The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	1035095	1077475	4878509	portal,terminase,tail,head,integrase,lysis,plate,capsid,tRNA	Erwinia_phage(38.1%)	49	1029620:1029639	1084493:1084512
1029620:1029639	attL	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
WP_032618958.1|1035095_1036655_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	9.6e-08
WP_017382401.1|1036651_1037146_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017692642.1|1037291_1038056_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_017692643.1|1038056_1039226_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032618959.1|1039582_1040599_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	95.0	8.6e-191
WP_080288393.1|1040598_1041171_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	74.1	1.8e-76
WP_032618960.1|1041295_1041559_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	93.1	5.0e-42
WP_032618962.1|1041589_1042099_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	91.7	8.6e-83
WP_071842907.1|1042106_1042307_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	1.3e-29
WP_032618963.1|1042270_1042609_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	3.6e-53
WP_032618964.1|1042675_1042903_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	70.1	4.8e-17
WP_032618966.1|1042902_1043124_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	94.4	1.1e-31
WP_032618967.1|1043110_1045339_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	89.6	0.0e+00
WP_032665232.1|1045461_1045659_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	71.4	1.5e-11
WP_032618969.1|1045783_1046833_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.9	5.7e-105
WP_032618970.1|1046876_1048835_-	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	NA	NA	NA	NA	NA
WP_047715938.1|1049261_1050287_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.7	7.9e-168
WP_032618972.1|1050288_1052058_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.2	6.1e-301
WP_032618973.1|1052223_1053078_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	73.6	1.9e-114
WP_047715936.1|1053133_1054189_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.8	3.8e-165
WP_032618975.1|1054192_1054948_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	64.5	9.8e-75
WP_023295250.1|1055047_1055554_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.0	4.4e-63
WP_017382979.1|1055553_1055757_+|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032618977.1|1055747_1055969_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_023295248.1|1055952_1056465_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	1.0e-83
WP_032618978.1|1056461_1056893_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	78.3	2.8e-58
WP_032618979.1|1056892_1057309_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	2.1e-42
WP_032618981.1|1057404_1057872_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	68.4	2.3e-58
WP_032618983.1|1057864_1058314_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.8	4.7e-48
WP_032618984.1|1058382_1059018_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	86.7	8.2e-99
WP_032618985.1|1059014_1059365_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	71.6	6.2e-40
WP_032618987.1|1059370_1060279_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	83.1	3.0e-134
WP_032620226.1|1060271_1060802_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	2.4e-91
WP_044489085.1|1060813_1063162_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	49.2	3.0e-114
WP_032618988.1|1063163_1063595_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	41.1	7.0e-17
WP_023323582.1|1063969_1065163_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	2.4e-184
WP_017382996.1|1065175_1065694_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032618991.1|1065751_1066075_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_032665230.1|1066107_1066230_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	7.7e-14
WP_032618993.1|1066219_1068670_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.1	9.3e-308
WP_032618994.1|1068680_1069145_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	2.1e-59
WP_032618995.1|1069141_1070311_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	77.5	2.5e-170
WP_063132245.1|1070376_1070595_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	5.4e-34
WP_032618996.1|1070617_1071265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384024.1|1071544_1072051_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015571912.1|1072151_1073996_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032618997.1|1074148_1075894_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|1076009_1076225_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015571911.1|1076461_1077475_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
1084493:1084512	attR	TTCCCCCGAGCGCGATACCG	NA	NA	NA	NA
>prophage 2
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	1135413	1171921	4878509	transposase,integrase	Stx2-converting_phage(20.0%)	26	1124405:1124419	1137357:1137371
1124405:1124419	attL	TTTCCAGAACGTCCC	NA	NA	NA	NA
WP_007897923.1|1135413_1136661_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007897920.1|1136647_1138414_+	hypothetical protein	NA	NA	NA	NA	NA
1137357:1137371	attR	GGGACGTTCTGGAAA	NA	NA	NA	NA
WP_017384059.1|1138401_1140519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017384060.1|1140522_1140951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|1141041_1142188_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_000019450.1|1142472_1143453_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_017384068.1|1143723_1144857_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_003846919.1|1145711_1145882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003846917.1|1145938_1147192_-	lactose permease	NA	NA	NA	NA	NA
