The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013246	Clostridium botulinum strain CDC_69094, complete genome	4089027	76406	84611	4089027	protease	uncultured_phage(33.33%)	9	NA	NA
WP_003358714.1|76406_77351_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.1	3.2e-14
WP_003358556.1|77970_78966_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358645.1|79082_79844_+	2-hydroxyglutaryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_003358723.1|79861_80293_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.1	1.4e-12
WP_003358633.1|80294_80960_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	44.6	1.4e-37
WP_003358544.1|80963_81554_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	54.5	9.8e-46
WP_003358784.1|81737_82388_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	51.2	1.7e-59
WP_003358688.1|82689_83508_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071647142.1|83654_84611_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.6	7.2e-14
>prophage 2
NZ_CP013246	Clostridium botulinum strain CDC_69094, complete genome	4089027	172103	234752	4089027	coat,head,tail,holin,terminase,plate,integrase	Clostridium_phage(65.12%)	79	194131:194162	240680:240711
WP_003359081.1|172103_173249_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	36.9	1.1e-16
WP_071647160.1|173241_174825_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_071647161.1|175118_176600_+	threonine synthase	NA	NA	NA	NA	NA
WP_071647162.1|176609_177503_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003359029.1|177629_178949_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003359088.1|179169_180447_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003358936.1|181132_183043_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_003358990.1|183551_184718_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003358986.1|185046_185934_+	sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein	NA	NA	NA	NA	NA
WP_003359035.1|185933_187316_+	NADPH-dependent glutamate synthase	NA	NA	NA	NA	NA
WP_071647163.1|187544_189509_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_003359059.1|189515_190217_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_106574553.1|190495_190609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358842.1|190640_191729_+	Ig domain-containing protein	NA	E5AFW9	Erwinia_phage	33.8	5.5e-10
WP_031367703.1|191822_192041_+	hypothetical protein	NA	A0A0A7RTM8	Clostridium_phage	71.4	2.2e-11
WP_155119175.1|192215_192368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003358874.1|192726_192888_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_003359075.1|193726_193942_+	hypothetical protein	NA	NA	NA	NA	NA
194131:194162	attL	AAAAGAACCCCAATAAAAGGGGTTCTTTTTGT	NA	NA	NA	NA
WP_079994968.1|194440_194677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003359066.1|194832_195384_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	31.6	2.5e-11
WP_003359046.1|195421_195709_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_071647164.1|196294_197368_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	29.8	3.7e-19
WP_012720639.1|197429_197876_-	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	42.8	2.2e-26
WP_071647165.1|197894_198320_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	58.0	5.8e-32
WP_071647166.1|198547_198751_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071647167.1|198767_199067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080488611.1|199087_199951_+	phage antirepressor KilAC domain-containing protein	NA	A0A090D834	Clostridium_phage	59.0	6.8e-80
WP_061294726.1|199942_200209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080488612.1|200572_200896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647168.1|201071_201869_+	recombinase RecT	NA	H7BUU1	unidentified_phage	54.3	4.2e-60
WP_080488648.1|201900_202653_+	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	55.4	6.3e-74
WP_071647170.1|202663_202948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647171.1|202970_203765_+	DnaD domain protein	NA	A8ATY7	Listeria_phage	37.8	3.5e-38
WP_080488614.1|203697_204465_+	MerR family transcriptional regulator	NA	M9Q1J4	Clostridium_phage	46.2	7.7e-51
