The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	201313	274157	4798436	plate,tRNA,transposase,protease	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_001295561.1|201313_202666_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|202695_205128_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|205249_205735_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|205738_206764_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|206868_207324_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|207327_208116_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|208115_209264_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|209260_209857_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_071940724.1|209893_213376_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.7e-209
WP_000055741.1|213388_214348_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|214446_216588_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|216644_217034_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|217098_218397_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|218445_218706_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|218692_218893_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|219058_219604_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|219600_220023_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|220036_220747_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|220946_221771_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|221824_223543_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|223654_224362_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|224358_224763_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|224880_225696_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|225735_226389_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|226381_227413_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|227600_228176_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|233936_234740_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|234736_235651_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|235891_236692_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|237366_238725_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|238796_239552_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|239585_240308_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|240304_240772_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|240836_241568_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|242104_242890_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|243026_243506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|243515_244430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|244473_244956_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|244979_246332_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122545204.1|246342_249777_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|249885_251298_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|251302_252046_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|252042_254808_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|254816_255578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|255582_256914_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|256916_257441_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|257437_258718_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|258742_259825_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|259788_261639_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|261642_262056_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|262062_263538_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|263588_263813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|263847_264348_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|265042_265561_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|265770_267912_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_000508724.1|267987_272220_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|272197_272590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071940725.1|273020_274157_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	281337	338880	4798436	transposase,integrase	Enterobacteria_phage(45.45%)	45	275762:275777	307962:307977
275762:275777	attL	GCGGCTTCATCTTTAT	NA	NA	NA	NA
WP_000343760.1|281337_282558_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_000056849.1|282814_283564_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|283739_284237_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|284460_286200_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|286144_286930_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|287000_288056_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|288107_288401_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|288403_288802_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|288811_289264_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|290361_291819_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|292079_292538_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|292629_293874_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|293931_294333_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749867.1|294371_295427_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_001285288.1|295714_296818_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|296829_298083_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000772656.1|298436_299645_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
WP_001087767.1|299886_301095_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_000132880.1|301087_302794_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000920172.1|302771_303842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333700.1|306466_306724_-	YjhX family toxin	NA	NA	NA	NA	NA
WP_001081495.1|307098_307842_-	epimerase	NA	NA	NA	NA	NA
WP_000558519.1|307852_308143_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
307962:307977	attR	GCGGCTTCATCTTTAT	NA	NA	NA	NA
WP_000774153.1|308191_309067_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000155278.1|309095_310118_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000197460.1|310144_311143_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911138.1|311142_312189_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001178466.1|312182_313736_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	22.2	2.9e-12
WP_024176379.1|313985_314942_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000057773.1|315041_316634_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000597528.1|316646_316997_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_139371347.1|319158_320371_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001013303.1|323116_323542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021534030.1|323538_323922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|324693_325906_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_072146520.1|326437_326587_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001335904.1|327659_328451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021517769.1|328835_329042_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_021527306.1|329135_329738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336040.1|332144_333293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000375614.1|334154_335273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000569129.1|335363_335711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000422741.1|336463_336889_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|336885_337236_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|337266_338880_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
>prophage 3
