The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016930	Francisella sp. MA067296 chromosome, complete genome	1824527	79849	89991	1824527	tRNA	Staphylococcus_phage(28.57%)	10	NA	NA
WP_071628449.1|79849_81634_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	2.1e-22
WP_114701994.1|81581_82730_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_114701995.1|83770_84295_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.4e-16
WP_071628452.1|84291_84735_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	4.9e-26
WP_071628453.1|84744_85956_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	2.1e-90
WP_071628454.1|85948_86554_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	36.2	6.8e-18
WP_071628455.1|86546_87614_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.1	1.5e-49
WP_157092979.1|88215_88353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071628456.1|88625_88982_-	ferredoxin	NA	NA	NA	NA	NA
WP_071628457.1|89067_89991_+	S49 family peptidase	NA	F8QZT1	Wolbachia_phage	22.6	1.2e-13
>prophage 3
NZ_CP016930	Francisella sp. MA067296 chromosome, complete genome	1824527	661156	720359	1824527	integrase,transposase,tRNA	Paenibacillus_phage(13.33%)	54	714807:714866	720169:720385
WP_071628947.1|661156_663040_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_071628948.1|663183_664266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071628949.1|664252_665158_+	FUSC family protein	NA	NA	NA	NA	NA
WP_071628950.1|665173_666085_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071628951.1|666192_666915_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	40.0	9.3e-06
WP_071628952.1|667226_668675_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_071628953.1|668708_670100_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	60.4	3.4e-49
WP_157092984.1|670309_670456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071628954.1|670751_671159_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_071628955.1|671530_673543_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_071628956.1|673581_674379_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_071628957.1|674378_675176_+	glutamate racemase	NA	NA	NA	NA	NA
WP_071628958.1|675267_676545_+	MFS transporter	NA	NA	NA	NA	NA
WP_157092985.1|677271_678426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114702045.1|678465_678645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114702046.1|678628_678811_+|transposase	IS1 transposase	transposase	NA	NA	NA	NA
WP_071628960.1|679023_680478_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_114702047.1|680477_681464_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_071628961.1|681481_683233_+	transglutaminase	NA	NA	NA	NA	NA
WP_071628962.1|683279_684449_-	amidohydrolase	NA	NA	NA	NA	NA
WP_071628963.1|684690_684933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071628964.1|685079_686465_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SGL7	Hokovirus	23.8	4.5e-09
WP_066047264.1|686448_686649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071628965.1|686747_688019_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.7	2.7e-40
WP_071628966.1|688022_688778_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	46.3	1.5e-62
WP_071628967.1|688778_689252_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.4	1.5e-25
WP_071628968.1|689326_689758_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_071628969.1|689757_690063_+	RnfH family protein	NA	NA	NA	NA	NA
WP_071628970.1|690052_690631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071628971.1|690623_691832_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_071628972.1|691908_692829_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_071628973.1|692944_694690_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_071628974.1|694708_695464_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071628975.1|695633_697451_-	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	34.9	3.2e-23
WP_071628410.1|697857_698607_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	44.2	2.1e-21
WP_071628976.1|698738_699437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071628977.1|699652_700525_-	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_071628978.1|700533_700704_-	rubredoxin	NA	NA	NA	NA	NA
WP_071628979.1|700790_701408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071628980.1|701513_702908_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.3	7.0e-42
WP_114702048.1|703170_704451_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_071628982.1|704648_705677_+	SIS domain-containing protein	NA	A0A0N9Q9E4	Chrysochromulina_ericina_virus	29.7	8.5e-21
WP_071628983.1|705710_707063_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_071628984.1|707151_707862_+	phosphatase PAP2 family protein	NA	R4TQ27	Phaeocystis_globosa_virus	25.0	3.5e-05
WP_071628985.1|707858_708605_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_071629958.1|708703_709909_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_071628986.1|709923_710631_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_071628987.1|710649_712443_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	36.7	6.1e-99
WP_071628988.1|712550_713615_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.0	1.7e-35
WP_071628989.1|713974_714724_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	43.3	1.1e-20
WP_071628990.1|714798_715347_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	33.5	1.2e-18
714807:714866	attL	TAGTTATAAAACAGTAAGAAGTTGGAGTAATAAGTTTGGCAAATCTTTCGCTGATATTCT	NA	NA	NA	NA
WP_071628991.1|715805_718073_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071628992.1|719558_719912_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_071628993.1|720002_720359_-|transposase	IS6 family transposase	transposase	NA	NA	NA	NA
720169:720385	attR	AGAATATCAGCGAAAGATTTGCCAAACTTATTACTCCAACTTCTTACTGTTTTATAACTAACTAATATACTTCTGTATCTAAGTATTTCCTCTACATCCCTGTAACTGGTATTAAATCTATGATAAATCCATATAGCGTAACTAATAATCTCCGCTGAATAACGATATCTCTTTGGCTTTTGAGTAAGCATAGATAATGAGTAAGAAAAATAATTTT	NA	NA	NA	NA
>prophage 4
NZ_CP016930	Francisella sp. MA067296 chromosome, complete genome	1824527	1418282	1427463	1824527		Prochlorococcus_phage(33.33%)	8	NA	NA
WP_071629589.1|1418282_1420292_+	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	26.1	7.4e-53
WP_071629590.1|1420387_1420741_+	YraN family protein	NA	NA	NA	NA	NA
WP_071629591.1|1420801_1421899_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_071629592.1|1421901_1422393_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	2.6e-20
WP_071629593.1|1422498_1423083_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.1	1.1e-20
WP_071629594.1|1423086_1425399_-	phosphoribosylamine--glycine ligase	NA	A0A0M4JBD3	Mollivirus	29.8	3.6e-27
WP_071629595.1|1425398_1426442_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	40.0	3.7e-56
WP_071629596.1|1426614_1427463_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.0	3.1e-29
>prophage 5
NZ_CP016930	Francisella sp. MA067296 chromosome, complete genome	1824527	1795513	1816176	1824527	transposase	Wolbachia_phage(33.33%)	19	NA	NA
WP_071629399.1|1795513_1796263_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	44.2	2.1e-21
WP_071629909.1|1796440_1797862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071629910.1|1798550_1799192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629912.1|1799490_1800243_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.8	1.2e-19
WP_071628504.1|1800311_1801274_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071629913.1|1801333_1801837_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071629914.1|1802195_1803827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629915.1|1803926_1804718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629916.1|1804816_1805383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629917.1|1805768_1806008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629918.1|1806061_1807009_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	45.5	1.0e-57
WP_157092991.1|1807309_1807447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071629919.1|1807778_1809149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071629920.1|1809593_1810346_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_071629921.1|1810358_1811099_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_071629922.1|1811106_1811826_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_071629923.1|1811893_1813042_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	47.9	3.7e-81
WP_071629924.1|1813274_1814534_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.4	9.1e-41
WP_071628605.1|1815228_1816176_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	45.5	3.6e-58
