The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	4684	14728	4116555	tRNA	uncultured_Mediterranean_phage(33.33%)	9	NA	NA
WP_096043191.1|4684_5953_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	29.2	6.2e-05
WP_096043192.1|5954_6818_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.6	9.9e-39
WP_003483796.1|7047_7926_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003490675.1|8034_8553_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-30
WP_003483798.1|8677_10849_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.4	7.3e-14
WP_030036564.1|10890_11340_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_045897596.1|11393_11993_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	33.0	1.8e-23
WP_096043193.1|12031_13462_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_096043194.1|13480_14728_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	28.4	1.9e-30
>prophage 2
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	18486	48135	4116555		Clostridium_phage(77.78%)	35	NA	NA
WP_003483806.1|18486_18690_+	alpha/beta-type small acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	43.7	1.5e-09
WP_096043195.1|19165_19315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045896411.1|19617_20028_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_061321068.1|20220_20430_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045896409.1|20491_20704_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172819784.1|20796_21702_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	40.4	5.5e-40
WP_172819823.1|21691_22492_+	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	35.2	2.6e-33
WP_096043198.1|22548_22869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896408.1|22985_23507_+	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	2.1e-36
WP_045896406.1|24197_24482_+	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	61.2	1.0e-24
WP_096043199.1|24481_24847_+	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	56.2	7.7e-33
WP_096043200.1|24851_25199_+	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	57.8	9.5e-33
WP_045896404.1|25204_25624_+	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	74.1	1.2e-58
WP_072586302.1|25628_26516_+	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	73.8	4.5e-119
WP_045896402.1|26530_26947_+	hypothetical protein	NA	A0A0A7S0S0	Clostridium_phage	69.7	2.0e-45
WP_172819778.1|26906_27149_+	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	67.6	1.2e-21
WP_096043201.1|27331_28873_+	hypothetical protein	NA	A0A0A7RU22	Clostridium_phage	37.4	1.5e-29
WP_045895947.1|28894_29275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043202.1|29271_30801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045895945.1|30793_31156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043203.1|31174_31720_+	hypothetical protein	NA	A0A0A7RW86	Clostridium_phage	73.1	1.3e-73
WP_096043204.1|31723_32704_+	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	61.3	1.4e-110
WP_096043205.1|32727_33966_+	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	83.5	2.2e-201
WP_096043206.1|33978_35823_+	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	62.7	3.5e-134
WP_045896654.1|35828_36083_+	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	6.3e-34
WP_096043207.1|36094_37093_+	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.0	7.2e-142
WP_096043208.1|37104_38190_+	signal peptidase II	NA	A0A0A7RU66	Clostridium_phage	67.6	3.8e-136
WP_096043209.1|38325_39387_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	54.4	3.4e-65
WP_096043210.1|39541_40612_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	52.6	4.5e-65
WP_096043211.1|40767_41847_+	hypothetical protein	NA	I1TJW8	Clostridium_phage	53.5	1.6e-65
WP_045898193.1|42843_43098_+	hemolysin XhlA family protein	NA	A0A0A7RTX0	Clostridium_phage	48.1	1.8e-12
WP_045898196.1|43115_43310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045898192.1|43454_44225_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	63.3	6.7e-87
WP_045898191.1|44365_45490_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	29.8	1.5e-31
WP_096043212.1|45507_48135_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	33.4	7.9e-63
>prophage 3
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	189239	198708	4116555		Synechococcus_phage(42.86%)	7	NA	NA
WP_172819786.1|189239_191795_+	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	33.1	8.1e-12
WP_045896706.1|192471_192951_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	2.2e-27
