The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015756	Clostridium estertheticum subsp. estertheticum strain DSM 8809 chromosome, complete genome	4760574	3000408	3031979	4760574	capsid,holin,tail,portal	Clostridium_phage(73.08%)	38	NA	NA
WP_084647595.1|3000408_3001620_-	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	51.5	8.9e-102
WP_071613333.1|3001873_3002404_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_071613334.1|3002408_3003749_-	AAA family ATPase	NA	Q2P9X8	Enterobacteria_phage	28.1	5.2e-10
WP_071613335.1|3003983_3004220_-	helix-turn-helix domain-containing protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	37.7	9.7e-05
WP_169829599.1|3004397_3004535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613336.1|3004680_3005226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613337.1|3005295_3006180_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M947	Bacillus_phage	34.2	6.9e-11
WP_071614981.1|3006282_3007044_-	DNA adenine methylase	NA	A0A2H4J7L8	uncultured_Caudovirales_phage	78.9	6.8e-116
WP_084647467.1|3007161_3007620_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	57.9	6.0e-35
WP_071613338.1|3007691_3008345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613339.1|3008365_3009442_-	signal peptidase II	NA	A0A0A7RU66	Clostridium_phage	53.8	1.0e-101
WP_071613340.1|3009453_3010449_-	hypothetical protein	NA	A0A0A7RW91	Clostridium_phage	64.5	1.8e-121
WP_071613341.1|3010460_3010715_-	hypothetical protein	NA	A0A0A7S0T0	Clostridium_phage	73.8	2.0e-32
WP_071613342.1|3010720_3012553_-	hypothetical protein	NA	A0A0A7RU09	Clostridium_phage	53.6	4.3e-108
WP_071613343.1|3012564_3013806_-	hypothetical protein	NA	A0A0A7RU28	Clostridium_phage	75.6	5.2e-182
WP_071613344.1|3013818_3015021_-	hypothetical protein	NA	A0A0A7RU61	Clostridium_phage	48.4	1.7e-41
WP_071613346.1|3015966_3016296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613347.1|3016308_3017394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613348.1|3017383_3017794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613349.1|3017806_3019975_-|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	47.4	6.4e-111
WP_071613350.1|3020020_3020347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613351.1|3020374_3020608_-	hypothetical protein	NA	A0A0A7RW80	Clostridium_phage	48.6	4.0e-11
WP_071614983.1|3020561_3020993_-	esterase	NA	A0A0A7S0S0	Clostridium_phage	64.6	2.1e-42
WP_071613352.1|3021103_3021985_-	hypothetical protein	NA	A0A0A7RTZ9	Clostridium_phage	51.0	1.3e-73
WP_071613353.1|3021986_3022409_-	hypothetical protein	NA	A0A0A7RU17	Clostridium_phage	64.0	5.2e-49
WP_071613354.1|3022416_3022761_-	hypothetical protein	NA	A0A0A7RU51	Clostridium_phage	63.6	7.0e-36
WP_071613355.1|3022765_3023131_-	hypothetical protein	NA	A0A0A7RW73	Clostridium_phage	65.8	9.3e-39
WP_071613356.1|3023130_3023421_-	hypothetical protein	NA	A0A0A7S0R4	Clostridium_phage	64.9	6.9e-29
WP_152025094.1|3023423_3023630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613358.1|3023713_3024742_-|capsid	major capsid protein	capsid	A0A1J1GG50	Clostridium_phage	75.4	2.8e-149
WP_152025082.1|3024760_3025102_-	hypothetical protein	NA	A0A2H4J872	uncultured_Caudovirales_phage	66.4	5.5e-33
WP_071613360.1|3025110_3025752_-	phage scaffold protein	NA	A0A0A7RW68	Clostridium_phage	52.2	3.7e-46
WP_084647468.1|3025798_3026017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613361.1|3026152_3026581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613362.1|3026652_3027588_-	hypothetical protein	NA	A0A0A7RU06	Clostridium_phage	67.6	2.0e-125
WP_071613363.1|3027613_3029071_-|portal	phage portal protein	portal	A0A0A7RW62	Clostridium_phage	64.9	3.4e-180
WP_071613365.1|3030955_3031162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613366.1|3031418_3031979_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	61.6	2.5e-59
>prophage 2
NZ_CP015756	Clostridium estertheticum subsp. estertheticum strain DSM 8809 chromosome, complete genome	4760574	3040147	3046797	4760574		Clostridium_phage(33.33%)	10	NA	NA
WP_071613376.1|3040147_3040738_-	molybdopterin-guanine dinucleotide biosynthesis protein A	NA	A0A2D1GQA7	Lysinibacillus_phage	42.4	3.4e-30
WP_071613377.1|3040740_3041169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613378.1|3041261_3041870_-	hypothetical protein	NA	A0A0A8WEV5	Clostridium_phage	42.0	7.5e-41
WP_071614985.1|3041900_3042326_-	single-stranded DNA-binding protein	NA	Q8SBL5	Clostridium_phage	42.0	2.9e-23
WP_169829603.1|3042352_3042505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613379.1|3042507_3043221_-	MBL fold metallo-hydrolase	NA	D7RWG0	Brochothrix_phage	42.4	2.9e-44
WP_071613380.1|3043221_3043986_-	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	45.1	7.9e-48
WP_071613381.1|3043986_3044259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613382.1|3044279_3044582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613384.1|3046542_3046797_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.3	6.7e-20
>prophage 3
NZ_CP015756	Clostridium estertheticum subsp. estertheticum strain DSM 8809 chromosome, complete genome	4760574	3230617	3240676	4760574		Synechococcus_phage(33.33%)	7	NA	NA
WP_071613570.1|3230617_3232120_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.4	2.2e-62
WP_071613571.1|3232134_3232743_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_071613572.1|3232730_3233729_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.1	1.0e-66
WP_084647599.1|3233738_3235139_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.4	5.0e-56