WP_007894989.1|1147243_1150318_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_007851507.1|1150439_1151522_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_032435706.1|1151891_1152884_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|1153287_1154292_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_007898884.1|1154553_1154832_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898888.1|1155162_1155456_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_004152282.1|1155554_1156322_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|1156322_1157279_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004118243.1|1157275_1158274_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_007898890.1|1158270_1159173_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_022652364.1|1159217_1161542_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023304425.1|1161628_1162582_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_016151347.1|1162578_1163100_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_007896426.1|1164343_1165669_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
WP_022649395.1|1165822_1166791_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_016151369.1|1168954_1169305_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	9.6e-41
WP_000227969.1|1170844_1171921_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	1550333	1581789	4878509	transposase,protease,integrase	Salmonella_phage(16.67%)	25	1547425:1547444	1587678:1587697
1547425:1547444	attL	AATGTAGGCCGGGTAAGGCG	NA	NA	NA	NA
WP_080288382.1|1550333_1551302_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	5.1e-185
WP_032619181.1|1551366_1553964_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_032619182.1|1553974_1556044_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_071842894.1|1556158_1556785_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001618770.1|1556915_1558331_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001618769.1|1558457_1558670_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	4.2e-07
WP_001618768.1|1558795_1559674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|1560124_1561272_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_001067212.1|1562705_1563551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795663.1|1563831_1564038_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
WP_032619186.1|1564653_1565856_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032619187.1|1565848_1567153_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032619190.1|1567149_1569024_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001625709.1|1569038_1569425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619191.1|1569521_1569947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619193.1|1569983_1570298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619194.1|1570317_1570704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619196.1|1571234_1572425_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032620260.1|1572393_1572771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619198.1|1572947_1574309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047685188.1|1575036_1575243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128302277.1|1575246_1576149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050019407.1|1576470_1578606_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_080288391.1|1578639_1580361_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	22.9	9.6e-17
WP_032619204.1|1580517_1581789_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	90.5	1.4e-214
1587678:1587697	attR	CGCCTTACCCGGCCTACATT	NA	NA	NA	NA
>prophage 4
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	1628973	1653463	4878509	transposase,integrase	Enterobacteria_phage(36.84%)	28	1617302:1617317	1644068:1644083
1617302:1617317	attL	ACCGCATCGCGCAGTT	NA	NA	NA	NA
WP_006176728.1|1628973_1629549_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_015572138.1|1629580_1630231_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_023304255.1|1630230_1631184_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_006811609.1|1631180_1631657_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_006811608.1|1632088_1633318_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_022651668.1|1633295_1633580_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_017692869.1|1633626_1633869_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	7.8e-34
WP_032619244.1|1633855_1634467_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.8e-42
WP_022651666.1|1634501_1635587_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	9.1e-106
WP_032619246.1|1635596_1638656_-	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	67.5	0.0e+00
WP_022651664.1|1638778_1639066_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	5.4e-34
WP_022651662.1|1639317_1639503_-	YebW family protein	NA	NA	NA	NA	NA
WP_032619247.1|1639622_1639808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693529.1|1639999_1640413_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.2e-07
WP_032619249.1|1640766_1641309_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	55.6	4.3e-48
WP_032619250.1|1641744_1642737_+	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032619251.1|1642720_1643413_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	60.9	2.4e-80
WP_032619252.1|1643424_1644156_+	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
1644068:1644083	attR	AACTGCGCGATGCGGT	NA	NA	NA	NA
WP_032619253.1|1644142_1644403_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	62.5	7.9e-24
WP_032619254.1|1644399_1644879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619256.1|1644880_1645138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044489041.1|1645134_1647210_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	1.6e-199
WP_032619258.1|1647257_1648016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619259.1|1648279_1648513_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	79.2	1.2e-28
WP_032619262.1|1648919_1649519_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	2.9e-98
WP_155858305.1|1649727_1649880_+	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	100.0	4.4e-19
WP_085949497.1|1649881_1651029_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
WP_003860714.1|1651657_1653463_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
>prophage 5
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	2117210	2128023	4878509		Hokovirus(12.5%)	9	NA	NA
WP_032619353.1|2117210_2118629_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	8.9e-61