WP_096043297.1|192950_193655_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	7.8e-42
WP_096043298.1|193745_195194_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	3.6e-57
WP_096043299.1|195254_196250_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	43.7	2.6e-67
WP_096043300.1|196377_196995_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	2.0e-25
WP_096043301.1|197208_198708_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.3	1.6e-68
>prophage 4
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	1319713	1382212	4116555	coat,tail,integrase,tRNA,bacteriocin,capsid,protease,portal,terminase,head	Clostridium_phage(39.58%)	82	1318674:1318694	1381139:1381159
1318674:1318694	attL	ATAAAAAAATTAATAGAAGAT	NA	NA	NA	NA
WP_096043921.1|1319713_1320772_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_096043922.1|1320849_1321728_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043031910.1|1321746_1322937_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003486026.1|1322990_1323152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042385544.1|1323237_1324428_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_072584266.1|1325018_1326671_-	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	62.0	4.6e-194
WP_072584267.1|1326694_1327090_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RU96	Clostridium_phage	64.5	1.5e-37
WP_045895993.1|1327310_1327535_+	helix-turn-helix domain-containing protein	NA	A0A0A7S118	Clostridium_phage	65.5	2.0e-12
WP_155119526.1|1327588_1327747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366070.1|1327766_1327931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584268.1|1327936_1328491_+	sigma-70 family RNA polymerase sigma factor	NA	M9Q2I8	Clostridium_phage	33.2	3.9e-20
WP_045895992.1|1328556_1328883_+	hypothetical protein	NA	A0A0A7S0N7	Clostridium_phage	41.8	1.1e-09
WP_080490381.1|1328883_1331139_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	39.3	2.6e-99
WP_072584269.1|1331159_1332086_+	recombinase RecT	NA	A0A1L2JY28	Aeribacillus_phage	47.3	7.1e-59
WP_072584270.1|1332087_1332804_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	48.5	2.9e-60
WP_155119527.1|1332805_1332967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052705773.1|1332977_1333760_+	DnaD domain protein	NA	A0A2P1JTY8	Anoxybacillus_phage	39.1	1.9e-36
WP_072587230.1|1333719_1334523_+	ATP-binding protein	NA	D2XQ17	Bacillus_virus	40.1	1.6e-43
WP_045895991.1|1334554_1334794_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	56.4	2.0e-18
WP_045895990.1|1334793_1335273_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	40.8	4.2e-15
WP_072584271.1|1335300_1335477_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	54.7	1.2e-12
WP_072584272.1|1335588_1335750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584273.1|1335746_1336169_+	DUF1064 domain-containing protein	NA	A0A0A7RTV9	Clostridium_phage	69.3	5.5e-51
WP_072584274.1|1336156_1336786_+	hypothetical protein	NA	A0A0A7RW43	Clostridium_phage	72.1	1.8e-82
WP_072584275.1|1336830_1337739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045895994.1|1337747_1338080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045895987.1|1338116_1338305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405269.1|1338962_1340786_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	8.4e-88
WP_172819798.1|1341038_1341233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896277.1|1341315_1342311_+|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	26.1	3.7e-05
WP_072584276.1|1342343_1343171_+	DNA adenine methylase	NA	A7YGL3	Campylobacter_phage	35.0	2.8e-30
WP_045896273.1|1343213_1343657_+	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	35.2	3.0e-15
WP_072584277.1|1343649_1343988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119529.1|1344080_1344248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896270.1|1344347_1344761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584278.1|1345101_1345449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896268.1|1345521_1345731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896266.1|1345798_1346044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896264.1|1346101_1346404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584279.1|1346445_1346823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119530.1|1346991_1347348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896258.1|1347349_1347775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584281.1|1347774_1348248_+	hypothetical protein	NA	A0A0A7RUV1	Clostridium_phage	37.1	7.4e-12
