-|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000078361.1|2355270_2356281_-|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_001127095.1|2356317_2357217_-|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000331803.1|2357390_2359208_+|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001999948.1|2359204_2360251_+|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000729650.1|2360234_2360450_+	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001263191.1|2360520_2360772_+	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_001292395.1|2360772_2361018_-	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001140408.1|2361255_2361594_+	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_000756239.1|2361667_2362204_-	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001909657.1|2362213_2364799_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000613058.1|2364795_2365380_-	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_000629095.1|2365376_2365487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000099608.1|2365483_2366101_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_001198814.1|2366097_2366325_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000997540.1|2366574_2366985_-	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001031152.1|2366981_2367515_-	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_001272765.1|2367596_2368031_-	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_000253093.1|2368043_2368583_-	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_000959026.1|2368693_2368906_-	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_001881894.1|2369051_2369699_+	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000132153.1|2369724_2370630_+	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_000985033.1|2370629_2371043_+	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000116333.1|2371042_2372080_+|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
WP_000154827.1|2372528_2373668_-	flagellin	NA	NA	NA	NA	NA
2372290:2372313	attR	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
WP_000934642.1|2374075_2375269_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_000135483.1|2375281_2377156_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_000609516.1|2377335_2378274_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M9Y4	Brevibacillus_phage	31.9	9.5e-11
WP_001225051.1|2378284_2379370_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_001911822.1|2379460_2380237_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_001182097.1|2380260_2381049_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_000373284.1|2381068_2381818_-	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_000122825.1|2382000_2383305_-	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000929365.1|2383333_2384041_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_000051920.1|2384058_2384475_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_001007981.1|2384479_2384875_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_000125387.1|2385094_2385922_-	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_000145786.1|2385932_2386859_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.4e-35
WP_001881906.1|2386915_2387683_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000907265.1|2387813_2388137_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_000729367.1|2388240_2388666_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_001881911.1|2388775_2389213_-	flagellar assembly lipoprotein FlgP	NA	NA	NA	NA	NA
WP_000759070.1|2389220_2389856_-	membrane protein	NA	NA	NA	NA	NA
WP_000739493.1|2390016_2391150_+	flagella assembly protein FlgT	NA	NA	NA	NA	NA
WP_000523394.1|2391279_2398533_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	2.9e-30
WP_000064348.1|2398778_2399594_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000279435.1|2399897_2401961_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001895039.1|2402572_2403079_+	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000731531.1|2403167_2404133_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000216841.1|2404428_2405853_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP013305	Vibrio cholerae strain CRC1106 chromosome 1, complete sequence	2999012	2460652	2467269	2999012		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000864130.1|2460652_2461123_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
WP_001122865.1|2461387_2462497_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000493874.1|2462537_2463191_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001131994.1|2463195_2464299_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000543544.1|2464324_2464774_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_000366574.1|2464873_2466124_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000210573.1|2466135_2467269_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
