The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	161034	214990	6041408	transposase	Corynebacterium_phage(50.0%)	44	NA	NA
WP_071942619.1|161034_161343_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_096311544.1|161299_162560_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	60.1	3.0e-84
WP_071942621.1|162945_163911_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_071942623.1|163907_164693_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071942625.1|164689_165805_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071942627.1|165804_166305_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_071942629.1|166387_167032_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071942631.1|167059_167878_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_071942633.1|167877_169005_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071942635.1|169001_170171_+	sulfotransferase	NA	NA	NA	NA	NA
WP_071942637.1|170178_171012_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_071942639.1|170998_172207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942641.1|172216_172933_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_071949669.1|173006_174536_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.1	1.1e-19
WP_071942643.1|177250_177583_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_083542560.1|177607_180562_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_071942645.1|180551_181595_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_096312014.1|181591_181912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083542561.1|181961_182432_-	ferredoxin	NA	NA	NA	NA	NA
WP_071942649.1|182209_183592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083542562.1|183588_185118_-	nitrate reductase	NA	NA	NA	NA	NA
WP_071942651.1|185120_185582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083542563.1|185697_186966_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_071942653.1|187141_188065_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_096312012.1|188419_188599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942656.1|188629_190468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942658.1|190498_191557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156909710.1|191565_191823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125477475.1|191931_192315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942662.1|192241_192967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942665.1|194585_195821_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.5	4.7e-82
WP_071942667.1|196279_196507_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_071942669.1|196503_196806_+	toxin	NA	NA	NA	NA	NA
WP_071942671.1|196865_197552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949672.1|198267_201765_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_071942673.1|201875_203078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949673.1|203396_205733_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_083542881.1|205747_206944_+	dihydrolipoyllysine succinyltransferase	NA	NA	NA	NA	NA
WP_071942677.1|207126_207417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942680.1|207736_208972_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	50.1	1.4e-110
WP_083542564.1|208860_209898_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_071949674.1|210038_210509_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_156909711.1|210744_212008_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	54.0	7.7e-72
WP_071942687.1|213754_214990_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.7	3.4e-109
>prophage 2
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	294221	303979	6041408	transposase	Gordonia_phage(37.5%)	10	NA	NA
WP_083542565.1|294221_294368_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156909712.1|294389_294563_-	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	61.4	1.6e-12
WP_125477522.1|294546_295746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	7.3e-32
WP_071942687.1|296254_297490_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.7	3.4e-109
WP_071942806.1|297493_298102_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	47.1	6.1e-35
WP_071942808.1|298098_298356_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	58.3	8.6e-15
WP_096310927.1|298391_299530_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.4	1.3e-33
WP_156909713.1|299723_300827_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	4.2e-42
WP_156909714.1|300842_301010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156909715.1|302714_303979_-|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	44.5	7.7e-64
>prophage 3
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	379037	440517	6041408	portal,head,capsid,protease,integrase	Mycobacterium_phage(31.25%)	58	369267:369314	386577:386624
369267:369314	attL	CAGCGCCCCCGGCAGGAATCGAACCTGCGACCTAGGGATTAGAAGGCC	NA	NA	NA	NA
WP_156909723.1|379037_380240_+|portal	phage portal protein	portal	A0A0A1END8	Mycobacterium_phage	27.9	3.1e-30
WP_156909908.1|380245_380797_+|head,protease	HK97 family phage prohead protease	head,protease	Q9AZE1	Lactococcus_phage	37.4	6.0e-21
WP_083542571.1|380787_381975_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	31.6	1.0e-33
WP_156909724.1|382105_382696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942944.1|382680_383046_+	hypothetical protein	NA	A0A097EYM2	Mycobacterium_phage	62.7	6.5e-32