WP_072587231.1|1348518_1348983_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	63.0	1.5e-49
WP_072584282.1|1348979_1350680_+|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	56.6	2.5e-187
WP_072584283.1|1350695_1351889_+|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	37.8	3.5e-66
WP_072584284.1|1351869_1352538_+|head,protease	HK97 family phage prohead protease	head,protease	E2ELI4	Clostridium_phage	46.5	8.0e-36
WP_072584285.1|1352548_1353700_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	57.8	4.3e-122
WP_155119531.1|1353743_1353875_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045896253.1|1353889_1354216_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	50.0	8.4e-15
WP_045896251.1|1354196_1354523_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_072584286.1|1354515_1354899_+	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	50.0	2.7e-28
WP_072584287.1|1354895_1355237_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	42.6	2.5e-17
WP_045896249.1|1355239_1355821_+|tail	tail protein	tail	E2ELJ1	Clostridium_phage	58.5	9.9e-59
WP_072584288.1|1355856_1356183_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	34.6	4.2e-06
WP_072584289.1|1356438_1361745_+|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	38.8	3.9e-77
WP_080490383.1|1361761_1362628_+|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	69.6	4.8e-110
WP_172819830.1|1362628_1363699_+	hypothetical protein	NA	E2ELJ7	Clostridium_phage	58.8	3.7e-120
WP_072584291.1|1363698_1364472_+	hypothetical protein	NA	E2ELJ8	Clostridium_phage	60.2	8.8e-79
WP_072584292.1|1365496_1365796_+	hypothetical protein	NA	J9QEB9	Clostridium_phage	47.6	4.4e-10
WP_072584293.1|1365811_1366027_+	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	67.4	2.7e-09
WP_072584294.1|1366202_1366499_+	hypothetical protein	NA	Q332A4	Clostridium_botulinum_C_phage	53.5	9.6e-18
WP_072584295.1|1366498_1367128_+	hypothetical protein	NA	Q332A5	Clostridium_botulinum_C_phage	65.1	2.5e-71
WP_072584296.1|1367180_1367384_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_021106364.1|1367392_1367587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584297.1|1367629_1368400_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	64.8	2.1e-88
WP_045896240.1|1368696_1368897_+	hypothetical protein	NA	A0A2H4J069	uncultured_Caudovirales_phage	77.4	2.2e-13
WP_061295793.1|1368893_1369139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061295790.1|1369200_1369581_+	recombinase family protein	NA	A0A2H4J078	uncultured_Caudovirales_phage	55.7	1.2e-28
WP_061295788.1|1369869_1370070_+	helix-turn-helix domain-containing protein	NA	A0A2H4J765	uncultured_Caudovirales_phage	50.0	5.0e-10
WP_167366071.1|1370194_1370353_+	hypothetical protein	NA	A0A2H4J4S7	uncultured_Caudovirales_phage	73.1	3.4e-14
WP_052705787.1|1370481_1371033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119532.1|1371166_1371316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584299.1|1371312_1372539_+	hypothetical protein	NA	Q331T3	Clostridium_botulinum_C_phage	25.3	2.0e-21
WP_072584300.1|1372529_1373126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072584301.1|1373349_1373859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896231.1|1373906_1374185_-	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	88.0	2.3e-37
WP_045896228.1|1374256_1374493_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUG5	Clostridium_phage	71.8	4.2e-24
WP_096043923.1|1374872_1376246_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_096043924.1|1376323_1379125_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.9	1.0e-52
WP_096043925.1|1379266_1381261_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.2	3.6e-68
1381139:1381159	attR	ATAAAAAAATTAATAGAAGAT	NA	NA	NA	NA
WP_096043926.1|1381276_1382212_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	1748308	1754924	4116555	integrase	Clostridium_phage(50.0%)	9	1749335:1749351	1754970:1754986
WP_072584550.1|1748308_1748707_-	ATP-dependent helicase	NA	A0A1V0SAV1	Catovirus	42.3	3.3e-05
WP_072584551.1|1748977_1749565_-	DUF4352 domain-containing protein	NA	A0A0A7RUM7	Clostridium_phage	33.0	5.0e-10
1749335:1749351	attL	ATTTTCTTTAGCTTCTA	NA	NA	NA	NA
WP_045896982.1|1749899_1750658_-	N-acetylmuramoyl-L-alanine amidase	NA	I1TJX3	Clostridium_phage	55.7	6.4e-50
