The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018029	Alteromonas mediterranea strain RG65 chromosome, complete genome	4349864	919021	927687	4349864		Streptococcus_phage(16.67%)	6	NA	NA
WP_071968328.1|919021_920314_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.7	2.2e-135
WP_012517444.1|920373_922005_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	3.2e-147
WP_071968329.1|922141_924733_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.7	8.4e-33
WP_012517446.1|924894_925434_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	45.2	1.0e-25
WP_012517447.1|925554_926601_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.8	2.5e-116
WP_012517448.1|926865_927687_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.4e-26
>prophage 2
NZ_CP018029	Alteromonas mediterranea strain RG65 chromosome, complete genome	4349864	1905714	1974178	4349864	protease,integrase,holin,tRNA	Liberibacter_phage(14.29%)	58	1910289:1910319	1935713:1935743
WP_081367518.1|1905714_1906776_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	35.5	4.8e-51
WP_071968719.1|1906780_1906957_-	excisionase	NA	NA	NA	NA	NA
WP_071968720.1|1907060_1907990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968721.1|1908020_1908440_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_071968722.1|1908483_1910061_-	replication endonuclease	NA	Q94N00	Haemophilus_virus	33.2	5.8e-61
1910289:1910319	attL	TGGTGGAGCTGGCGGGATTTGAACCCGCGTC	NA	NA	NA	NA
WP_155761737.1|1910394_1910547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071968723.1|1910641_1911043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968724.1|1911106_1912051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071968726.1|1913201_1914176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071968728.1|1915279_1916542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155761738.1|1916736_1916892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968729.1|1917231_1918557_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_071968730.1|1918826_1919147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968731.1|1919502_1920117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968732.1|1920141_1920795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968733.1|1920921_1922610_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	26.9	2.9e-34
WP_071968735.1|1923984_1925292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968736.1|1925270_1926425_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_071968737.1|1926436_1929625_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.7	3.9e-72
WP_071968738.1|1929688_1930930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968739.1|1931089_1931326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071968740.1|1931563_1931893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968742.1|1932571_1932763_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	46.6	6.2e-10
WP_071968743.1|1932779_1933955_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	38.3	2.5e-61
WP_071968744.1|1934137_1934578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015067082.1|1936457_1937681_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
1935713:1935743	attR	TGGTGGAGCTGGCGGGATTTGAACCCGCGTC	NA	NA	NA	NA
WP_012518302.1|1937783_1938263_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.0	3.8e-24
WP_012518303.1|1938408_1938840_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_071968745.1|1938836_1939184_+	RnfH family protein	NA	NA	NA	NA	NA
WP_012518305.1|1939256_1939733_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071968746.1|1939765_1941736_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.4	4.4e-26
WP_071968747.1|1942059_1944762_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_071968748.1|1944926_1946906_+	sulfotransferase	NA	NA	NA	NA	NA
WP_071968749.1|1947207_1947921_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_071951433.1|1948096_1948909_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_071968750.1|1949181_1951554_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.4	2.3e-178
WP_023559661.1|1951879_1952029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968751.1|1952649_1954911_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_071968752.1|1954907_1955414_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_015067092.1|1955779_1955995_-	tellurium resistance protein TerC	NA	NA	NA	NA	NA
WP_015067093.1|1956313_1956730_+	DUF4826 family protein	NA	NA	NA	NA	NA
WP_071968753.1|1956746_1957205_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071968754.1|1957214_1958381_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_081367519.1|1958553_1959294_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_071951439.1|1959348_1960716_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	1.9e-108
WP_071959150.1|1960729_1961356_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_155761628.1|1961355_1962483_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_015067100.1|1962817_1963360_-	rRNA large subunit pseudouridine synthase E	NA	NA	NA	NA	NA
WP_071951442.1|1963858_1966078_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014949330.1|1966602_1966821_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.1	2.7e-17
WP_014949331.1|1967062_1967383_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.6	4.2e-11
WP_071968756.1|1967407_1969684_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	7.1e-169
WP_008844395.1|1969864_1970083_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_081367520.1|1970158_1970905_-	arginyltransferase	NA	NA	NA	NA	NA
WP_071970597.1|1970877_1971624_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020743481.1|1971669_1972635_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.7	3.3e-59
WP_071951446.1|1973213_1973663_+	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_071959157.1|1973722_1974178_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018029	Alteromonas mediterranea strain RG65 chromosome, complete genome	4349864	2280765	2290416	4349864	tRNA	uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_071968883.1|2280765_2281155_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	36.4	1.7e-14
WP_071968884.1|2281154_2281523_+	DsrE family protein	NA	NA	NA	NA	NA
WP_071968885.1|2281522_2281867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071968886.1|2281863_2282211_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A060BH02	Podovirus	33.7	9.0e-07
WP_071968887.1|2282574_2283012_+	host attachment protein	NA	NA	NA	NA	NA
WP_071968888.1|2283088_2283802_-	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_071968889.1|2283912_2286819_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.1	3.8e-26
WP_071968890.1|2287318_2288611_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.8	5.6e-94
WP_071968891.1|2288621_2289005_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	32.4	7.6e-07
WP_071951624.1|2289108_2290416_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	4.6e-72