WP_156909725.1|383462_383717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942950.1|383788_384145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942952.1|384359_384590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942954.1|384586_384871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071942956.1|385043_386501_-|integrase	site-specific integrase	integrase	A0A1W6JQG4	Corynebacterium_phage	29.2	1.3e-27
WP_071942958.1|386748_386931_-	hypothetical protein	NA	NA	NA	NA	NA
386577:386624	attR	CAGCGCCCCCGGCAGGAATCGAACCTGCGACCTAGGGATTAGAAGGCC	NA	NA	NA	NA
WP_071942959.1|387350_388556_+	alpha/beta hydrolase	NA	Q854G2	Mycobacterium_phage	36.7	1.2e-37
WP_071949692.1|388558_389299_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071942961.1|389411_390629_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	28.7	1.8e-06
WP_071942963.1|390786_391392_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071942965.1|391398_391701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047331514.1|391697_391922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909726.1|392021_392282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949694.1|392396_393881_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_071942967.1|393880_395470_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_071942968.1|395466_397794_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
WP_071942970.1|397809_399807_+	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_071942972.1|399931_400384_+	single-stranded DNA-binding protein	NA	A0A2I2MPH3	Mycobacterium_phage	28.8	8.9e-07
WP_071949695.1|400502_402176_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.8	1.1e-46
WP_071942974.1|407040_407454_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_071942976.1|407450_408086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096311852.1|408095_408770_+	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_071942978.1|408766_410323_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_071942980.1|410332_410728_-	globin	NA	NA	NA	NA	NA
WP_071949697.1|410858_411491_+	HNH endonuclease	NA	H6WG01	Cyanophage	37.0	2.6e-20
WP_071942982.1|411508_411745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071942984.1|411731_412208_+	DUF5130 domain-containing protein	NA	NA	NA	NA	NA
WP_071942986.1|412208_412556_-	HNH endonuclease	NA	A0A0K0N676	Gordonia_phage	42.2	5.1e-10
WP_071942988.1|412579_415138_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	34.1	7.2e-45
WP_083542572.1|415161_415509_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_071942992.1|415697_416306_+	disulfide bond formation protein DsbA	NA	NA	NA	NA	NA
WP_071942994.1|416363_417773_+	cytosine permease	NA	NA	NA	NA	NA
WP_071942996.1|417769_418216_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_071942998.1|418212_419166_+	isopenicillin N synthase family oxygenase	NA	S4VNP9	Pandoravirus	27.7	2.9e-15
WP_071943000.1|419254_419734_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_071943002.1|419737_420529_+	Fpg/Nei family DNA glycosylase	NA	A0A127AWE5	Bacillus_phage	29.0	2.6e-09
WP_071943003.1|420565_422257_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_071949698.1|422253_423090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071943005.1|423144_424356_-	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	24.4	6.1e-18
WP_156909909.1|424557_426186_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_071943009.1|426243_427827_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_071943011.1|427823_429008_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_071943013.1|429004_429742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071943015.1|429745_431116_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071943017.1|431201_432563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949699.1|432562_432916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156909727.1|433060_434335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071943022.1|434400_434928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156909728.1|434934_435594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909729.1|435667_436375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071943030.1|437750_439169_+	trigger factor	NA	NA	NA	NA	NA
WP_071943032.1|439265_439862_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	6.9e-39
WP_071943034.1|439854_440517_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	1913717	1922957	6041408		Streptococcus_phage(16.67%)	9	NA	NA
WP_071945459.1|1913717_1914386_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	33.0	2.7e-20
WP_071945461.1|1914494_1915382_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	31.1	1.3e-06
WP_071945463.1|1915388_1916384_+	DUF4190 domain-containing protein	NA	A0A2H4UTF4	Bodo_saltans_virus	32.7	7.2e-09
WP_071945466.1|1916394_1916634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909926.1|1916840_1917044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071945470.1|1917057_1919409_-	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.9	8.8e-13
WP_071945472.1|1919499_1920042_-	adenine phosphoribosyltransferase	NA	A0A2K9L0U5	Tupanvirus	27.3	4.8e-07
WP_071945474.1|1920023_1921676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071945476.1|1921682_1922957_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.1	9.6e-22
>prophage 5
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	2556965	2564949	6041408	transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_071946601.1|2556965_2557448_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	29.5	7.3e-07