WP_003486633.1|1750657_1750831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486634.1|1750832_1751057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003486635.1|1751339_1751534_-	hypothetical protein	NA	A0A0A7RU02	Clostridium_phage	96.9	3.9e-28
WP_030034659.1|1751809_1751965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096044139.1|1751952_1752858_-|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	27.7	8.9e-06
WP_085333276.1|1752911_1754924_-	ATP-dependent helicase	NA	S5M596	Bacillus_phage	30.5	3.4e-66
1754970:1754986	attR	TAGAAGCTAAAGAAAAT	NA	NA	NA	NA
>prophage 6
NZ_CP013242	Clostridium botulinum strain CDC_67071 chromosome, complete genome	4116555	3109559	3117521	4116555		Bacillus_phage(66.67%)	6	NA	NA
WP_096044880.1|3109559_3110882_+	FAD-dependent oxidoreductase	NA	S4VRT3	Pandoravirus	28.7	3.5e-27
WP_096045392.1|3111286_3112327_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	1.5e-20
WP_045897047.1|3112364_3113060_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	9.4e-40
WP_096044881.1|3113133_3115095_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.4	3.9e-06
WP_172819844.1|3115453_3116707_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.6	1.9e-38
WP_096044883.1|3116843_3117521_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	2.2e-33
>prophage 1
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	0	15923	235650		Anoxybacillus_phage(33.33%)	14	NA	NA
WP_172819771.1|1594_1732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043121.1|1783_2719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043122.1|3263_3638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172819772.1|3816_3993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043123.1|4010_4556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043124.1|4732_5425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043125.1|5500_6676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043126.1|6668_8951_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_072587034.1|9353_9656_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_072587035.1|9828_10449_+	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	56.0	4.0e-42
WP_045897719.1|10865_11177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043127.1|11173_13267_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.3	7.8e-37
WP_096043128.1|13432_14167_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_096043129.1|14609_15923_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	65.2	1.2e-160
>prophage 2
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	21276	28010	235650		Aeromonas_virus(33.33%)	11	NA	NA
WP_172819773.1|21276_21717_+	hypothetical protein	NA	Q76YT6	Aeromonas_virus	56.1	7.4e-14
WP_155119566.1|21756_21930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291524.1|21961_22321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003405269.1|22923_24747_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	8.4e-88
WP_155119570.1|24774_25017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167366120.1|25061_25217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587058.1|25276_25924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045898841.1|25948_26161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587059.1|26293_26494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040109960.1|26468_27068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043133.1|27119_28010_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0E3D9C3	Bacillus_phage	33.2	4.3e-13
>prophage 3
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	31871	41844	235650	transposase	Bacillus_virus(20.0%)	8	NA	NA
WP_096043134.1|31871_32987_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D2XQ03	Bacillus_virus	65.9	8.1e-142
WP_096043135.1|33363_35706_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	29.0	3.0e-37
WP_072587066.1|35850_36225_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_096043136.1|36243_36666_+	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_030032212.1|36796_37174_+	hypothetical protein	NA	E7DN80	Pneumococcus_phage	47.1	3.5e-12
WP_096043137.1|37190_39125_+	ATPase	NA	A0A0C5AFF4	Paenibacillus_phage	25.0	7.2e-13
WP_096043138.1|39275_39854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043139.1|39900_41844_+	PcfJ domain-containing protein	NA	A0A2H4J308	uncultured_Caudovirales_phage	44.2	1.3e-17
>prophage 4
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	45136	51241	235650		Bacillus_virus(50.0%)	4	NA	NA
