The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	560601	569046	4780676		Escherichia_phage(50.0%)	8	NA	NA
WP_071547662.1|560601_563022_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.9	4.8e-139
WP_042848441.1|563018_563657_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.8	1.9e-63
WP_042848439.1|563653_564553_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_042848437.1|564590_565157_+	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	31.3	2.7e-16
WP_042848436.1|565382_565805_+	DoxX family protein	NA	NA	NA	NA	NA
WP_071547664.1|565892_566687_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	41.7	3.0e-42
WP_071547665.1|566698_567925_-	RtcB family protein	NA	A0A1V0EEW8	Caulobacter_phage	62.9	9.5e-136
WP_042848432.1|567927_569046_-	slipin family protein	NA	A0A2P1EMF1	Moumouvirus	28.1	1.3e-14
>prophage 2
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	1178447	1189046	4780676		Mycobacterium_phage(25.0%)	11	NA	NA
WP_042848391.1|1178447_1179647_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.5	4.5e-29
WP_042848390.1|1180374_1181346_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.2	1.3e-132
WP_071547823.1|1181360_1183493_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	1.4e-206
WP_042848388.1|1183505_1183919_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	33.6	2.9e-12
WP_042848387.1|1183927_1184155_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.2	1.4e-16
WP_042848385.1|1184442_1184901_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2K9L300	Tupanvirus	46.6	6.0e-19
WP_014657708.1|1185118_1185328_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_042848383.1|1185484_1186450_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_071547824.1|1186574_1187204_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_042848378.1|1187435_1187699_-	YbeD family protein	NA	NA	NA	NA	NA
WP_071547825.1|1187834_1189046_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.9	5.9e-106
>prophage 3
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	1324348	1374487	4780676	tRNA,lysis,protease,integrase	Bacillus_phage(11.11%)	46	1323546:1323561	1386945:1386960
1323546:1323561	attL	TATTCATGGTAATAAA	NA	NA	NA	NA
WP_042846592.1|1324348_1325290_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_042846591.1|1325448_1325697_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_042846590.1|1325788_1326628_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_164975526.1|1326665_1326827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042846589.1|1327076_1329185_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.7	2.3e-52
WP_042846588.1|1329333_1329837_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YTY5	Streptomyces_phage	32.2	2.4e-08
WP_042846587.1|1330163_1331051_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_042846586.1|1331361_1331937_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.7	4.8e-21
WP_042846585.1|1331970_1332429_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042846584.1|1332679_1334278_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.2	1.4e-59
WP_042846644.1|1334388_1334724_-	phnA family protein	NA	NA	NA	NA	NA
WP_048606504.1|1334910_1335669_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_042846582.1|1335668_1336910_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_094301199.1|1337261_1338353_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_042846580.1|1338554_1339214_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	56.3	6.8e-56
WP_071547849.1|1339217_1340360_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_042846578.1|1340401_1341106_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_071547850.1|1341474_1342170_+	carbohydrate-binding family 9-like protein	NA	NA	NA	NA	NA
WP_042846576.1|1342346_1343264_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_071547851.1|1343325_1344687_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_042846574.1|1344702_1345548_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042846573.1|1345547_1346330_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_071547852.1|1346347_1347235_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_071547854.1|1347789_1348254_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071547855.1|1348338_1348779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547856.1|1348882_1349389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547857.1|1349942_1350344_-	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_071547858.1|1350438_1350981_-	DinB family protein	NA	NA	NA	NA	NA
WP_071547859.1|1351105_1352329_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_071547860.1|1352509_1352983_-	trimethoprim-resistant dihydrofolate reductase DfrA	NA	A0A1B2IBQ4	Erwinia_phage	33.7	3.4e-17
WP_008169685.1|1353344_1354313_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	37.9	1.9e-54
WP_071547861.1|1354492_1356667_-	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	26.1	1.7e-47
WP_071547862.1|1356659_1357100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547863.1|1357092_1357761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547864.1|1357757_1360379_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_071547865.1|1360375_1361848_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071547866.1|1362000_1363698_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_042846570.1|1364126_1364750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547867.1|1364809_1365502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547869.1|1366707_1367595_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_042846566.1|1367799_1368495_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_042846565.1|1368494_1368962_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_042846564.1|1369106_1371134_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.8	1.8e-54
