The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	8568	17036	5289898	tail	Shigella_phage(25.0%)	11	NA	NA
WP_001164137.1|8568_9096_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|9126_9660_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|9661_10447_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|10674_10857_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|11055_11724_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|11780_12050_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|12461_13019_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|13015_13291_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|13666_14473_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|14472_15666_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|15677_17036_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
>prophage 2
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	520334	608581	5289898	holin,transposase,terminase,tRNA,plate,capsid,portal,tail,integrase	Escherichia_phage(22.73%)	103	566031:566090	608643:608767
WP_099156434.1|520334_521683_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000568520.1|521792_522803_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|522811_523423_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|523561_523627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|523697_524300_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|524301_524823_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|524857_525598_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|525626_526079_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|526071_527844_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|528153_528720_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|528716_529535_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|529587_529983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|530023_530767_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|530763_531735_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|531770_534200_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|534224_535325_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|535712_536459_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|536472_537039_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|537254_538988_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|539040_539433_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|539432_541511_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|541503_542652_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|542840_543485_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|543495_543885_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|543899_544949_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|544951_545812_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|546102_547764_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|547908_548412_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|548432_550397_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|550401_551328_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|551324_552212_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|552338_552917_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|552919_553270_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|554049_554478_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|554484_555909_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|555883_556684_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|556850_557840_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|557851_559366_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|559435_560425_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|561219_561723_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|561800_562052_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|562166_562253_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|562516_562840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|563011_563509_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|563546_563786_-	YecH family protein	NA	NA	NA	NA	NA
WP_048266395.1|563976_565188_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|565238_565904_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
566031:566090	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|566375_566795_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|568009_568234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|568395_568785_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|568820_570461_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|570569_570851_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|570863_571376_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|571393_572896_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|572892_573282_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|573281_574466_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|574458_575085_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|575087_576008_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|576004_576346_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|576348_577251_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|577231_577768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|577764_578445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|578476_578857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|578853_579273_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|579307_580342_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|580400_580730_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|580729_582037_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|582036_583611_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|583607_583841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|583840_585703_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|585689_586256_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|586624_586870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|586929_587124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|587131_587611_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|587610_587883_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|587882_588266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|588378_589050_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|589049_589343_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|589339_589936_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|590013_590193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|590344_590986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|591229_591463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104021938.1|591861_592359_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.3	2.9e-27
WP_001138663.1|592360_592966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|593428_594127_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|595314_596238_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|596412_597201_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|597882_598107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|598103_598415_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|598411_598648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|598649_599060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|599098_600514_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|600503_601259_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|601255_601480_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|601519_601996_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|602054_602285_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|602383_602797_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|603807_604128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|604158_606375_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|606371_606941_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|606940_607123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|607332_607596_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|607564_608581_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
608643:608767	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	626825	704958	5289898	holin,transposase,terminase,head,capsid,portal,tail,integrase,protease	Escherichia_phage(40.0%)	95	661601:661616	727960:727975
WP_001347174.1|626825_627350_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|627506_628304_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|628313_628865_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|629033_629366_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|629709_630024_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|630238_631897_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|631889_632885_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|632877_633564_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|633563_634937_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|634955_635399_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|635395_636523_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|636627_637092_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|637096_638101_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|638097_638511_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|638513_638879_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|638878_639616_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|639625_639895_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|639903_640689_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|640978_641602_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|641645_641888_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|641996_642224_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|642519_643335_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|643331_645026_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|645196_645379_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|645457_646375_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|646547_647468_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|647456_647927_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|647907_649326_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|649392_650088_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|650127_650493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|651058_652174_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|652766_653618_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|653725_655084_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|655083_655755_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|655887_656301_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|656409_657414_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|657414_658050_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|658133_659482_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|659742_660393_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|661476_661764_-	hypothetical protein	NA	NA	NA	NA	NA