WP_032619354.1|2118738_2120109_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.0e-33
WP_032619355.1|2120274_2121681_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	4.7e-38
WP_032619357.1|2121770_2122856_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	8.2e-99
WP_017693099.1|2122856_2123738_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	9.0e-104
WP_032619358.1|2123976_2125143_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	7.0e-112
WP_032619359.1|2125192_2126197_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	1.9e-33
WP_032619360.1|2126391_2127372_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_017693103.1|2127411_2128023_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
>prophage 6
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	2227910	2307956	4878509	terminase,portal,tail,protease,holin,integrase,plate,coat	Enterobacteria_phage(14.29%)	90	2221626:2221641	2240850:2240865
2221626:2221641	attL	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619465.1|2227910_2228924_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	69.0	5.6e-134
WP_032619466.1|2228923_2229145_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.9	1.8e-08
WP_032619467.1|2229204_2229447_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	50.0	4.2e-11
WP_032619468.1|2229433_2231338_-	hypothetical protein	NA	K7P6V4	Enterobacteria_phage	29.8	7.3e-18
WP_032619469.1|2231560_2231833_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	44.2	2.7e-14
WP_155858306.1|2232219_2232390_-	hypothetical protein	NA	A0A1I9SEJ3	Klebsiella_phage	50.9	4.7e-09
WP_032619471.1|2232675_2233167_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	55.0	1.4e-16
WP_032619472.1|2233239_2233509_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	38.7	2.2e-08
WP_032620290.1|2233508_2233961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619473.1|2233983_2234901_+	hypothetical protein	NA	U5P0A0	Shigella_phage	40.0	2.4e-51
WP_032619474.1|2234903_2235644_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.3	1.1e-99
WP_032619475.1|2235661_2236318_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.9	3.2e-13
WP_032619476.1|2236513_2236747_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	46.2	2.8e-12
WP_032620293.1|2237277_2237631_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	92.5	5.4e-52
WP_032619477.1|2237816_2238140_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	7.0e-30
WP_032619479.1|2238625_2238922_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	59.1	2.6e-23
WP_032619481.1|2240730_2241087_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	59.3	9.1e-39
2240850:2240865	attR	CATTCAGGTGCCGGAG	NA	NA	NA	NA
WP_032619482.1|2241083_2241689_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	1.2e-75
WP_032619483.1|2242027_2242432_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_044489029.1|2242428_2242725_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	33.8	5.5e-05
WP_032619484.1|2242721_2243351_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	5.1e-101
WP_032620296.1|2243358_2243634_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.9	1.6e-22
WP_032619486.1|2243759_2244017_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.3	1.6e-16
WP_020690713.1|2244165_2244369_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_032619487.1|2244441_2244669_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	71.7	2.1e-17
WP_032619488.1|2244857_2245118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619489.1|2245393_2245897_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_032619490.1|2245900_2248021_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	9.2e-304
WP_023299859.1|2248017_2248233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619491.1|2248241_2249762_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.3e-153
WP_103848174.1|2249754_2251812_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.2	4.6e-199
WP_032619492.1|2251880_2252216_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023303463.1|2252215_2252572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023299864.1|2252573_2253236_+	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	1.9e-21
WP_023303465.1|2253244_2253799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619493.1|2253791_2254415_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	30.8	7.2e-07
WP_032619495.1|2254453_2255923_+|tail	tail protein	tail	R9TMQ0	Vibrio_phage	47.1	1.1e-77
WP_032619497.1|2255919_2256426_+|tail	tail protein	tail	NA	NA	NA	NA
WP_032619498.1|2256477_2256765_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032619500.1|2259008_2259479_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_032620301.1|2259453_2259669_+|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619501.1|2259671_2260790_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	7.8e-36
WP_032619502.1|2260826_2261180_+|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_032619503.1|2261163_2262078_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	45.3	1.6e-58
WP_032619504.1|2262070_2262622_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_050019395.1|2262624_2264802_+	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.9	3.9e-55
WP_032619505.1|2264801_2265380_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.9	5.2e-52
WP_032619506.1|2265456_2266527_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032619507.1|2266567_2266972_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_004157630.1|2266993_2267149_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_032619509.1|2267456_2268731_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032619510.1|2268727_2269261_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017384434.1|2270920_2271244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619511.1|2271273_2272200_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384432.1|2272205_2272676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619512.1|2272841_2273558_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.1e-11
