The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013301	Vibrio cholerae strain C5 chromosome 1, complete sequence	2996195	572561	579785	2996195		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_000698379.1|572561_573314_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.3	8.0e-69
WP_000002982.1|573306_573933_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_000177568.1|573932_574868_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000116737.1|574941_575949_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_001894770.1|576041_578630_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_001279365.1|578897_579785_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
>prophage 2
NZ_CP013301	Vibrio cholerae strain C5 chromosome 1, complete sequence	2996195	811133	818326	2996195		Faustovirus(16.67%)	9	NA	NA
WP_000775253.1|811133_812348_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
WP_000331703.1|812384_812768_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000301571.1|812828_813152_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_001105747.1|813200_813716_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196560.1|813739_815590_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001124187.1|815603_815942_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000872176.1|815990_816185_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000107237.1|816404_817694_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_001162850.1|817897_818326_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
>prophage 3
NZ_CP013301	Vibrio cholerae strain C5 chromosome 1, complete sequence	2996195	1556700	1584490	2996195	coat	Vibrio_phage(61.54%)	17	NA	NA
WP_149591715.1|1556700_1558806_-	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
WP_001906284.1|1559232_1559580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001881196.1|1559605_1560067_+	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_000517826.1|1560090_1573728_+	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_000593522.1|1574185_1574560_-	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_001881225.1|1574556_1575333_-	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000021616.1|1575431_1576631_-	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_000979342.1|1576627_1576921_-	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_001268534.1|1576917_1578105_-|coat	minor coat protein pIII	coat	A0A142I701	Vibrio_phage	100.0	1.4e-200
WP_000493022.1|1578211_1578460_-	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001911548.1|1578595_1578955_-	hypothetical protein	NA	A0A0N9HE73	Vibrio_phage	100.0	4.4e-65
WP_000693566.1|1580160_1580499_+	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000170634.1|1580988_1581573_-	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_001161489.1|1581565_1581733_-	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_001052672.1|1581810_1582503_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000512956.1|1582632_1582902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001881266.1|1582921_1584490_-	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
>prophage 4
NZ_CP013301	Vibrio cholerae strain C5 chromosome 1, complete sequence	2996195	2325571	2374884	2996195	integrase,plate,portal,tRNA,capsid,terminase,head,tail	Vibrio_phage(89.13%)	58	2341984:2342007	2375094:2375117
WP_000186559.1|2325571_2326054_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000809002.1|2326187_2327849_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000400335.1|2328390_2329242_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.7	2.6e-47
WP_000933144.1|2329261_2330074_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000272895.1|2330089_2330473_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_000117270.1|2330472_2331333_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000647701.1|2331336_2332425_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	46.4	2.4e-05
WP_000054219.1|2332454_2333714_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000993150.1|2333872_2334490_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000581228.1|2334486_2335359_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001113134.1|2335389_2336334_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.0	1.7e-44
WP_000081944.1|2336502_2337093_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505884.1|2337103_2338195_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000290380.1|2340534_2341668_-	flagellin	NA	NA	NA	NA	NA
2341984:2342007	attL	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
WP_000779002.1|2342691_2344323_-	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
WP_000457681.1|2344319_2344793_-	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000267787.1|2344780_2345674_-	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000369864.1|2345676_2346201_-	hypothetical protein	NA	A9ZT45	Vibrio_virus	100.0	4.8e-97
WP_000083759.1|2346200_2348063_-|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000005870.1|2348059_2348719_-	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000044509.1|2348715_2349915_-|plate	baseplate J/gp47 family protein	plate	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_001113003.1|2349911_2350244_-	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000343647.1|2350233_2352051_-|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_000165786.1|2352247_2352529_-	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_001881877.1|2352525_2352828_-	hypothetical protein	NA	U3PCH1	Vibrio_phage	100.0	1.5e-50
WP_000990572.1|2352736_2353078_-	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_000705022.1|2353052_2353640_-	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_001077689.1|2353626_2353854_-	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000382491.1|2353850_2354060_-	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_000063627.1|2354074_2354533_-	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000312540.1|2354532_2355642_-	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000461677.1|2355643_2356303_-	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000122189.1|2356289_2356778_-|tail	phage tail protein	tail	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000493401.1|2356774_2357236_-|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000059165.1|2357342_2358059_-|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000078361.1|2358074_2359085_-|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_001127095.1|2359121_2360021_-|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000331803.1|2360194_2362012_+|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001999948.1|2362008_2363055_+|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000729650.1|2363038_2363254_+	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001263191.1|2363324_2363576_+	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_001292395.1|2363576_2363822_-	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001140408.1|2364059_2364398_+	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_000756239.1|2364471_2365008_-	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001909657.1|2365017_2367603_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000613058.1|2367599_2368184_-	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_000629095.1|2368180_2368291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000099608.1|2368287_2368905_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_001198814.1|2368901_2369129_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000997540.1|2369378_2369789_-	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001031152.1|2369785_2370319_-	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_001272765.1|2370400_2370835_-	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_000253093.1|2370847_2371387_-	phage regulatory CII family protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_000959026.1|2371497_2371710_-	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_001881894.1|2371855_2372503_+	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000132153.1|2372528_2373434_+	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_000985033.1|2373433_2373847_+	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000116333.1|2373846_2374884_+|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
2375094:2375117	attR	CAGAAAAAAGAAAAGCCCCTTTTC	NA	NA	NA	NA
>prophage 5
NZ_CP013301	Vibrio cholerae strain C5 chromosome 1, complete sequence	2996195	2463456	2470073	2996195		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000864130.1|2463456_2463927_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
WP_001122865.1|2464191_2465301_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000493874.1|2465341_2465995_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001131994.1|2465999_2467103_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000543544.1|2467128_2467578_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_000366574.1|2467677_2468928_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000210573.1|2468939_2470073_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