WP_071647172.1|204476_204755_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155119176.1|204791_204950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647173.1|204962_205778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119177.1|205807_205972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647174.1|206009_206306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647175.1|206385_206688_+	hypothetical protein	NA	A0A172JIH8	Bacillus_phage	69.6	9.2e-16
WP_155119178.1|206794_207178_+	hypothetical protein	NA	I2E8X6	Clostridium_phage	34.1	1.9e-13
WP_071647176.1|207346_207700_+	Holliday junction resolvase	NA	A0A0A7S133	Clostridium_phage	79.3	1.0e-50
WP_071647177.1|207701_208085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647178.1|208085_208412_+	hypothetical protein	NA	A0A0A7RWJ7	Clostridium_phage	46.6	8.7e-20
WP_155119179.1|208424_208601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647179.1|208752_209271_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0A7RVS1	Clostridium_phage	30.8	1.4e-16
WP_012705283.1|209654_209894_+	peptidase	NA	NA	NA	NA	NA
WP_071647180.1|210157_210868_+	GIY-YIG nuclease family protein	NA	A0A2I7S3T0	Vibrio_phage	36.2	2.4e-06
WP_045904665.1|211029_211212_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_071647181.1|211297_211507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647182.1|211605_212175_+|terminase	terminase small subunit	terminase	Q6SED9	Lactobacillus_prophage	33.3	2.8e-13
WP_071647183.1|212164_213403_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0A7RTE7	Clostridium_phage	91.0	1.4e-222
WP_031368395.1|214657_216484_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.4	1.1e-87
WP_080488616.1|217348_218380_+|head	phage head morphogenesis protein	head	A0A0A7RVY7	Clostridium_phage	77.3	1.1e-148
WP_155119180.1|218468_218615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647185.1|218598_218967_-	DUF2513 domain-containing protein	NA	A0A1S5SCT1	Streptococcus_phage	45.2	1.1e-23
WP_071647186.1|219140_219704_+	scaffolding protein	NA	A0A0A7RTM5	Clostridium_phage	42.6	4.2e-22
WP_071647187.1|219726_220794_+|coat	phage coat protein	coat	A0A0A7RTH8	Clostridium_phage	88.5	7.2e-180
WP_071647944.1|220811_221156_+	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	85.1	2.1e-48
WP_071647188.1|221157_221544_+	hypothetical protein	NA	A0A0A7S083	Clostridium_phage	73.6	3.1e-40
WP_071647189.1|221543_222035_+	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	73.5	1.2e-60
WP_071647190.1|222048_222330_+	hypothetical protein	NA	A0A0A7RTM9	Clostridium_phage	62.2	3.0e-21
WP_071647191.1|222280_222511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647192.1|222563_222995_+	hypothetical protein	NA	A0A0A7RTI2	Clostridium_phage	75.4	4.6e-53
WP_071647193.1|223156_224467_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	83.9	1.5e-211
WP_071647194.1|224470_224935_+|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	80.5	6.0e-67
WP_071647195.1|224950_225364_+	hypothetical protein	NA	A0A0A7RTN3	Clostridium_phage	74.8	3.7e-52
WP_012703789.1|225604_226183_+	hypothetical protein	NA	A0A0A7RTT9	Clostridium_phage	56.1	2.3e-55
WP_071647196.1|226268_228428_+	hypothetical protein	NA	A0A0A7S091	Clostridium_phage	52.7	1.2e-133
WP_071647197.1|228427_229090_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7RVP5	Clostridium_phage	76.1	2.2e-94
WP_012721239.1|229101_230076_+	hypothetical protein	NA	A0A0A7RTZ4	Clostridium_phage	84.3	4.3e-155
WP_071647198.1|230078_230423_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	78.1	8.0e-40
WP_012720785.1|230425_230836_+	DUF2634 domain-containing protein	NA	A0A0A7RTH1	Clostridium_phage	75.6	2.5e-48
WP_071647199.1|230836_231931_+|plate	baseplate J/gp47 family protein	plate	A0A0A7S096	Clostridium_phage	76.7	3.8e-160
WP_012721289.1|231911_232538_+	DUF2313 domain-containing protein	NA	A0A0A7RVP9	Clostridium_phage	75.6	2.1e-86
WP_071647200.1|233173_233632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647201.1|233631_234192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647202.1|234205_234565_+	hypothetical protein	NA	A0A2H4J342	uncultured_Caudovirales_phage	53.3	4.7e-19
WP_071647203.1|234566_234752_+	hypothetical protein	NA	A0A2H4JGH3	uncultured_Caudovirales_phage	67.4	1.3e-09
240680:240711	attR	AAAAGAACCCCAATAAAAGGGGTTCTTTTTGT	NA	NA	NA	NA
>prophage 3