WP_015570244.1|2273554_2274430_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_023303913.1|2274426_2275701_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003859667.1|2275712_2276627_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003859669.1|2276695_2277817_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859671.1|2278228_2278897_+	YecA family protein	NA	NA	NA	NA	NA
WP_032620305.1|2279213_2280425_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859673.1|2280616_2280853_+	YecH family protein	NA	NA	NA	NA	NA
WP_003859676.1|2280889_2281387_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_015570249.1|2281587_2281926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859680.1|2282171_2282810_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_017384426.1|2282852_2284271_-	MFS transporter	NA	NA	NA	NA	NA
WP_003859682.1|2284485_2284569_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_003859683.1|2284675_2284927_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_017693227.1|2285007_2286351_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032619513.1|2286492_2286996_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_017384423.1|2287499_2288057_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_017384422.1|2288374_2289364_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032619514.1|2289435_2290950_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.2	6.9e-11
WP_003859689.1|2290964_2291945_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_023303910.1|2292098_2292902_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_015570257.1|2292876_2294301_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_017384418.1|2294316_2294745_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_006811111.1|2295532_2295892_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003859695.1|2295894_2296473_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003859696.1|2296596_2297484_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_017693230.1|2297480_2298410_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_017384416.1|2298414_2300424_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003859699.1|2300443_2300947_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_023303909.1|2301043_2302303_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023303908.1|2302730_2303303_+	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_015570265.1|2303310_2303859_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032619515.1|2303875_2304637_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023303905.1|2304612_2306997_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_017384412.1|2306993_2307956_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	3194129	3252671	4878509	tail,portal,terminase,protease,head,holin,integrase,capsid,tRNA	Enterobacterial_phage(33.33%)	77	3214246:3214261	3249898:3249913
WP_032619843.1|3194129_3195413_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	2.5e-09
WP_022650865.1|3195673_3195994_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
WP_154232874.1|3195981_3196221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636446.1|3196315_3197629_-	hypothetical protein	NA	K7PH95	Enterobacterial_phage	52.6	2.7e-112
WP_017382566.1|3197687_3197921_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_032619848.1|3198028_3198700_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	9.9e-87
WP_022651029.1|3198700_3199015_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_032619850.1|3199058_3202904_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	62.7	0.0e+00
WP_032619853.1|3202956_3203544_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	3.6e-48
WP_022648880.1|3203543_3204254_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032619855.1|3204256_3205015_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.2	3.9e-95
WP_022648882.1|3205011_3205350_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032620356.1|3205352_3208655_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.9	0.0e+00
WP_032619857.1|3208712_3209054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032619858.1|3209109_3209388_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3209396_3209780_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3209788_3210232_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3210291_3210639_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648888.1|3211081_3211420_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_032619860.1|3211428_3211755_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	82.4	3.4e-48
WP_023296252.1|3211798_3213010_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_032619863.1|3213019_3213868_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	91.8	9.2e-138
WP_032619865.1|3213881_3215186_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.6e-234
3214246:3214261	attL	TGCGTCAGGAACTGGA	NA	NA	NA	NA
WP_032619866.1|3215185_3216943_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	96.6	0.0e+00
WP_032619868.1|3216942_3217416_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	2.9e-85
WP_032619870.1|3217573_3217924_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	1.2e-51
WP_032619873.1|3217923_3218514_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	77.6	9.3e-89
WP_032619877.1|3218495_3219953_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	93.2	2.0e-278
WP_032619880.1|3220039_3220300_+	hypothetical protein	NA	A0A089FW14	Salmonella_phage	40.2	2.5e-09
WP_047715785.1|3220548_3220743_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.5	1.3e-18
WP_032619884.1|3220693_3220969_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	96.0	9.3e-07
WP_032619887.1|3220965_3221508_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_000220248.1|3221504_3221786_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_032264642.1|3221782_3222187_-	exported phage-related protein	NA	NA	NA	NA	NA
WP_032619892.1|3222414_3223218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619895.1|3223254_3223617_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	90.8	3.4e-57
WP_032619897.1|3223631_3224621_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.1	4.2e-182
WP_050595702.1|3224617_3225343_-	antirepressor	NA	G0ZND1	Cronobacter_phage	52.7	1.1e-54
WP_032619898.1|3225358_3225748_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.9	2.9e-62
