The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	964804	973536	4806964	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|964804_965923_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|965919_967866_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|967995_968217_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|968540_968861_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_071953427.1|968891_971168_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|971359_971818_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|972280_973536_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	1023380	1121728	4806964	portal,tail,lysis,protease,tRNA,holin	Salmonella_phage(42.86%)	98	NA	NA
WP_001154025.1|1023380_1024184_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1024176_1025499_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1025479_1026184_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1026183_1030650_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1030994_1032836_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1033095_1033644_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1033671_1034319_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1034380_1035571_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1035755_1036847_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1037453_1038854_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1039054_1039516_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071953431.1|1039832_1041047_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1042804_1044007_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1044201_1045494_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1045538_1045787_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1045827_1046067_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1046109_1047267_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1047229_1050115_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1050241_1050541_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1050562_1050721_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_078008757.1|1050713_1050974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1051023_1051434_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1051553_1051793_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1051758_1052133_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1052217_1053201_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1053203_1053953_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1053963_1054311_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1054307_1054619_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1054696_1054987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1055278_1055512_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1055623_1055845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1055927_1056530_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1056738_1057350_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1057346_1057493_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1057482_1058280_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001534733.1|1058836_1058962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1059097_1059547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1059907_1060594_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1060869_1061199_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1061182_1061635_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1061652_1062132_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1062339_1062873_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000196190.1|1064965_1065172_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1065168_1066716_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1066639_1068721_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_000774239.1|1069128_1069428_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1069408_1069975_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1069971_1070373_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_071953432.1|1070384_1071134_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	1.4e-89
WP_000478859.1|1071179_1071578_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1071574_1071904_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1071983_1074971_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1074967_1075300_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_071953433.1|1075398_1075896_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	30.0	8.0e-09
WP_000877926.1|1076012_1076546_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1076635_1077331_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1077340_1078078_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1077975_1078680_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1078751_1081199_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_170919158.1|1081225_1082101_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1082139_1082382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1082435_1084874_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1084873_1085455_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_071953434.1|1085458_1085731_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	63.4	4.4e-17
WP_065304666.1|1085729_1086440_+	pathogenicity island 2 effector protein SseI	NA	Q9MBL9	Phage_Gifsy-2	99.2	6.5e-137
WP_000334547.1|1087087_1087714_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1087782_1088082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1089024_1089216_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1089642_1092255_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1092462_1093473_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1093638_1094181_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1094177_1095287_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1095385_1097494_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1097506_1099414_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1099428_1100682_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_015675524.1|1100721_1102326_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1102322_1102886_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1103140_1103308_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1103407_1103926_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1103994_1105755_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1105940_1106393_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1106464_1107517_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1107873_1108383_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1108599_1109205_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1109191_1111345_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1111363_1111810_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1111933_1113988_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1114023_1114482_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1114576_1115239_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1115412_1115826_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1115870_1116188_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1116245_1117457_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1117671_1118220_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1118245_1119025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1119073_1119355_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1119351_1119681_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1119767_1120427_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1121047_1121728_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	1904737	1911546	4806964	integrase,tail	Salmonella_phage(33.33%)	11	1899600:1899622	1909315:1909337
1899600:1899622	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1904737_1905619_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1906091_1906280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1906344_1906512_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1906768_1907302_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1907355_1907586_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1907775_1908270_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1908329_1909184_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1909557_1909911_-	YebY family protein	NA	NA	NA	NA	NA
1909315:1909337	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1909927_1910803_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1910803_1911178_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1911315_1911546_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	2015480	2064532	4806964	portal,integrase,tail,protease,plate,terminase,capsid,holin,head	Salmonella_phage(85.71%)	67	2016652:2016666	2062008:2062022
WP_001157322.1|2015480_2016911_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
2016652:2016666	attL	GGATGATGCGCTGGC	NA	NA	NA	NA
WP_000377041.1|2016984_2017680_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2017771_2018071_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2018719_2019916_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2020176_2020365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2020375_2020588_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_071953501.1|2021042_2022311_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.7e-226
WP_000394196.1|2022313_2022733_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2022859_2023021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2024214_2024427_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2024423_2024837_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2024884_2024998_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2025072_2025306_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2025419_2026025_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2025994_2027557_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2027543_2028131_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2028133_2029213_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2029205_2029619_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2029623_2030157_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2030156_2031215_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2031211_2032552_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2032585_2034514_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2034598_2034892_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2034921_2035278_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2035277_2036774_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2036763_2036928_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2036931_2037492_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_023892996.1|2037488_2038001_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	99.4	1.3e-91