WP_012300921.1|45136_46999_+	ATP-binding protein	NA	G3MBM1	Bacillus_virus	26.0	2.0e-15
WP_096043141.1|47216_47618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043142.1|47690_49454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043187.1|49489_51241_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	48.2	6.5e-29
>prophage 5
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	58567	58834	235650		Clostridium_phage(100.0%)	1	NA	NA
WP_030032175.1|58567_58834_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	42.7	3.0e-10
>prophage 6
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	62914	63967	235650		Bacillus_virus(100.0%)	1	NA	NA
WP_012720244.1|62914_63967_+	ParM/StbA family protein	NA	G3MAP7	Bacillus_virus	23.9	8.7e-21
>prophage 7
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	74226	76363	235650		Bacillus_virus(50.0%)	2	NA	NA
WP_072587082.1|74226_75045_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	30.4	2.5e-23
WP_080490442.1|75034_76363_+	replicative DNA helicase	NA	I6S783	Marinomonas_phage	35.9	2.1e-59
>prophage 8
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	88881	100348	235650	protease	Bacillus_phage(33.33%)	12	NA	NA
WP_072587086.1|88881_90606_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	40.2	2.1e-88
WP_072587087.1|90964_91771_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_072587088.1|92130_92694_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	45.3	5.0e-23
WP_021107212.1|92961_93825_+	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	30.4	2.1e-33
WP_096043149.1|94061_95285_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	34.5	6.1e-26
WP_072587090.1|95456_95912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896493.1|96503_96728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052705794.1|96795_97509_+	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	36.9	1.2e-26
WP_045896492.1|97540_97897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896491.1|97929_98334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587091.1|98415_98805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045896490.1|99322_100348_+	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	28.7	9.7e-33
>prophage 9
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	107623	108292	235650		Clostridioides_phage(100.0%)	1	NA	NA
WP_045897924.1|107623_108292_+	serine/threonine protein phosphatase	NA	A0A2R2ZH50	Clostridioides_phage	54.1	1.7e-62
>prophage 10
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	117689	119648	235650	transposase	Paenibacillus_phage(66.67%)	3	NA	NA
WP_096043152.1|117689_118568_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	60.3	1.1e-74
WP_096043153.1|118564_119242_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	48.4	2.2e-49
WP_045898418.1|119402_119648_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	58.7	7.9e-18
>prophage 11
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	125368	146504	235650		Clostridium_botulinum_D_phage(27.27%)	21	NA	NA
WP_072587107.1|125368_127249_-	botulinum neurotoxin hemagglutinin HA70 subunit	NA	Q786X9	Clostridium_botulinum_D_phage	67.5	6.6e-237
WP_003404194.1|127262_127703_-	hemagglutinin component HA17	NA	Q786Y1	Clostridium_botulinum_D_phage	63.7	2.3e-47
WP_072587108.1|127765_128650_-	ricin-type beta-trefoil lectin domain protein	NA	Q38196	Clostridium_botulinum_phage	34.6	3.1e-35
WP_003404193.1|128875_129412_+	botulinum neurotoxin transcription-activating sigma factor BotR	NA	Q9ZWV5	Clostridium_botulinum_D_phage	52.8	5.6e-40
WP_072587328.1|129573_133167_+	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	69.2	0.0e+00
WP_072587109.1|133192_137068_+	botulinum neurotoxin type B	NA	Q332E0	Clostridium_botulinum_C_phage	33.4	5.2e-188
WP_003362424.1|138752_138965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404190.1|139000_139168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045899006.1|139184_139370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404186.1|139430_139787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072587110.1|139858_140317_+	SAM-dependent methyltransferase	NA	A0A0E3Y6D6	Fusobacterium_phage	71.3	6.2e-64
WP_012291535.1|140347_141112_+	site-specific DNA-methyltransferase	NA	A0A088C4U4	Shewanella_sp._phage	50.4	8.5e-58
WP_003404181.1|141169_141790_+	DUF5052 family protein	NA	A0A2P0ZKZ7	Lactobacillus_phage	44.5	5.3e-42