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	1237311	1328804	4798436	tRNA,transposase,holin,tail,protease,terminase,integrase,portal,head,capsid	Escherichia_phage(29.55%)	112	1254151:1254166	1309952:1309967
WP_000074971.1|1237311_1238430_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|1238398_1238668_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|1238729_1241171_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|1241264_1241456_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1241452_1241641_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171946.1|1242209_1242428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042046576.1|1242499_1242799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|1243152_1243491_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|1243882_1244125_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|1244108_1244534_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|1244605_1245676_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|1245716_1246139_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|1246196_1246553_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1246646_1246829_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|1246821_1246998_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_000813254.1|1247920_1248076_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_032155008.1|1248243_1248522_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|1248523_1249582_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|1249582_1249963_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|1249959_1250781_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|1251175_1251262_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|1251750_1251963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170386723.1|1252156_1253128_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000874243.1|1253701_1253890_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|1253886_1254048_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
1254151:1254166	attL	GGTGGCTTTTTTATTG	NA	NA	NA	NA
WP_000372595.1|1254197_1254413_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_071940739.1|1254417_1254768_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	5.4e-36
WP_000992097.1|1254831_1255365_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|1255581_1255764_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|1255854_1256148_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|1256673_1257024_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|1257171_1257654_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|1257653_1259411_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000811487.1|1259407_1259569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923134.1|1259558_1260785_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000999828.1|1260777_1261377_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|1261391_1262609_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|1262685_1263003_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|1263011_1263350_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|1263346_1263796_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|1263792_1264137_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|1264197_1264902_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_000164661.1|1264916_1265288_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978926.1|1265311_1265590_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.7	5.3e-42
WP_000224003.1|1265636_1268864_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|1268841_1269198_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|1269197_1269896_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|1269901_1270645_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|1270581_1271190_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|1271250_1274730_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|1274797_1275397_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_139371347.1|1278787_1280001_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_042047081.1|1280002_1280533_+|tail	tail fiber domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_139371347.1|1280755_1281968_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000241001.1|1282083_1282752_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|1283306_1284170_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1284153_1285290_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1285539_1286766_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1286814_1287936_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1288011_1289472_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1289471_1290143_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1290311_1291682_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1291685_1292327_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1292362_1293469_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1293522_1293984_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248681.1|1293993_1294647_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444493.1|1294818_1296069_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_042345983.1|1296181_1297324_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	81.6	5.9e-172
WP_000089156.1|1297313_1297550_-	excisionase	NA	NA	NA	NA	NA
WP_042345979.1|1297613_1297805_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	87.3	1.2e-26
WP_042345976.1|1297801_1298587_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	1.3e-61
WP_023301986.1|1298586_1298886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040219347.1|1299249_1299945_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	72.0	1.6e-87
WP_001191665.1|1300042_1300285_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004213338.1|1300319_1300781_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_023317571.1|1301018_1301231_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_042345967.1|1301187_1302102_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_042345965.1|1302098_1302908_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	7.7e-110
WP_000779146.1|1302917_1303295_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_042345962.1|1303307_1304288_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
WP_042345959.1|1304301_1304880_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_057077933.1|1304955_1305552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|1305681_1306077_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1306063_1306345_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_042346306.1|1306344_1306974_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.9	1.0e-85
WP_042346304.1|1306975_1307284_+	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	51.5	6.7e-14
WP_042346301.1|1307280_1307556_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	3.7e-24
WP_042346295.1|1307779_1308715_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_042346292.1|1308716_1309346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182580.1|1309975_1310266_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
1309952:1309967	attR	GGTGGCTTTTTTATTG	NA	NA	NA	NA
WP_042346284.1|1310278_1310488_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	82.6	5.3e-23
WP_042346281.1|1310609_1311044_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	1.1e-73
WP_042346278.1|1311053_1312586_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	5.1e-296
WP_042346275.1|1312588_1313866_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.2e-245
WP_004216821.1|1313871_1314552_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_042346268.1|1314563_1315727_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.0	1.5e-210