WP_042846563.1|1371472_1372585_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_042846562.1|1372868_1373429_+	LemA family protein	NA	NA	NA	NA	NA
WP_042846560.1|1373530_1374487_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
1386945:1386960	attR	TTTATTACCATGAATA	NA	NA	NA	NA
>prophage 4
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	1915293	1950642	4780676	transposase,integrase	Escherichia_phage(35.71%)	33	1908546:1908559	1947871:1947886
1908546:1908559	attL	AGCTTAAAGCCATG	NA	NA	NA	NA
WP_048821757.1|1915293_1916247_-|integrase	site-specific integrase	integrase	A0A1L4BKH1	Thermus_phage	29.5	7.7e-08
1908546:1908559	attL	AGCTTAAAGCCATG	NA	NA	NA	NA
WP_158516022.1|1916646_1916820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547991.1|1916859_1917114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|1917677_1918382_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|1918872_1919733_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_004235553.1|1920157_1921090_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_000812657.1|1921613_1922879_+|transposase	IS4-like element ISPa12 family transposase	transposase	NA	NA	NA	NA
WP_011751353.1|1923158_1923800_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	6.6e-56
WP_004235553.1|1923999_1924932_+|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_122037036.1|1925057_1925345_-	hypothetical protein	NA	A0A1W6JNS2	Morganella_phage	47.0	5.5e-10
WP_004197545.1|1925440_1925713_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|1925837_1926597_+|transposase	IS5-like element ISKpn12 family transposase	transposase	NA	NA	NA	NA
WP_004197549.1|1927489_1927675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832797.1|1927740_1928879_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.7	1.0e-19
WP_000587836.1|1928931_1929225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557452.1|1929237_1930098_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_000027057.1|1930239_1931100_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|1931282_1931840_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_071547993.1|1932003_1935012_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_002026779.1|1935845_1936031_+	hypothetical protein	NA	NA	NA	NA	NA
1935342:1935355	attR	CATGGCTTTAAGCT	NA	NA	NA	NA
WP_077252464.1|1936250_1936532_+	hypothetical protein	NA	NA	NA	NA	NA
1935342:1935355	attR	CATGGCTTTAAGCT	NA	NA	NA	NA
WP_000359986.1|1936512_1937286_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|1938610_1939315_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|1939512_1941054_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|1941458_1942298_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1942291_1942639_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000470556.1|1942743_1943034_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001007673.1|1943094_1943922_-	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_032488579.1|1944003_1944558_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845054.1|1944707_1945721_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001162012.1|1946026_1946584_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|1946586_1949559_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427623.1|1949637_1950642_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	2094611	2102064	4780676		Tupanvirus(33.33%)	7	NA	NA
WP_004263721.1|2094611_2094908_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_042844064.1|2094984_2095923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048606996.1|2096038_2097040_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.4	6.2e-16
WP_042844062.1|2097045_2097813_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	28.4	3.4e-06
WP_042844061.1|2097941_2099087_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	27.4	8.0e-36
WP_042844059.1|2099086_2100079_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.4	4.3e-38
WP_042844058.1|2100078_2102064_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.3	1.9e-21
>prophage 6
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	3152518	3168024	4780676	tail,lysis,plate	Burkholderia_phage(28.57%)	21	NA	NA
WP_071548251.1|3152518_3153766_-|tail	phage tail protein	tail	E5AGC6	Erwinia_phage	40.4	8.5e-15
WP_071548252.1|3153771_3154431_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.5	2.9e-38
WP_071548253.1|3154427_3155615_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.7	1.7e-73
WP_071548254.1|3155607_3155952_-	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	35.7	1.8e-12
WP_071548255.1|3155948_3156641_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	39.7	5.2e-30
WP_071548256.1|3156644_3157460_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	37.5	2.3e-45
WP_071548257.1|3157452_3157749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548258.1|3157748_3158279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548259.1|3158275_3160339_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.3	2.5e-19
WP_071548260.1|3160403_3161090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548261.1|3161237_3161696_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.2	2.0e-22
WP_071548262.1|3161747_3162200_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	39.6	2.3e-23
WP_071548263.1|3162210_3163698_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	7.3e-82
WP_081363958.1|3163708_3164152_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_167363357.1|3164160_3164334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048607794.1|3164315_3164786_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.9	1.9e-47
WP_042844233.1|3164785_3165055_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	66.7	2.5e-25