WP_000702410.1|2037972_2038377_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2038373_2038697_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2038699_2038900_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2038950_2040156_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2040170_2040821_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2040798_2042040_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2042039_2042222_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2042233_2043967_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2043963_2044458_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2044583_2044934_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2044984_2045317_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2045779_2046172_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2046168_2046783_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2046782_2047064_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2047050_2047437_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2047582_2047840_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2047990_2048743_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001241579.1|2049617_2050007_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2050003_2050897_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2050896_2051379_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2051380_2052199_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2052195_2052420_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2052416_2053574_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2053570_2054125_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2054153_2054378_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2054475_2055171_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2055376_2055715_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2055677_2055902_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2056441_2056813_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2056870_2057698_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2057834_2058374_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2058444_2058978_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2058979_2059237_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2059247_2059829_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_071953502.1|2059832_2060402_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	1.2e-109
WP_001527041.1|2060441_2060669_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2060670_2061660_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2061951_2062749_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2062008:2062022	attR	GGATGATGCGCTGGC	NA	NA	NA	NA
WP_001219015.1|2064058_2064532_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 5
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	2154715	2161029	4806964		Enterobacteria_phage(50.0%)	6	NA	NA
WP_000973708.1|2154715_2155267_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2155267_2156146_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2156193_2157093_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2157092_2158178_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2158554_2159448_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2159625_2161029_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	2229336	2238507	4806964	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2229336_2231370_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2231610_2232069_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2232240_2232771_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2232827_2233295_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2233341_2234061_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2234057_2235743_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2235965_2236697_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2236756_2236864_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2236844_2237576_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2237559_2238507_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	2310551	2320583	4806964	tail,holin	Salmonella_phage(40.0%)	10	NA	NA
WP_000806401.1|2310551_2311055_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2311082_2311373_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2311720_2313550_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2313603_2314047_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2314424_2314952_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2314954_2316196_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2316788_2317118_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2317414_2318746_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2318774_2319143_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000624225.1|2319791_2320583_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP017621	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 chromosome, complete genome	4806964	4335067	4384931	4806964	tail,tRNA,plate	Burkholderia_phage(39.13%)	49	NA	NA
WP_001285165.1|4335067_4336015_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|4336030_4336540_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|4336671_4337796_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|4337767_4338241_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|4338267_4338810_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|4338814_4339387_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451193.1|4339391_4340210_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070571.1|4340206_4340464_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001285640.1|4340439_4340994_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000973243.1|4346842_4347280_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122767.1|4347436_4348366_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_001069372.1|4348634_4350236_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857881.1|4350267_4351572_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_001137266.1|4351673_4353425_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_010989091.1|4353388_4353796_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226434.1|4353806_4354631_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_000095958.1|4354934_4358618_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
WP_000956811.1|4358884_4360516_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421792.1|4360591_4361281_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001541281.1|4361352_4361454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096724.1|4361488_4362028_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_000954611.1|4362074_4362944_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|4362940_4363213_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_000881652.1|4363310_4364252_-	ketopantoate/pantoate/pantothenate transporter PanS	NA	NA	NA	NA	NA
WP_010989092.1|4365437_4365728_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4365976_4366432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4366428_4367034_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4367038_4368784_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4368786_4369419_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4369411_4370527_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4370517_4370877_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4371040_4372588_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4372587_4373517_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4373513_4373876_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4374202_4374925_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4374934_4375978_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4375965_4376175_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4376174_4377128_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4377127_4379482_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4379578_4379707_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4379666_4379984_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4380035_4380560_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4380559_4381987_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4381976_4382174_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4382170_4382626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4382785_4383100_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4383112_4383718_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4383720_4384008_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4384583_4384931_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP017620	Salmonella enterica subsp. enterica serovar Typhimurium strain 22792 plasmid unnamed1, complete sequence	93595	47181	56462	93595	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|47181_47598_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|47781_48117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|48173_48740_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|48771_49713_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|50127_51333_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_071953349.1|51332_52307_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
WP_000457541.1|52388_53663_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|53662_54085_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|54595_55066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|55058_55415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071953350.1|55796_56462_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	2.7e-28