WP_149025458.1|1315764_1316007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042346263.1|1315954_1316281_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	97.2	3.7e-55
WP_042346260.1|1316341_1316554_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_023317183.1|1316555_1316888_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	3.4e-56
WP_042346256.1|1316880_1317420_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	2.2e-92
WP_049162797.1|1317416_1317782_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	94.2	9.3e-63
WP_017880225.1|1317838_1318330_+|tail	major tail subunit	tail	A0A286S1Q8	Klebsiella_phage	99.4	2.3e-88
WP_042346250.1|1318373_1318757_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	92.3	4.0e-56
WP_032432338.1|1318759_1319023_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	92.0	3.6e-40
WP_042346245.1|1319086_1319479_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_042346242.1|1319548_1321984_+|tail	phage tail length tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.4	0.0e+00
WP_042346239.1|1321983_1322463_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.5	3.3e-92
WP_042346237.1|1322449_1322932_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	2.8e-83
WP_042346234.1|1322942_1323323_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	6.2e-70
WP_057077865.1|1323319_1326388_+	kinase	NA	A0A286S259	Klebsiella_phage	96.0	0.0e+00
WP_057077864.1|1326464_1328804_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	76.3	4.0e-50
>prophage 4
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	1332034	1338474	4798436		Enterobacteria_phage(33.33%)	10	NA	NA
WP_022066379.1|1332034_1332604_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	98.3	3.9e-92
WP_004179627.1|1333168_1333588_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_042346540.1|1333589_1334855_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	2.1e-207
WP_042346543.1|1335041_1335485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539894.1|1335836_1335989_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_001295666.1|1336091_1336415_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_120795380.1|1336674_1336719_-	protein YmgK	NA	NA	NA	NA	NA
WP_032082692.1|1336954_1337065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1337117_1337522_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1337742_1338474_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 5
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	2597083	2603456	4798436	transposase,integrase	Enterobacteria_phage(33.33%)	8	2598144:2598166	2610992:2611014
WP_000368131.1|2597083_2598016_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2598144:2598166	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_023149819.1|2598330_2599617_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	3.2e-65
WP_001535476.1|2599609_2600365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|2600521_2600713_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_001461315.1|2600761_2600953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|2601039_2601465_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2601461_2601812_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|2601842_2603456_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
2610992:2611014	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 6
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	2857313	2974925	4798436	plate,tRNA,transposase,head,tail,terminase,integrase,portal,capsid	Erwinia_phage(20.75%)	112	2854252:2854267	2937402:2937417
2854252:2854267	attL	ATTTTTATCCCGGCAA	NA	NA	NA	NA
WP_001521090.1|2857313_2858351_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2858557_2858977_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|2859045_2859744_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_071940767.1|2859775_2862436_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2862549_2863905_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001696047.1|2863950_2864274_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2864270_2865569_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|2865877_2867226_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_024176393.1|2872806_2875380_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.2e-127
WP_001520329.1|2875509_2876241_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|2876237_2877218_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197689.1|2877352_2878090_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2878360_2878702_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2878805_2878853_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_020233815.1|2878951_2880112_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225220.1|2880154_2881276_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2881286_2882357_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001314943.1|2882566_2882932_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001520332.1|2883081_2883600_+	YfiR family protein	NA	NA	NA	NA	NA
WP_021523227.1|2883589_2884816_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001520334.1|2884831_2885314_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2885390_2885738_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264781.1|2885779_2886547_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2886577_2887126_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2887144_2887393_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2887641_2889003_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2889169_2889961_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2889981_2891268_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2891322_2891916_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001520335.1|2892038_2892917_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001520336.1|2893002_2894664_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2894812_2895154_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2895215_2895506_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|2895495_2895972_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001520337.1|2896103_2896586_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
WP_001120794.1|2901962_2902082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019842420.1|2902235_2902379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521105.1|2902832_2904287_-	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_052935640.1|2905333_2906797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052935639.1|2906807_2907812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
WP_052935638.1|2907811_2908387_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
WP_001630878.1|2908519_2908783_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_052935637.1|2908813_2909323_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
WP_052935636.1|2909330_2909558_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
WP_052935635.1|2909544_2909745_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
WP_052935634.1|2909814_2910042_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
WP_052935633.1|2910041_2910269_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
WP_071940768.1|2910265_2910574_+	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
WP_052935632.1|2910587_2912828_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.5	0.0e+00
WP_071940803.1|2912971_2913154_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
WP_071940769.1|2913442_2914660_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	29.6	4.4e-32
WP_052935790.1|2915126_2916164_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.0	5.9e-163
WP_052935789.1|2916163_2917933_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	80.5	1.9e-286
WP_052935788.1|2918097_2918961_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