WP_071946603.1|2557476_2557716_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	64.4	2.2e-20
WP_083542931.1|2559173_2559479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096310927.1|2560158_2561296_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	34.4	1.3e-33
WP_083542676.1|2561196_2561760_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_071946607.1|2561812_2562355_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.7	3.3e-08
WP_156909943.1|2562452_2563046_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071949986.1|2563042_2564086_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	25.9	1.4e-15
WP_071946611.1|2564082_2564949_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	30.9	1.0e-06
>prophage 6
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	2876962	2886222	6041408	capsid,portal,protease,head	Mycobacterium_phage(50.0%)	8	NA	NA
WP_071947046.1|2876962_2877316_-	hypothetical protein	NA	M4W671	Mycobacterium_phage	60.0	1.5e-30
WP_156909792.1|2877300_2877891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909793.1|2877887_2878034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071947048.1|2878033_2879215_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	31.1	7.0e-35
WP_071947049.1|2879211_2879772_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1PA08	Enterococcus_phage	35.6	1.3e-20
WP_083542697.1|2879768_2880872_-|portal	phage portal protein	portal	A0A0A1END8	Mycobacterium_phage	29.2	5.7e-31
WP_071947050.1|2881192_2882587_-	hypothetical protein	NA	A0A2K9VGS4	Pontimonas_phage	33.7	1.0e-48
WP_071947051.1|2882883_2886222_-	hypothetical protein	NA	A0A1D8EX17	Mycobacterium_phage	65.9	9.2e-40
>prophage 7
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	2928484	2976387	6041408	transposase,integrase	Gordonia_phage(22.22%)	52	2940936:2940953	2977814:2977831
WP_071942687.1|2928484_2929720_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	52.7	3.4e-109
WP_071947092.1|2929770_2930085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071950029.1|2930190_2931267_-	NDP-sugar synthase	NA	I7I009	Enterobacteria_phage	28.4	1.2e-17
WP_071950030.1|2931285_2932143_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_083542941.1|2932157_2933021_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_096310578.1|2933142_2934600_+	LCP family protein	NA	NA	NA	NA	NA
WP_071947095.1|2934599_2935310_+	TIGR03089 family protein	NA	NA	NA	NA	NA
WP_083542699.1|2935324_2936110_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_071947096.1|2936106_2937264_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_071947097.1|2937305_2937812_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.8	4.6e-20
WP_071947098.1|2937804_2939022_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_071947099.1|2939079_2939730_+	GtrA family protein	NA	NA	NA	NA	NA
WP_071950032.1|2939684_2940203_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_071947100.1|2940291_2941920_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
2940936:2940953	attL	CAAGACCGTCACCGGCGA	NA	NA	NA	NA
WP_071947101.1|2941916_2942195_+	acyl-CoA carboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_071947102.1|2942191_2942836_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_071947103.1|2942856_2943753_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_096312744.1|2943761_2944175_+	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_071947105.1|2944210_2945332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947106.1|2945446_2947234_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_071947107.1|2947244_2948045_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_156909795.1|2948067_2948808_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_071950034.1|2948818_2949169_+	DUF1707 domain-containing protein	NA	NA	NA	NA	NA
WP_071947108.1|2949170_2949497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947109.1|2949480_2950038_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_071947110.1|2950405_2950846_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_071947111.1|2950816_2951608_-	RNA polymerase sigma factor SigF	NA	A0A218KDJ1	Bacillus_phage	28.5	3.5e-14
WP_071947112.1|2951604_2952042_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_071947113.1|2952254_2953274_+	DNA topoisomerase IB	NA	NA	NA	NA	NA
WP_071947114.1|2953275_2954517_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_071947116.1|2954907_2956413_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071947117.1|2956479_2956692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109751034.1|2956773_2956956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947118.1|2956972_2957212_+	CsbD family protein	NA	NA	NA	NA	NA
WP_125477403.1|2957267_2957513_-	LapA family protein	NA	NA	NA	NA	NA
WP_071947120.1|2957660_2958335_-	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_071947121.1|2958346_2959681_-	L-lysine 6-transaminase	NA	A0A1V0SKB7	Klosneuvirus	47.3	1.4e-116
WP_071947122.1|2959732_2960203_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071947123.1|2960233_2961472_+	DUF1338 family protein	NA	NA	NA	NA	NA
WP_071947124.1|2961468_2963025_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071947125.1|2963021_2963468_-	ester cyclase	NA	NA	NA	NA	NA
WP_071947126.1|2963522_2964173_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071950035.1|2964169_2965261_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_071950036.1|2965340_2965556_+	ferredoxin	NA	NA	NA	NA	NA