WP_003404179.1|141800_141977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045899007.1|142004_142295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586973.1|142359_142545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586975.1|142881_143790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404170.1|143938_144310_+	hypothetical protein	NA	A8ASN9	Listeria_phage	34.4	8.9e-13
WP_003404167.1|144395_145211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404165.1|145480_145645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404163.1|145649_146504_+	DNA cytosine methyltransferase	NA	A0A142F1A1	Bacillus_phage	27.9	1.1e-24
>prophage 12
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	155199	158057	235650	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_072586985.1|155199_155793_+	AAA family ATPase	NA	A0A0E3X9J6	Bacillus_phage	34.1	4.8e-16
WP_072586986.1|156803_158057_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	36.2	1.3e-44
>prophage 13
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	161248	171413	235650	transposase	Bacillus_phage(20.0%)	14	NA	NA
WP_045896620.1|161248_161794_+	DUF1273 family protein	NA	A0A1P8CWY2	Bacillus_phage	45.1	4.3e-32
WP_072586990.1|161981_162593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012300928.1|162724_163285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586991.1|163303_164287_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_167366114.1|164336_164480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586992.1|164787_166203_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.9	2.6e-52
WP_045896618.1|166330_166921_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_072586993.1|167052_167508_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_172819776.1|167597_167738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072586994.1|167759_168152_+	LemA family protein	NA	NA	NA	NA	NA
WP_045896596.1|168177_168363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072586995.1|168443_169472_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	51.4	1.8e-26
WP_003362366.1|169630_170773_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0IJS6	Lactobacillus_phage	45.3	7.1e-85
WP_045896601.1|170966_171413_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	52.3	2.3e-31
>prophage 14
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	185091	186036	235650		Moumouvirus(100.0%)	1	NA	NA
WP_072587004.1|185091_186036_+	SPFH/Band 7/PHB domain protein	NA	M1PGF9	Moumouvirus	34.1	3.2e-22
>prophage 15
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	190754	192227	235650		Salmonella_phage(100.0%)	1	NA	NA
WP_072587009.1|190754_192227_+	phosphoadenosine phosphosulfate reductase family protein	NA	S4TTT6	Salmonella_phage	25.8	2.6e-07
>prophage 16
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	195297	200851	235650		Deep-sea_thermophilic_phage(33.33%)	4	NA	NA
WP_096043163.1|195297_197700_-	ATP-binding protein	NA	E5DV71	Deep-sea_thermophilic_phage	29.5	2.6e-76
WP_072587013.1|197696_198098_-	bacitracin ABC transporter ATP-binding protein	NA	A0A218KCI4	Bacillus_phage	41.6	3.1e-11
WP_096043164.1|198942_199272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043165.1|199537_200851_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	65.2	7.7e-160
>prophage 17
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	203907	205374	235650		Yersinia_phage(100.0%)	1	NA	NA
WP_096043169.1|203907_205374_+	hypothetical protein	NA	A0A2C9CXG6	Yersinia_phage	37.1	3.6e-41
>prophage 18
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	218466	227614	235650	transposase	Staphylococcus_phage(25.0%)	8	NA	NA
WP_003362755.1|218466_219117_-	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	42.3	3.0e-11
WP_096043172.1|219272_219962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043173.1|220061_221159_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	75.8	2.6e-145
WP_172819777.1|221624_221909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043175.1|222052_222742_+	Fic family protein	NA	NA	NA	NA	NA
WP_096043176.1|222833_223442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043177.1|223766_224168_+	hypothetical protein	NA	J9PV82	Bacillus_phage	44.5	5.8e-26
WP_003405269.1|225790_227614_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	8.4e-88
>prophage 19
NZ_CP013241	Clostridium botulinum strain CDC_67071 chromosome pNPD7, complete genome	235650	231441	232890	235650	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_096043183.1|231441_232890_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A142F1Q5	Bacillus_phage	36.7	3.4e-39