661601:661616	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|661774_662479_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|662488_662770_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|662769_665148_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|665268_665727_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|665923_666523_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|666590_669986_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|670046_670694_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|670591_671335_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|671340_672039_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|672038_672395_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|672372_675600_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_071590020.1|675646_675907_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|675948_676335_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|676334_677039_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|677099_677444_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|677440_677890_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|677886_678225_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|678233_678551_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|678627_679845_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|679859_680459_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|680451_681678_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|681825_683583_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|683582_684065_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|684212_684563_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|685088_685382_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|685472_685655_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|685871_686405_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|686468_686819_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|686823_687039_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|687346_687535_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|687794_688130_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|688410_688542_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|689437_690259_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|690273_690636_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|690636_691695_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|691696_691969_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|692136_692292_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|692550_692769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224667.1|693382_693565_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000761442.1|693658_694072_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.6e-58
WP_001151210.1|694072_694495_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|694535_695498_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|695520_695946_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|695929_696211_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|696311_696731_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|696996_697152_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|697311_697530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|697533_697698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|698097_698286_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|698282_698474_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|698566_701038_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|701096_701300_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|701299_702325_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|702560_703358_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|703695_704958_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
727960:727975	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 4
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	770766	808145	5289898	transposase	Stx2-converting_phage(21.43%)	41	NA	NA
WP_000080195.1|770766_772380_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|772410_772761_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|772757_773183_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001336659.1|773447_773624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296203.1|774387_775584_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001304240.1|775707_775986_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|776079_776682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|777707_778400_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|778399_779422_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_089438313.1|779567_779747_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001296206.1|780946_782092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|782622_782880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|782933_783701_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|783697_784756_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|784774_785764_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000856948.1|785774_787940_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|788368_788803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|789020_791405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203551.1|791401_792307_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102633.1|792303_793374_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001542273.1|793509_793923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|794037_795579_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|795593_796340_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|796788_797199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|797419_798238_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|798237_798483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|798576_799050_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|799065_799542_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|799604_799826_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|799844_800489_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|800504_800873_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|800961_801336_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|801332_801527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|801539_801653_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|802141_802324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|802424_802754_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|802925_803984_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|804181_804655_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|804773_805940_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_000980556.1|806148_807576_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|807686_808145_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
>prophage 5
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	832075	838372	5289898		Enterobacteria_phage(66.67%)	6	NA	NA
WP_104021940.1|832075_832612_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	62.8	4.3e-48
WP_000857525.1|832616_833495_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|833552_834452_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|834451_835537_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|835909_836803_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|836977_838372_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 6
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	885090	924948	5289898	holin,lysis,terminase,tRNA,plate,head,capsid,portal,tail,integrase	Escherichia_phage(44.19%)	48	889379:889406	922962:922989
WP_000675176.1|885090_886494_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|886490_887213_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000476014.1|887872_889234_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
889379:889406	attL	AATCTCCCTTACACAGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|889506_889725_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000887625.1|889806_890970_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
WP_000978916.1|890969_891449_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_001600133.1|891463_893911_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|893903_894023_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001599803.1|894055_894331_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_001251408.1|894387_894906_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|894918_896109_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_023908562.1|896187_896355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599801.1|896543_897623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001516655.1|897951_898530_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_001599800.1|898529_901148_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
WP_001285323.1|901158_901689_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001121473.1|901681_902590_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127164.1|902594_902942_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001599799.1|902938_903574_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_001599798.1|903657_904443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599797.1|904514_904967_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
WP_001599796.1|904959_905427_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	9.7e-81
WP_001300730.1|905389_905563_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_023908563.1|905534_905960_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.0	4.0e-65
WP_001605748.1|905947_906373_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_001144101.1|906387_906885_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|906884_907166_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|907169_907373_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|907372_907882_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203428.1|907981_908725_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_023908564.1|908728_909802_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.6	3.1e-199
WP_001601069.1|909860_910715_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
WP_000156877.1|910888_912661_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_023908565.1|912660_913695_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	98.8	3.3e-198
WP_001752367.1|914391_914829_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	86.0	1.4e-65
WP_021561350.1|914991_916083_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	33.3	9.1e-05
WP_021561351.1|916096_916585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908567.1|917002_919303_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027664.1|919292_919568_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|919564_919789_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|919791_920091_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|920090_920315_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|920378_920879_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|921056_921332_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|921453_921753_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|921868_922882_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001531820.1|923316_923634_-	hypothetical protein	NA	NA	NA	NA	NA
922962:922989	attR	AATCTCCCTTACACAGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807341.1|924048_924948_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 7
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	967265	975577	5289898		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001296230.1|967265_969269_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|969393_969855_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|969895_970366_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|970412_971132_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|971128_972814_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|973035_973767_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|973826_973934_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|973914_974646_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|974650_975577_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 8