WP_071947127.1|2965552_2966953_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071947128.1|2966963_2968235_+	cytochrome P450	NA	NA	NA	NA	NA
WP_071947129.1|2968377_2972907_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_083542597.1|2973078_2973456_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	62.1	5.9e-28
WP_125477522.1|2973403_2974603_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	7.3e-32
WP_096311611.1|2974692_2975487_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	46.9	2.6e-41
WP_071947130.1|2975483_2975801_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.5	1.2e-18
WP_083542702.1|2975814_2976387_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2977814:2977831	attR	CAAGACCGTCACCGGCGA	NA	NA	NA	NA
>prophage 8
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	3793453	3822021	6041408	transposase,integrase	Corynebacterium_phage(25.0%)	18	3787957:3787971	3803077:3803091
3787957:3787971	attL	ACCAGCCCCAGCCCG	NA	NA	NA	NA
WP_071947838.1|3793453_3794815_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_071947839.1|3795243_3795687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071947840.1|3795683_3797858_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071947841.1|3798111_3799347_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.4e-81
WP_156909834.1|3801518_3803213_+	hypothetical protein	NA	NA	NA	NA	NA
3803077:3803091	attR	ACCAGCCCCAGCCCG	NA	NA	NA	NA
WP_156909960.1|3803284_3804922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947842.1|3804955_3805918_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071950124.1|3805941_3807645_-	FAD-dependent oxidoreductase	NA	A0A1V0S9J5	Catovirus	35.8	2.8e-08
WP_071947843.1|3809036_3810395_-	nucleotide sugar dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	30.0	3.4e-41
WP_083542736.1|3810628_3812665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071947844.1|3813224_3814562_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_083542737.1|3814592_3814805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071947845.1|3814870_3815719_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_083542738.1|3815834_3817418_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_071947847.1|3817522_3818437_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_071947848.1|3818580_3819393_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	43.0	6.9e-50
WP_071950126.1|3819392_3820613_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071950127.1|3820758_3822021_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	4849625	4914570	6041408	transposase,integrase,tRNA	Corynebacterium_phage(27.27%)	60	4905495:4905514	4915727:4915746
WP_071942665.1|4849625_4850861_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.5	4.7e-82
WP_071948668.1|4851015_4851495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948669.1|4851491_4851860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948670.1|4852036_4852294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948671.1|4852615_4852861_-	hypothetical protein	NA	G1DAP3	Mycobacterium_virus	47.4	6.3e-07
WP_083542800.1|4853191_4854676_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_071950241.1|4854672_4855080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948672.1|4855165_4855720_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071948673.1|4855788_4855986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125477511.1|4855996_4856296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948675.1|4856373_4856643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948676.1|4856733_4857495_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071948677.1|4857491_4858670_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_071950242.1|4858666_4859665_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_071948678.1|4859705_4861022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948679.1|4861029_4861422_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_071948680.1|4861429_4861903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071948681.1|4862033_4862768_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.3	1.5e-35
WP_071948682.1|4862745_4864248_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.6	1.6e-12
WP_071948683.1|4864244_4866041_+	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_156909874.1|4866085_4867330_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071948684.1|4867326_4869237_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_083542801.1|4869310_4871314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071948686.1|4871343_4873221_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.5	2.8e-139
WP_071948687.1|4874208_4874832_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071948688.1|4874828_4876136_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_071948689.1|4876146_4876905_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.8	2.6e-11
WP_071948690.1|4876906_4877950_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_071948691.1|4878037_4879189_+	CoA transferase	NA	NA	NA	NA	NA
WP_071948692.1|4879203_4880364_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_071948693.1|4880462_4881071_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_071948694.1|4881084_4882110_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_071948695.1|4882106_4882481_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_071948696.1|4882621_4883575_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071948697.1|4883575_4884673_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	7.0e-05