WP_042844957.1|3165162_3165669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042844959.1|3165990_3166497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048607795.1|3166747_3167551_-	antitermination protein	NA	F1C595	Cronobacter_phage	43.6	1.4e-55
WP_042844962.1|3167562_3168024_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	38.3	6.5e-29
>prophage 7
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	3458738	3548643	4780676	coat,capsid,tail,portal,integrase,transposase,head,lysis,terminase	Morganella_phage(16.25%)	125	3466577:3466623	3547520:3547566
WP_081363963.1|3458738_3458957_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.8	2.1e-06
WP_071548327.1|3459087_3459408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548328.1|3459392_3459713_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_071548329.1|3459942_3460230_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	77.3	1.3e-32
WP_036960459.1|3460972_3461161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548330.1|3461816_3462122_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071548331.1|3462266_3462938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548332.1|3462950_3463208_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_071548333.1|3463636_3464053_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	83.2	1.7e-60
WP_071548334.1|3464112_3464793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548335.1|3464859_3465432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158516030.1|3465577_3465742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081363964.1|3465909_3466413_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	E5AGD0	Erwinia_phage	47.8	1.6e-36
3466577:3466623	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_071548336.1|3469243_3470104_-	phage antirepressor Ant	NA	I6S627	Salmonella_phage	48.1	1.2e-73
WP_071548337.1|3470109_3470319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548338.1|3470315_3470471_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071548339.1|3470578_3470830_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	42.7	2.5e-06
WP_094301217.1|3471219_3471699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548341.1|3471709_3474049_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	40.3	2.1e-22
WP_094301236.1|3475430_3476129_-	DNA transfer protein	NA	A0A2H5BFK5	Salmonella_phage	67.2	4.5e-58
WP_071548347.1|3476146_3476596_-	DUF2824 family protein	NA	G5DA79	Enterobacteria_phage	83.8	5.1e-71
WP_158516031.1|3476603_3477326_-|tail	phage tail protein	tail	B6SCW1	Bacteriophage	31.8	4.1e-22
WP_094301237.1|3477322_3478378_-	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	69.6	5.8e-150
WP_071548351.1|3479087_3479585_-	packaged DNA stabilization gp4 family protein	NA	A0A2D1GLR5	Escherichia_phage	63.8	1.8e-48
WP_071548352.1|3479562_3479772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548353.1|3479826_3481110_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	66.7	7.8e-165
WP_071548355.1|3481109_3482024_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	63.2	7.7e-98
WP_071548356.1|3482038_3484129_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	65.3	2.4e-235
WP_071548358.1|3484131_3485574_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	75.6	2.1e-222
WP_071548360.1|3485554_3486043_-|terminase	terminase small subunit	terminase	A0A088C409	Shewanella_sp._phage	48.0	7.1e-26
WP_071548362.1|3486126_3486324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548364.1|3486410_3486638_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	48.6	1.9e-10
WP_071548367.1|3486755_3487124_-	hypothetical protein	NA	A0AR14	Salmonella_phage	74.4	7.4e-44
WP_071548369.1|3487350_3487800_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	42.4	2.4e-12
WP_071548371.1|3487801_3488284_-	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	76.3	1.4e-66
WP_071548373.1|3488270_3488549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548375.1|3488545_3488959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548379.1|3489386_3489962_-	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	75.3	7.2e-78
WP_071548381.1|3490323_3490935_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.6	7.3e-44
WP_071548383.1|3490931_3491123_-	hypothetical protein	NA	A0A088CC23	Shigella_phage	56.6	2.0e-08
WP_071548385.1|3491112_3491478_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	66.9	5.8e-41
WP_071548387.1|3491474_3491765_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	75.0	6.5e-35
WP_071548388.1|3491864_3492308_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	87.7	1.5e-30
WP_071548390.1|3492309_3492594_-	hypothetical protein	NA	E5AGF1	Erwinia_phage	52.2	3.1e-21
WP_081363967.1|3492586_3492811_-	Lar family restriction alleviation protein	NA	A0A2I7RLZ1	Vibrio_phage	52.6	1.2e-15
WP_158516032.1|3492807_3493047_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_158516033.1|3493033_3493285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548396.1|3493271_3493499_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071548398.1|3493498_3493891_-	ASCH domain-containing protein	NA	A0A1S6L2Y8	Erwinia_phage	49.6	4.2e-29
WP_071548400.1|3493916_3495287_-	replicative DNA helicase	NA	K7P852	Enterobacteria_phage	66.2	8.1e-168
WP_071548402.1|3495286_3496120_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	57.6	4.9e-83
WP_036978872.1|3496305_3496623_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	50.0	8.1e-23
WP_071548404.1|3496802_3497030_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	69.3	7.6e-23
WP_071548406.1|3497138_3497831_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	50.3	5.3e-43
WP_071548408.1|3498373_3498565_+	hypothetical protein	NA	G5DMM6	Enterobacter_virus	44.3	8.4e-07