WP_052935787.1|2918982_2920143_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	2.5e-130
WP_052935786.1|2920146_2920905_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.3	1.3e-79
WP_000177981.1|2921002_2921503_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_001100637.1|2921502_2921706_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|2921696_2921918_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_000534554.1|2921901_2922411_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_001298859.1|2922715_2924257_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2924271_2925018_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_052935784.1|2925515_2925983_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.7e-56
WP_052935783.1|2925975_2926425_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.7	8.5e-50
WP_071940771.1|2926430_2927516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052935607.1|2927631_2928273_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.5e-95
WP_052935606.1|2928269_2928617_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	71.3	4.3e-41
WP_052935605.1|2928621_2929530_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.0e-134
WP_052935604.1|2929522_2930134_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.8e-95
WP_052935603.1|2931302_2931716_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	4.0e-22
WP_052935602.1|2931847_2933035_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.5	2.6e-183
WP_052935601.1|2933047_2933566_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_023223220.1|2933628_2933910_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|2933942_2934062_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_052935600.1|2934054_2936484_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	67.8	7.6e-270
WP_052935599.1|2936495_2936960_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.7e-61
WP_052935598.1|2936962_2938156_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	1.3e-166
2937402:2937417	attR	TTGCCGGGATAAAAAT	NA	NA	NA	NA
WP_023223216.1|2938195_2938414_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_001521106.1|2939206_2941459_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001521107.1|2941795_2942773_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_020233013.1|2942792_2944061_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772878.1|2944083_2945532_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000097652.1|2945545_2946826_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_001295173.1|2947063_2948464_+	GABA permease	NA	NA	NA	NA	NA
WP_000156814.1|2948484_2949147_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522417.1|2949147_2949597_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000508177.1|2949680_2949839_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137280.1|2950021_2950321_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229454.1|2950330_2950855_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115383.1|2950901_2951306_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492658.1|2951972_2952422_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|2952458_2952803_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001316582.1|2952954_2953284_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223227.1|2953531_2953777_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001521113.1|2953773_2954175_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_020233016.1|2954156_2956301_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.2e-196
WP_001521117.1|2956310_2957270_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985494.1|2957626_2958829_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774965.1|2958821_2959886_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216531.1|2959943_2960936_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165699.1|2961388_2962573_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|2962696_2963434_+	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000119745.1|2963423_2963759_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|2963849_2964380_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_020233875.1|2964506_2965679_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001295176.1|2965695_2967234_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130211.1|2967297_2967813_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001521120.1|2967962_2969519_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287454.1|2969591_2970020_-	DedA family protein	NA	NA	NA	NA	NA
WP_001521122.1|2970016_2970583_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|2971874_2972060_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|2972294_2974925_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 7
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	3011226	3018366	4798436		Escherichia_phage(83.33%)	6	NA	NA
WP_071940772.1|3011226_3013788_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	4.6e-31
WP_001141345.1|3013893_3014550_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|3014600_3015368_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|3015563_3016472_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|3016468_3017731_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3017727_3018366_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	4000822	4011412	4798436	integrase	Enterobacteria_phage(88.89%)	12	4000640:4000662	4011889:4011911
4000640:4000662	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218984.1|4000822_4001986_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
WP_000220867.1|4001995_4003867_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
WP_000611230.1|4003863_4004286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071940786.1|4004596_4005169_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	5.5e-94
WP_000638635.1|4005242_4005743_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283007.1|4005739_4006474_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|4007026_4007293_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_071940787.1|4007289_4007880_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	1.2e-59
WP_001244665.1|4007872_4008160_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459301.1|4008152_4008608_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4008743_4009064_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_071940788.1|4009078_4011412_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
4011889:4011911	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP018115	Escherichia coli strain MRSN346638 chromosome, complete genome	4798436	4644626	4699359	4798436	tRNA,transposase,holin,protease,integrase	Enterobacteria_phage(26.32%)	49	4653550:4653565	4681453:4681468
WP_001162184.1|4644626_4645979_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|4646033_4646420_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106227.1|4646464_4646929_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.1	1.2e-51
WP_000187791.1|4647088_4649227_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001333756.1|4649620_4651276_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|4651325_4652747_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4652865_4653813_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
4653550:4653565	attL	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001387276.1|4653997_4654051_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|4654191_4656888_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_024176429.1|4657093_4657480_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4657552_4658014_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013049.1|4658026_4658962_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.3e-52