WP_032619899.1|3225744_3226068_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	90.4	4.1e-46
WP_032619900.1|3226064_3226724_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	77.9	2.3e-96
WP_032619901.1|3226723_3227218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032634002.1|3227214_3228093_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	81.4	1.7e-38
WP_032619902.1|3228082_3228262_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_023315870.1|3228425_3228980_-	hypothetical protein	NA	S5FXP0	Shigella_phage	53.6	1.6e-45
WP_071842884.1|3229008_3229260_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_032619903.1|3229294_3230047_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	70.1	4.5e-80
WP_032619905.1|3230094_3230529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620359.1|3230628_3230838_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	60.9	6.6e-13
WP_032103842.1|3230865_3231075_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	75.0	3.0e-18
WP_032620361.1|3231794_3232208_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.2	5.2e-54
WP_032619906.1|3232207_3233035_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	85.6	1.5e-121
WP_032620364.1|3233632_3233977_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	74.3	2.7e-40
WP_032619908.1|3234056_3234326_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	74.2	1.5e-30
WP_022650818.1|3234358_3234622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032619909.1|3234596_3235739_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	1.4e-93
WP_015570783.1|3235958_3236459_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_015570785.1|3236867_3238199_+	sugar (Glycoside-Pentoside-Hexuronide) transporter	NA	NA	NA	NA	NA
WP_032619910.1|3238214_3240251_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003857881.1|3240357_3240804_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_017384695.1|3240787_3241579_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384696.1|3241678_3242866_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_032619911.1|3242897_3243605_-	CTP synthase	NA	NA	NA	NA	NA
WP_015570789.1|3243756_3244101_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|3244101_3244407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015570791.1|3244487_3244742_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_032619912.1|3245053_3246082_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.4	2.5e-12
WP_015570793.1|3246127_3246226_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|3246226_3246301_+	protein YoaJ	NA	NA	NA	NA	NA
WP_003857896.1|3246354_3246603_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|3246972_3247065_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_023296321.1|3247189_3248689_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_015570796.1|3248693_3248939_-	YmjA family protein	NA	NA	NA	NA	NA
WP_003857898.1|3249014_3250265_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
3249898:3249913	attR	TCCAGTTCCTGACGCA	NA	NA	NA	NA
WP_032619914.1|3250382_3251045_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_032619915.1|3251044_3251518_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032103856.1|3251558_3252671_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	4474455	4481960	4878509	integrase	Enterobacteria_phage(85.71%)	10	4468630:4468643	4486194:4486207
4468630:4468643	attL	GGAGCTGATGGCGA	NA	NA	NA	NA
WP_032620857.1|4474455_4474905_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.8	9.7e-46
WP_032620855.1|4474897_4475197_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	1.2e-31
WP_032620854.1|4475189_4475744_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	72.1	1.5e-35
WP_026094409.1|4475740_4476007_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	62.5	4.4e-22
WP_032620852.1|4476569_4477313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023323621.1|4477315_4477534_+	phage transcriptional activator	NA	Q7M294	Enterobacteria_phage	68.2	1.0e-16
WP_017692853.1|4477562_4478126_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	6.0e-61
WP_032620851.1|4478464_4479604_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_080288371.1|4479600_4480662_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_032620849.1|4480697_4481960_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	8.2e-74
4486194:4486207	attR	TCGCCATCAGCTCC	NA	NA	NA	NA
>prophage 9
NZ_CP011662	Enterobacter hormaechei strain CAV1176 chromosome, complete genome	4878509	4745066	4789126	4878509	tail,portal,terminase,protease,integrase,tRNA	Enterobacteria_phage(28.26%)	55	4739609:4739624	4797525:4797540
4739609:4739624	attL	CTTACCCGGCCTACAT	NA	NA	NA	NA
WP_032620558.1|4745066_4746104_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_032620560.1|4746191_4747286_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	83.7	1.4e-178
WP_032620563.1|4747505_4747751_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	63.8	2.2e-20
WP_128754880.1|4747734_4748001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620566.1|4748108_4748660_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	67.0	2.7e-66
WP_103848176.1|4749508_4750090_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.3	4.3e-46
WP_162269496.1|4750382_4750610_+	hypothetical protein	NA	E4WL44	Enterobacteria_phage	89.3	2.9e-30
WP_080288370.1|4750805_4754783_-|tail	phage tail protein	tail	M9P0D8	Enterobacteria_phage	89.5	0.0e+00
WP_128754879.1|4754799_4755279_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.0	7.9e-78
WP_032620570.1|4755364_4755982_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.0	2.6e-105
WP_032620572.1|4755974_4756694_-	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	97.9	9.8e-141
WP_032620573.1|4756696_4757434_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	6.1e-146
WP_032620574.1|4757489_4757828_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	99.1	5.2e-60
WP_032620577.1|4757824_4761085_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	97.7	0.0e+00
WP_071842901.1|4761068_4761383_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
WP_032620580.1|4761391_4761832_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
WP_032620582.1|4761842_4762586_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