WP_145927305.1|3498862_3499102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548412.1|3499131_3499353_+	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	50.0	1.1e-07
WP_071548413.1|3499354_3499720_+	hypothetical protein	NA	A0A1P8DTE8	Proteus_phage	30.7	6.8e-05
WP_071548415.1|3499784_3500726_+	hypothetical protein	NA	A0A2I7QK72	Vibrio_phage	47.3	3.0e-20
WP_167363358.1|3500931_3501108_+	hypothetical protein	NA	A0A1P8DTG5	Proteus_phage	84.2	6.7e-19
WP_071548419.1|3501118_3501592_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	74.2	1.2e-67
WP_071548421.1|3501733_3502087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548423.1|3502102_3502975_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	1.6e-60
WP_071548425.1|3502975_3503446_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	61.1	3.5e-46
WP_071548427.1|3503458_3504013_+	hypothetical protein	NA	A0A2I7QTL0	Vibrio_phage	37.9	2.1e-29
WP_145927306.1|3504090_3504426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548429.1|3504701_3505022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548431.1|3505021_3505351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548433.1|3505690_3505918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548435.1|3505904_3506537_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.3	1.9e-63
WP_071548438.1|3506988_3508146_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.8	6.4e-174
WP_071548440.1|3508377_3509601_+|integrase	site-specific integrase	integrase	V5YSU2	Pseudomonas_phage	30.8	2.2e-36
WP_071548442.1|3511170_3515481_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.3	1.1e-191
WP_071548444.1|3515481_3515880_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	51.5	2.1e-36
WP_145927307.1|3515969_3516809_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	38.7	1.4e-05
WP_071548448.1|3516915_3517497_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	47.9	1.2e-48
WP_071548450.1|3517496_3518093_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.6	2.3e-55
WP_071548452.1|3518095_3521200_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	32.0	7.7e-65
WP_071548453.1|3521232_3521457_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_071548455.1|3521513_3521906_-	hypothetical protein	NA	A0A1W6JP08	Morganella_phage	46.6	2.0e-23
WP_071548457.1|3521905_3522391_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	74.0	2.3e-56
WP_071548459.1|3522451_3522787_-	DUF3168 domain-containing protein	NA	A0A1W6JP05	Morganella_phage	58.2	8.0e-29
WP_071548461.1|3522783_3523233_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	65.5	2.6e-46
WP_071548463.1|3523225_3523552_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	77.1	4.4e-40
WP_071548465.1|3523561_3523888_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	76.9	1.1e-41
WP_071548467.1|3524182_3525397_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	82.9	4.8e-188
WP_071548469.1|3526267_3527605_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	75.8	5.6e-198
WP_071548470.1|3527605_3529348_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	5.1e-143
WP_071548472.1|3529301_3529769_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.0	1.2e-43
WP_071548474.1|3529892_3530105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548476.1|3530106_3530460_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	66.1	4.1e-39
WP_145927308.1|3530441_3531080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548480.1|3531540_3531729_-	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	85.2	1.2e-21
WP_071548482.1|3531800_3532175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141240661.1|3532185_3532467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158516034.1|3532732_3533122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548488.1|3533106_3533463_-	DUF882 domain-containing protein	NA	A0A0G2SSI0	Proteus_phage	62.3	3.6e-35
WP_071548490.1|3533459_3533828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548492.1|3533827_3534241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548494.1|3534393_3534612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548496.1|3534598_3534985_-	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_081363969.1|3535002_3535317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548497.1|3535888_3536287_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	48.3	1.9e-29
WP_071548499.1|3536318_3536858_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	50.9	3.1e-46
WP_071548501.1|3536854_3537241_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	51.7	1.8e-24
WP_071548503.1|3537597_3538065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048608715.1|3538066_3538705_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	65.6	2.2e-83
WP_071548868.1|3538704_3538950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548504.1|3538949_3540011_-	conserved phage C-terminal domain-containing protein	NA	A0A248SL49	Klebsiella_phage	48.6	8.5e-32
WP_071548505.1|3540020_3540200_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_071548507.1|3540482_3540941_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	64.0	1.5e-49
WP_071548508.1|3540998_3541184_-	cell division protein	NA	NA	NA	NA	NA
WP_071548509.1|3541286_3541919_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	42.1	1.2e-38
WP_071548510.1|3542017_3542227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548511.1|3542256_3542502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548869.1|3542476_3542710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548870.1|3542818_3543007_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	70.6	9.1e-14
WP_071548512.1|3543159_3544062_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	51.5	1.6e-79