NZ_CP013246	Clostridium botulinum strain CDC_69094, complete genome	4089027	1072766	1106940	4089027	tail,portal,capsid,terminase	uncultured_Caudovirales_phage(32.26%)	49	NA	NA
WP_071647419.1|1072766_1073534_-	SH3 domain-containing protein	NA	A0A2H4J8A3	uncultured_Caudovirales_phage	65.1	3.5e-88
WP_014521308.1|1073575_1073770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647420.1|1073783_1074038_-	hypothetical protein	NA	A0A0A7RTX0	Clostridium_phage	46.8	2.7e-13
WP_080488628.1|1074074_1075097_-	DNA (cytosine-5-)-methyltransferase	NA	A0A219UR24	Bacillus_phage	42.4	4.9e-69
WP_003400227.1|1075205_1075328_-	XkdX family protein	NA	A0A0A7S0E7	Clostridium_phage	55.0	5.9e-06
WP_071647421.1|1075320_1075686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647422.1|1075698_1077528_-	PQQ-binding-like beta-propeller repeat protein	NA	E2ELJ8	Clostridium_phage	57.8	4.4e-52
WP_071647423.1|1077535_1078693_-	hypothetical protein	NA	A0A0K2CZQ1	Paenibacillus_phage	33.3	6.1e-60
WP_155119189.1|1078708_1078861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155119203.1|1078888_1079725_-|tail	phage tail family protein	tail	E2ELJ6	Clostridium_phage	38.8	1.3e-43
WP_071647425.1|1079779_1082842_-|tail	phage tail tape measure protein	tail	A0A0A7S163	Clostridium_phage	81.9	6.9e-135
WP_033066337.1|1082842_1083145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647426.1|1083153_1083465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647427.1|1083477_1083999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647428.1|1083995_1084364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647429.1|1084384_1084801_-	hypothetical protein	NA	A0A0S2MVE4	Bacillus_phage	40.2	2.8e-07
WP_071647430.1|1084793_1085117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647431.1|1085116_1085413_-	hypothetical protein	NA	D7RWJ1	Brochothrix_phage	31.9	1.0e-06
WP_155119204.1|1085396_1085693_-	hypothetical protein	NA	A0A2H4PQK8	Staphylococcus_phage	58.5	3.2e-05
WP_071647433.1|1085702_1086686_-|capsid	phage capsid protein	capsid	A0A1V0E621	Streptomyces_phage	46.0	2.3e-68
WP_071647434.1|1086707_1087256_-	hypothetical protein	NA	A0A0A8WEG1	Clostridium_phage	38.7	5.0e-20
WP_071647435.1|1087385_1087751_-	ABC transporter ATPase	NA	A0A2H4J4N9	uncultured_Caudovirales_phage	58.7	5.1e-29
WP_071647436.1|1087816_1088038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080488630.1|1088039_1089224_-	hypothetical protein	NA	H7BWE7	unidentified_phage	33.5	2.5e-24
WP_071647437.1|1089213_1090641_-|portal	phage portal protein	portal	A0A0A8WIH2	Clostridium_phage	44.5	1.8e-106
WP_155119206.1|1090653_1091922_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	60.7	2.4e-150
WP_071647438.1|1091905_1092346_-|terminase	terminase small subunit	terminase	S5MA50	Brevibacillus_phage	60.9	1.6e-37
WP_071647439.1|1092445_1092637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647440.1|1092823_1093261_-	siderophore-interacting protein	NA	A0A0A7RTX6	Clostridium_phage	35.0	1.9e-14
WP_155119190.1|1093637_1093805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647441.1|1093816_1094008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647442.1|1094045_1095911_-	DNA primase	NA	A0A2H4J1M0	uncultured_Caudovirales_phage	87.9	0.0e+00
WP_155119191.1|1096116_1096272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071647443.1|1096478_1096808_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A2H4J7H8	uncultured_Caudovirales_phage	79.4	1.7e-44
WP_071647956.1|1096808_1097087_-	DUF1599 domain-containing protein	NA	A0A2H4J4N1	uncultured_Caudovirales_phage	74.7	1.5e-25
WP_071647444.1|1097546_1097960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647445.1|1098166_1099861_-	hypothetical protein	NA	A0A2H4J041	uncultured_Caudovirales_phage	83.0	1.6e-287
WP_014521346.1|1099860_1100049_-	hypothetical protein	NA	A0A0A7S0P6	Clostridium_phage	65.0	3.3e-16
WP_071647446.1|1100102_1100558_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	65.3	3.7e-53
WP_155119192.1|1100558_1100708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647447.1|1100707_1102399_-	AAA family ATPase	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	89.7	1.3e-260
WP_071647957.1|1102444_1102741_-	VRR-NUC domain-containing protein	NA	A0A2H4J095	uncultured_Caudovirales_phage	88.5	6.0e-44