WP_001704117.1|4762595_4762997_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
WP_020884618.1|4762993_4763572_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
WP_032620586.1|4763581_4763857_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	97.5	1.2e-38
WP_032620588.1|4763849_4764176_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	96.3	2.5e-51
WP_158650950.1|4764258_4766265_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	98.8	0.0e+00
WP_032620589.1|4766209_4767709_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.4	2.5e-287
WP_032620591.1|4767705_4767921_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	9.4e-31
WP_032620593.1|4767917_4770020_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	99.3	0.0e+00
WP_020884621.1|4770019_4770508_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	98.1	6.5e-80
WP_080288384.1|4770692_4771370_-	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	54.9	2.3e-35
WP_032620596.1|4771726_4771951_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.1	1.1e-18
WP_032620598.1|4771980_4772502_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	3.7e-73
WP_032620601.1|4772498_4773035_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	7.7e-90
WP_014832171.1|4773034_4773337_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_032620604.1|4774299_4774905_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.9	7.6e-70
WP_032620605.1|4774921_4775989_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.4	1.4e-106
WP_032620607.1|4775985_4777917_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	5.6e-199
WP_047715965.1|4777909_4779247_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	6.3e-117
WP_047715957.1|4779249_4780113_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	80.0	1.8e-56
WP_047715956.1|4780109_4780289_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	55.1	1.0e-06
WP_080344883.1|4780290_4781004_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	51.1	3.0e-49
WP_032634277.1|4781164_4781722_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.0	4.0e-65
WP_032634276.1|4781765_4781966_-	transcriptional regulator	NA	U5P445	Shigella_phage	84.6	3.5e-24
WP_032634275.1|4782054_4782729_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	1.1e-114
WP_047715955.1|4782897_4783098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032665243.1|4783069_4783324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154232880.1|4783322_4783478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620624.1|4783836_4784208_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_032620626.1|4784263_4785094_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	90.1	4.0e-138
WP_032620628.1|4785229_4785772_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.7	3.5e-74
WP_032620630.1|4785756_4785957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620631.1|4785953_4786280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620632.1|4786276_4787008_+	site-specific DNA-methyltransferase	NA	A0A0H5BBV5	Pseudomonas_phage	65.2	1.0e-84
WP_032620633.1|4787004_4787202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032620634.1|4787201_4787771_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	7.6e-80
WP_032620635.1|4787809_4788082_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	89.8	9.1e-39
WP_032620638.1|4788116_4788578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044488948.1|4788583_4789126_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.5	3.7e-07
4797525:4797540	attR	CTTACCCGGCCTACAT	NA	NA	NA	NA
>prophage 1
NZ_CP011661	Enterobacter hormaechei strain CAV1176 plasmid pKPC_CAV1176, complete sequence	90452	0	39742	90452	integrase,transposase	Escherichia_phage(29.41%)	32	18746:18762	41303:41319
WP_023302476.1|0_867_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
WP_006797591.1|1792_2998_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_023302473.1|2997_3972_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
WP_023302472.1|4053_5325_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
WP_006796638.1|5324_5756_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_074144872.1|6087_7056_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.1e-178
WP_032413487.1|7117_7453_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_017900922.1|7625_7904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805503.1|8166_9120_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
WP_023302470.1|9289_9910_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
WP_074142348.1|10748_11717_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.2	1.0e-172
WP_004152397.1|14862_16182_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|16431_17313_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|17511_18291_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|18287_19313_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
18746:18762	attL	CGGTCTTCATGTTGTCG	NA	NA	NA	NA
WP_004152392.1|19419_22449_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|22558_24274_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001235713.1|25388_25946_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|26128_26989_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_003032490.1|27151_27541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493700.1|28566_28776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|29253_30258_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|30336_30894_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|30887_31259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|31255_31756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|31752_32079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|32333_32690_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|32679_33081_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|33077_33368_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427614.1|33811_34816_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|34894_37861_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000935451.1|38026_39742_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
41303:41319	attR	CGACAACATGAAGACCG	NA	NA	NA	NA