WP_071613574.1|3235260_3235965_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	41.2	2.7e-42
WP_071613575.1|3236012_3236492_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	1.7e-27
WP_071613576.1|3236851_3240676_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.0	2.7e-27
>prophage 4
NZ_CP015756	Clostridium estertheticum subsp. estertheticum strain DSM 8809 chromosome, complete genome	4760574	3508504	3550689	4760574	terminase,portal,integrase,protease,holin,capsid,tail	Clostridium_phage(44.44%)	55	3514174:3514194	3553311:3553331
WP_071613803.1|3508504_3510697_-	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	24.2	2.2e-05
WP_071615020.1|3510841_3513343_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_071613804.1|3513361_3514048_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	2.4e-35
3514174:3514194	attL	AATCTTACAATTCTGTAAGAT	NA	NA	NA	NA
WP_169829614.1|3514367_3514541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613805.1|3514804_3514957_-	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	76.0	5.2e-12
WP_169829615.1|3515111_3515279_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RWZ4	Clostridium_phage	52.9	1.9e-07
WP_152025096.1|3515328_3515970_-	DUF3862 domain-containing protein	NA	U5J9H5	Bacillus_phage	53.2	2.3e-16
WP_071613806.1|3516118_3516670_-	hypothetical protein	NA	D9ZNF4	Clostridium_phage	35.4	5.6e-11
WP_071613807.1|3516710_3517697_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8SBN4	Clostridium_phage	50.3	1.1e-36
WP_071613808.1|3517696_3518101_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	50.7	3.6e-31
WP_071613809.1|3518389_3518788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169829547.1|3518759_3518906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613810.1|3518958_3519471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613811.1|3519827_3520829_-	acyltransferase family protein	NA	S5FNR8	Shigella_phage	34.1	1.7e-05
WP_071613812.1|3520930_3523663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613813.1|3523690_3523939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613814.1|3523954_3525679_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	29.7	3.2e-36
WP_071613815.1|3525678_3526383_-|tail	phage tail family protein	tail	C5IUK4	Streptococcus_phage	27.1	4.9e-12
WP_071613816.1|3526383_3530385_-	hypothetical protein	NA	A8ATH6	Listeria_phage	42.3	6.2e-35
WP_071613817.1|3530658_3531006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169829616.1|3531042_3531879_-	hypothetical protein	NA	F6K8R6	Clostridium_phage	56.5	2.0e-15
WP_071613818.1|3531892_3532207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613819.1|3532193_3532592_-	hypothetical protein	NA	A0A1S5SFC4	Streptococcus_phage	36.1	2.9e-09
WP_071613820.1|3532588_3532918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613821.1|3532914_3533226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615022.1|3533241_3534432_-|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	40.3	7.2e-72
WP_071613822.1|3534437_3535184_-|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	44.6	1.0e-36
WP_152025097.1|3535202_3536372_-|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	37.5	1.1e-61
WP_071613824.1|3536449_3536935_-	hypothetical protein	NA	A0A0K2CP90	Brevibacillus_phage	31.4	9.0e-05
WP_071613825.1|3536983_3538654_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	40.5	1.1e-107
WP_071613826.1|3538637_3538943_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_071613827.1|3539138_3539510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613828.1|3539514_3539826_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	35.6	7.7e-10
WP_071613829.1|3539825_3540350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613830.1|3540519_3541002_-	Xaa-His dipeptidase	NA	NA	NA	NA	NA
WP_071613831.1|3541275_3541914_-|integrase	tyrosine-type recombinase/integrase	integrase	F6K8Q2	Clostridium_phage	41.9	3.8e-27
WP_071613832.1|3542125_3542572_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_071613833.1|3542706_3542937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613834.1|3542973_3543216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613835.1|3543251_3543539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613836.1|3543572_3543800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613837.1|3543885_3544287_-	single-stranded DNA-binding protein	NA	A0A0A8WIG9	Clostridium_phage	46.8	2.4e-27
WP_071613838.1|3544283_3544469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613839.1|3544468_3544825_-	hypothetical protein	NA	A0A2K9V381	Faecalibacterium_phage	65.4	3.0e-34
WP_071613840.1|3544818_3544998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615023.1|3545171_3545924_-	ATP-binding protein	NA	M9Q1J4	Clostridium_phage	46.2	8.3e-50
WP_071613841.1|3545874_3546669_-	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SAV1	Streptococcus_phage	49.6	3.4e-33
WP_071613842.1|3546702_3547266_-	hypothetical protein	NA	Q332D2	Clostridium_botulinum_C_phage	51.4	1.0e-44
WP_071613843.1|3547342_3547567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613844.1|3547566_3547752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613845.1|3547741_3547957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613846.1|3547958_3549119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613847.1|3549347_3549536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071613848.1|3549706_3550210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152025098.1|3550209_3550689_-	hypothetical protein	NA	A0A0A7RVQ9	Clostridium_phage	58.4	3.4e-41
3553311:3553331	attR	AATCTTACAATTCTGTAAGAT	NA	NA	NA	NA