WP_071948698.1|4884669_4885314_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071948699.1|4885310_4886099_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_071948700.1|4886095_4886698_+	putative glycolipid-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083542802.1|4886660_4887620_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_071948702.1|4887701_4888220_+|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_071948703.1|4888216_4888678_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.9	6.3e-08
WP_071942665.1|4889254_4890490_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.5	4.7e-82
WP_071948705.1|4891537_4892281_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_071948706.1|4892557_4893844_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_071948707.1|4893840_4894353_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_071948708.1|4894363_4895185_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_083542803.1|4895256_4896042_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071948710.1|4896027_4896774_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071948711.1|4897128_4897452_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_071948712.1|4897454_4898729_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071948713.1|4898703_4899627_-	4,5-dihydroxyphthalate decarboxylase	NA	NA	NA	NA	NA
WP_071948714.1|4899790_4900915_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_071948715.1|4900917_4901610_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_071948716.1|4901606_4902677_+	amidohydrolase	NA	NA	NA	NA	NA
WP_083542804.1|4902750_4903962_+	cytochrome P450	NA	NA	NA	NA	NA
WP_071948717.1|4903958_4905380_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
4905495:4905514	attL	ACGCTCATCGAAATTCCCCA	NA	NA	NA	NA
WP_071947841.1|4907264_4908500_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	44.2	1.4e-81
WP_071947840.1|4908753_4910928_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071948718.1|4910924_4911368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071944019.1|4913016_4914570_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.1	1.5e-16
4915727:4915746	attR	TGGGGAATTTCGATGAGCGT	NA	NA	NA	NA
>prophage 10
NZ_CP018043	Mycobacterium sp. WY10, complete genome	6041408	5382129	5410399	6041408	portal,bacteriocin,capsid,protease,terminase,integrase	Mollivirus(14.29%)	32	5395888:5395904	5411297:5411313
WP_071949106.1|5382129_5382927_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_071949107.1|5382926_5383949_-	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	29.6	2.6e-17
WP_071950291.1|5383991_5385263_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_071950292.1|5385269_5385662_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_071949108.1|5385804_5387034_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_071950293.1|5387044_5389339_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	62.5	3.7e-266
WP_083542826.1|5389335_5391120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949109.1|5391116_5391665_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071949110.1|5391661_5392087_-	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071949111.1|5392143_5392536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949112.1|5392625_5394158_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.9	3.5e-47
WP_071949113.1|5394161_5395484_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_071949114.1|5395541_5395970_-	cupin domain-containing protein	NA	NA	NA	NA	NA
5395888:5395904	attL	CTCGGGGTCGCCGCGGC	NA	NA	NA	NA
WP_071949115.1|5395999_5396617_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_071949116.1|5396665_5397736_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.4	2.2e-59
WP_071949117.1|5397772_5397958_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_071949118.1|5398095_5399184_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_071949119.1|5399222_5400101_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_083542827.1|5400358_5401294_-	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	26.2	6.2e-10
WP_071950295.1|5401645_5401930_-	hypothetical protein	NA	R4TIQ5	Mycobacterium_phage	37.8	7.1e-10
WP_071949121.1|5401995_5402313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071949122.1|5402315_5403140_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_083542828.1|5403742_5405050_-|portal	phage portal protein	portal	A0A2H4JAT8	uncultured_Caudovirales_phage	29.4	3.0e-31
WP_071949124.1|5405050_5406502_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_156909884.1|5406709_5407006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909885.1|5407157_5407460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071949127.1|5407456_5407654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071949128.1|5407650_5407851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909886.1|5407847_5408111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156909887.1|5408124_5408835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071949131.1|5408831_5409029_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071949133.1|5409508_5410399_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
5411297:5411313	attR	GCCGCGGCGACCCCGAG	NA	NA	NA	NA