WP_001296693.1|4658965_4659100_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230272.1|4659380_4659776_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500681.1|4659906_4660620_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256665.1|4660690_4661284_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333754.1|4661428_4661881_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000012906.1|4663821_4664826_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002954.1|4664987_4665404_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001333751.1|4665449_4665953_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001014711.1|4666145_4667333_+	DUF898 family protein	NA	NA	NA	NA	NA
WP_000416404.1|4667384_4670240_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4670239_4670683_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4671036_4672548_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4672814_4673915_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4673914_4674997_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294554.1|4675157_4676660_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	1.4e-83
WP_001299662.1|4676787_4677807_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000772653.1|4678251_4679514_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	35.6	2.4e-65
WP_001066505.1|4679543_4680182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000455467.1|4680559_4680790_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000235891.1|4680886_4681072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118612.1|4681259_4681436_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001246998.1|4681428_4681788_+	hypothetical protein	NA	NA	NA	NA	NA
4681453:4681468	attR	GAACGCTGGCAGCATG	NA	NA	NA	NA
WP_001027153.1|4681819_4682104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075579.1|4682100_4682484_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000155331.1|4682480_4685153_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	4.1e-59
WP_001066218.1|4685553_4686297_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126947.1|4686293_4686845_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185344.1|4686850_4687123_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_000993028.1|4687768_4688737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422112.1|4688738_4689671_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.8e-25
WP_139371347.1|4691269_4692483_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_049828170.1|4692561_4692951_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
WP_000145481.1|4693001_4693220_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087920712.1|4693286_4694448_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
WP_000625669.1|4694728_4696006_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|4696068_4698066_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|4698219_4699359_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
>prophage 1
NZ_CP018116	Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence	119254	5003	43042	119254	integrase,transposase	Escherichia_phage(33.33%)	36	11666:11681	48267:48282
WP_001067855.1|5003_5708_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492330.1|6418_7279_+	class A broad-spectrum beta-lactamase TEM-57	NA	Q1MVP3	Enterobacteria_phage	99.7	3.9e-160
WP_001214976.1|8454_8862_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|8999_9884_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|9915_11115_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|11220_11871_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
11666:11681	attL	AGGCCGGCGACAGCGA	NA	NA	NA	NA
WP_000844627.1|11902_12145_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|12202_15169_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|15172_15733_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000993264.1|15908_16109_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|16174_16879_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_149025460.1|16769_17054_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_071940805.1|17086_17389_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_071940806.1|17759_17990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325825.1|18118_19024_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(42)	NA	NA	NA	NA	NA
WP_001120888.1|19473_20967_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_071940807.1|20997_21882_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_023300759.1|22098_23313_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|23340_23646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004202492.1|25173_25515_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
WP_001067855.1|26696_27401_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001175594.1|27934_28258_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044502555.1|28362_29400_+	permease	NA	NA	NA	NA	NA
WP_000521603.1|29692_30310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818556.1|30501_32058_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000194575.1|32320_32911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|32910_33168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350638.1|33521_35660_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|35821_36238_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|36234_36465_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000111771.1|36760_37051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|37040_37940_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|37989_40215_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|40216_41305_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000465036.1|41847_42261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164198.1|42262_43042_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
48267:48282	attR	TCGCTGTCGCCGGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP018118	Escherichia coli strain MRSN346638 plasmid pMRSN346638_64.5, complete sequence	64467	7521	13976	64467	transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_071940821.1|7521_8730_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	2.0e-207
WP_000545938.1|9246_9525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071940830.1|9786_11013_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	95.1	2.8e-188
WP_053001740.1|11071_11476_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	54.4	5.0e-33
WP_000681608.1|11761_12028_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.4	8.9e-15
WP_001481829.1|12134_12317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833470.1|12874_13057_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000466318.1|13081_13519_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	34.7	9.5e-14
WP_000206701.1|13649_13976_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	90.3	2.4e-25
>prophage 1
NZ_CP018117	Escherichia coli strain MRSN346638 plasmid pMRSN346638_67.9, complete sequence	67946	50697	61313	67946	transposase	Escherichia_phage(71.43%)	10	NA	NA
WP_077253135.1|50697_51714_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.7e-186
WP_001513659.1|51941_52259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989268.1|52533_53610_-|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_001513660.1|53919_54279_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|54306_54486_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|54490_54871_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|54870_55092_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_047633096.1|55274_56831_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
WP_001293038.1|56827_58075_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_071940817.1|58196_61313_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	4.9e-27