WP_071548513.1|3544144_3544921_+	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	38.3	4.4e-38
WP_081363970.1|3544935_3545406_+	hypothetical protein	NA	A0A1W6JPA7	Morganella_phage	57.1	3.2e-47
WP_071548515.1|3545408_3546080_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	52.4	4.1e-64
WP_071548516.1|3546082_3546631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548517.1|3546620_3547193_+	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	58.4	1.2e-51
WP_071548518.1|3547229_3547445_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071548519.1|3547785_3548643_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.8	5.8e-31
3547520:3547566	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP017671	Providencia rettgeri strain RB151 chromosome, complete genome	4780676	4588361	4703585	4780676	tRNA,protease,capsid,tail,plate,holin,portal,head,integrase,terminase	Salmonella_phage(43.59%)	111	4649315:4649358	4682473:4682516
WP_071548717.1|4588361_4589459_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_042846651.1|4589518_4589908_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_042846652.1|4589920_4590577_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_042846653.1|4591008_4592406_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_042846654.1|4592485_4593391_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_042846655.1|4595062_4595410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548718.1|4595474_4596851_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_042846657.1|4597013_4598234_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_042846658.1|4598278_4599055_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_071548719.1|4599069_4600074_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_042846660.1|4600176_4601340_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_042846661.1|4601578_4602463_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_042846662.1|4602526_4603591_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_042846663.1|4604209_4605610_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_042846664.1|4605721_4607272_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_042846665.1|4607343_4609983_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_155405705.1|4609951_4610095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042846666.1|4610385_4612827_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_042846667.1|4612839_4614000_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004265315.1|4614315_4614633_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_071548720.1|4614917_4615661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048605758.1|4615898_4616636_+	porin family protein	NA	NA	NA	NA	NA
WP_004265313.1|4616703_4616919_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_042846670.1|4617138_4619337_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_042846671.1|4619608_4620637_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_042846672.1|4620966_4621776_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004265304.1|4621944_4622475_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_042846673.1|4622486_4623821_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	27.7	1.3e-42
WP_042846674.1|4624145_4625066_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_042846675.1|4625186_4625711_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_042846676.1|4626043_4626283_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_042846677.1|4626587_4627448_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.9	3.0e-19
WP_042846678.1|4627451_4628978_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_071548721.1|4629263_4630730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548722.1|4631131_4633714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048605741.1|4633797_4634982_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	26.7	1.2e-13
WP_042846681.1|4635430_4636177_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_042846682.1|4636266_4636686_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_048605756.1|4636737_4637352_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_042846683.1|4637530_4638301_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_071548723.1|4638726_4639671_+	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_071548724.1|4640096_4641977_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_042846686.1|4642085_4643042_+	OmpG family monomeric porin	NA	NA	NA	NA	NA
WP_165568272.1|4643200_4644181_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042846688.1|4644452_4645430_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_042846689.1|4645834_4646779_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_071548725.1|4646775_4647417_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_042846691.1|4647647_4648400_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_042846692.1|4648628_4649210_-	HutD family protein	NA	NA	NA	NA	NA
4649315:4649358	attL	AAAAAAAAGCCCCTAACAGGGGCTATAAAAGACAGGGATGGTGT	NA	NA	NA	NA
WP_071548726.1|4649526_4650297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071548727.1|4650328_4650547_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.3	4.0e-21
WP_071548728.1|4650618_4651716_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	59.2	2.5e-119
WP_071548729.1|4651712_4652159_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.4	3.8e-42
WP_071548730.1|4652161_4654987_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.9	7.8e-117
WP_036962273.1|4654979_4655099_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	7.2e-09
WP_036962040.1|4655113_4655422_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.5	2.9e-17
WP_071548731.1|4655431_4655947_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	57.6	4.4e-50