WP_071647448.1|1102737_1102920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647449.1|1102937_1103312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080488632.1|1103312_1104482_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	74.3	9.6e-170
WP_080488633.1|1104595_1105159_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	43.7	1.2e-24
WP_014521358.1|1105590_1105788_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071647451.1|1106009_1106453_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	34.9	4.8e-13
WP_071647452.1|1106472_1106940_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	28.6	9.2e-07
>prophage 4
NZ_CP013246	Clostridium botulinum strain CDC_69094, complete genome	4089027	1493057	1502541	4089027		Synechococcus_phage(42.86%)	8	NA	NA
WP_031367308.1|1493057_1494557_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.1e-69
WP_003357901.1|1494770_1495388_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.6	1.5e-25
WP_003357871.1|1495515_1496511_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	44.0	3.4e-67
WP_003385256.1|1496571_1498020_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	7.2e-58
WP_003358103.1|1498111_1498816_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	42.1	1.0e-41
WP_003357851.1|1498815_1499295_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	48.7	1.1e-26
WP_003357858.1|1499815_1499950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079994953.1|1499970_1502541_-	selenium-dependent xanthine dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	32.4	1.3e-09
>prophage 5
NZ_CP013246	Clostridium botulinum strain CDC_69094, complete genome	4089027	1651964	1673836	4089027		Clostridium_phage(85.71%)	27	NA	NA
WP_071647540.1|1651964_1653050_-	signal peptidase II	NA	A0A0A7RU66	Clostridium_phage	69.8	3.9e-141
WP_071647541.1|1653061_1654060_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	72.6	2.0e-139
WP_030036513.1|1654071_1654326_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	81.0	1.1e-33
WP_071647542.1|1654331_1656227_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	55.4	1.5e-111
WP_071647543.1|1656241_1657495_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	78.2	2.5e-192
WP_071647545.1|1657517_1658495_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	61.1	1.9e-110
WP_071647547.1|1658496_1659837_-	caspase family protein	NA	A0A0A7RW86	Clostridium_phage	74.6	2.1e-75
WP_071647549.1|1659851_1660193_-	hypothetical protein	NA	A0A0A7S0S4	Clostridium_phage	55.7	1.6e-16
WP_071647550.1|1660205_1661291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025774830.1|1661277_1661712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025774832.1|1661724_1663128_-	hypothetical protein	NA	A0A0A7RU22	Clostridium_phage	42.4	6.9e-05
WP_003357826.1|1663291_1663459_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	70.4	1.9e-15
WP_071647551.1|1663493_1663910_-	esterase	NA	A0A0A7S0S0	Clostridium_phage	70.5	3.4e-45
WP_012704139.1|1663924_1664812_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	74.8	2.4e-120
WP_012704829.1|1664816_1665236_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	73.4	7.1e-59
WP_012704384.1|1665241_1665589_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	60.7	1.5e-33
WP_003357709.1|1665593_1665959_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	57.9	1.2e-33
WP_003357791.1|1665958_1666243_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	59.2	3.0e-24
WP_012704555.1|1666909_1667431_-	hypothetical protein	NA	A0A0A7RVS1	Clostridium_phage	50.0	1.1e-35
WP_012704130.1|1667543_1667864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071647552.1|1667920_1668769_-	ATP-binding protein	NA	A0A2K9V3L7	Faecalibacterium_phage	34.8	8.0e-33
WP_061310459.1|1668710_1669616_-	hypothetical protein	NA	A8ASN4	Listeria_phage	39.9	3.6e-39
WP_072570747.1|1669709_1669943_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025774852.1|1669983_1670193_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003360073.1|1670384_1670795_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	56.2	1.0e-09
WP_003357837.1|1671096_1671246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003357882.1|1672348_1673836_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	38.3	4.3e-66