WP_071548732.1|4655949_4657122_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	72.9	9.0e-168
WP_081363991.1|4657936_4658260_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_145927311.1|4658404_4658974_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	68.0	2.8e-21
WP_048606836.1|4660571_4661183_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	65.3	6.7e-74
WP_071548735.1|4661175_4662087_-|plate	baseplate J/gp47 family protein	plate	F1BUP3	Erwinia_phage	65.1	6.5e-105
WP_036962053.1|4662089_4662431_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	61.3	8.7e-31
WP_071548736.1|4662427_4663051_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	53.2	1.3e-51
WP_071548737.1|4663057_4663438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548738.1|4663526_4664144_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	38.8	2.4e-31
WP_036962064.1|4664140_4664569_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	44.1	6.9e-25
WP_071548888.1|4664552_4665104_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_036962066.1|4665146_4665590_-	structural protein	NA	A0A0D4DAE2	Escherichia_phage	44.2	7.6e-27
WP_036962068.1|4665582_4665888_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	56.3	2.1e-23
WP_071548739.1|4665891_4666095_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	56.7	1.0e-15
WP_071548740.1|4666091_4666568_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.7	7.7e-25
WP_081363977.1|4666656_4667289_-	hypothetical protein	NA	A0A077K804	Ralstonia_phage	41.9	1.7e-35
WP_071548742.1|4667316_4668411_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	61.7	6.5e-120
WP_071548743.1|4668423_4669251_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	46.7	3.6e-54
WP_071548744.1|4669426_4671184_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	75.5	2.6e-272
WP_071548745.1|4671183_4672221_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	70.7	6.8e-143
WP_071548746.1|4672807_4673722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548747.1|4673734_4674382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548748.1|4674414_4675197_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_071548749.1|4675432_4677841_-	replication endonuclease	NA	M1SV59	Escherichia_phage	47.7	2.8e-163
WP_071548750.1|4677833_4678157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548751.1|4678156_4678981_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	46.6	1.2e-60
WP_081363978.1|4678973_4679276_-	DUF3850 domain-containing protein	NA	A0A2P0W9X8	Enterobacter_phage	39.4	2.3e-06
WP_071548753.1|4679272_4679494_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	47.9	1.1e-10
WP_071548754.1|4679486_4679798_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071548755.1|4679815_4680247_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_071548757.1|4680385_4680598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071548758.1|4680599_4680890_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	65.6	6.1e-33
WP_071548759.1|4681012_4681312_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	56.6	9.4e-21
WP_071548760.1|4681378_4682350_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	66.9	5.6e-123
WP_071548761.1|4682607_4683183_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
4682473:4682516	attR	AAAAAAAAGCCCCTAACAGGGGCTATAAAAGACAGGGATGGTGT	NA	NA	NA	NA
WP_042846693.1|4683333_4684032_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	4.0e-06
WP_042846694.1|4684028_4685399_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.0	4.3e-20
WP_052219352.1|4685881_4687321_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_071548762.1|4687928_4688918_+	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071548763.1|4688920_4690729_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_071548764.1|4690729_4691119_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071548765.1|4691120_4691525_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_081363979.1|4691461_4692349_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_071548767.1|4692341_4693172_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	52.9	7.1e-10
WP_081363980.1|4693186_4694299_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_158516037.1|4694371_4695337_+	EpsG family protein	NA	NA	NA	NA	NA
WP_071548770.1|4695377_4696337_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071548771.1|4696351_4697176_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071548772.1|4697185_4698133_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A223FN07	Murmansk_poxvirus	24.2	2.9e-07
WP_071548773.1|4698180_4699326_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_071548774.1|4699331_4699760_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_071548775.1|4699792_4701874_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_071548776.1|4701891_4702917_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.5	1.2e-86
WP_042846710.1|4703081_4703585_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP017672	Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence	108417	37516	46452	108417	holin,transposase	uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_081364008.1|37516_40543_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.5	1.1e-34
WP_071548982.1|40733_41351_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	27.6	5.3e-10
WP_071548920.1|41520_43518_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.7	1.1e-21
WP_071548921.1|43589_44447_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.8	7.8e-44
WP_071548922.1|44449_45928_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.4	1.3e-195
WP_081363998.1|46212_46452_-	hypothetical protein	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	56.7	2.3e-17