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	987603	1086296	5289898	lysis,terminase,tRNA,portal,tail,protease	Enterobacteria_phage(43.4%)	97	NA	NA
WP_001264872.1|987603_988554_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|988792_989191_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|989187_989883_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553553.1|990012_990897_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920064.1|991046_991766_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000383096.1|991768_992008_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136339.1|992201_993440_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956074.1|993433_994669_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275112.1|994911_995922_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255034.1|995937_997458_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_001036964.1|997518_998517_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628655.1|998796_999837_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_000440900.1|999978_1001136_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139613.1|1001152_1001821_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425450.1|1002078_1002915_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000534384.1|1005229_1006699_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548294.1|1006903_1007785_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000182056.1|1007883_1008933_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873880.1|1009006_1009864_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
WP_000999817.1|1009867_1010956_+	sugar kinase	NA	NA	NA	NA	NA
WP_000415422.1|1011223_1012165_-	ribosylpyrimidine nucleosidase	NA	NA	NA	NA	NA
WP_000658608.1|1012294_1012993_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
WP_000353897.1|1013059_1014310_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_001293146.1|1014403_1015342_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001207098.1|1015329_1016271_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_000854422.1|1016726_1018418_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091263.1|1018434_1019373_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487246.1|1019372_1020503_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000552003.1|1020870_1022052_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001296237.1|1022048_1022303_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136827.1|1022457_1023030_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_001296238.1|1023252_1024719_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
WP_000198798.1|1024836_1025823_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_001296239.1|1025861_1026575_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1026986_1027553_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_104021941.1|1027733_1029290_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001554206.1|1029371_1031186_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501604.1|1031186_1032281_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_000088892.1|1032280_1033306_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000194884.1|1033307_1034897_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
WP_000202798.1|1034900_1035245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213379.1|1035578_1036769_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1036796_1037492_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578064.1|1037641_1039402_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
WP_000494186.1|1039526_1039811_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|1039949_1040957_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135664.1|1041138_1041366_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256203.1|1041385_1043146_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001351450.1|1044073_1045276_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_032197999.1|1046378_1046963_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	3.3e-102
WP_104021942.1|1046962_1050190_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001616893.1|1050254_1050854_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_048266389.1|1050920_1054319_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
WP_032198003.1|1054379_1055027_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	2.5e-111
WP_032198004.1|1054924_1055668_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.0e-150
WP_032198005.1|1055673_1056372_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	1.2e-132
WP_000447253.1|1056381_1056711_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_032198006.1|1056710_1059785_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	95.7	0.0e+00
WP_001161009.1|1059756_1060086_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001351445.1|1060094_1060481_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_000211109.1|1060541_1061285_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_032198026.1|1061296_1061698_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	5.4e-72
WP_000677108.1|1061694_1062273_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_032198007.1|1062284_1062560_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097050.1|1062552_1062876_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_072060416.1|1062966_1064994_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_072134767.1|1064938_1066519_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001072975.1|1066446_1066659_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_032198008.1|1066655_1068758_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.0	0.0e+00
WP_000349509.1|1068757_1069249_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_032198009.1|1069926_1070166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088939.1|1070212_1070674_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	66.4	7.6e-46
WP_021535405.1|1070670_1071168_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	97.6	7.1e-90
WP_000839596.1|1071167_1071383_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1071450_1072503_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1072653_1072857_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_032198010.1|1073132_1073996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137548549.1|1074240_1074672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104021943.1|1074690_1075056_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	89.2	3.8e-56
WP_032198014.1|1075070_1076060_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.8e-193
WP_032198015.1|1076067_1076877_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	4.8e-152
WP_000767103.1|1076896_1077286_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_032198016.1|1077282_1077609_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.6e-53
WP_001442792.1|1077605_1078259_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_015674830.1|1078258_1078753_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	95.1	2.6e-84
WP_032198017.1|1078749_1079721_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	87.3	7.3e-131
WP_001250272.1|1079710_1079890_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_032198019.1|1080065_1080617_-	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	3.8e-100
WP_032198020.1|1080609_1080870_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|1080967_1081660_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|1082362_1082725_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1082790_1083615_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|1083742_1084279_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242718.1|1084269_1084632_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548839.1|1084628_1084844_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001096409.1|1084905_1085115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741304.1|1085117_1086296_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
>prophage 9
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	1598344	1605484	5289898		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1598344_1600906_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|1601011_1601668_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|1601718_1602516_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|1602681_1603590_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|1603586_1604849_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|1604845_1605484_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	1854643	1916733	5289898	transposase,integrase,tRNA,protease	Staphylococcus_phage(33.33%)	53	1855852:1855869	1916130:1916147
WP_001296354.1|1854643_1855402_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|1855831_1856752_-	agmatinase	NA	NA	NA	NA	NA
1855852:1855869	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|1856887_1857619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|1857764_1859741_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|1859749_1859881_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|1860016_1860232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|1860535_1861690_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|1862125_1863520_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|1863596_1864094_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|1864188_1864896_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|1864975_1865707_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|1865719_1866670_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|1866706_1867342_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1867341_1867758_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|1867872_1868853_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1868870_1869575_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1869592_1870159_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|1870155_1870446_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|1870453_1871047_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|1871039_1872176_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|1872490_1873477_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|1873521_1874025_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|1874024_1875326_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|1875381_1876389_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|1876505_1877552_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1877727_1878447_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|1878467_1878608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|1878630_1878957_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1878956_1879676_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|1879836_1880889_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1880916_1881192_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|1881256_1882336_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|1882537_1883794_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|1883842_1885978_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|1886370_1887078_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|1887456_1888722_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|1888977_1890021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|1891714_1892266_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|1894757_1894991_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_104021965.1|1895457_1895673_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	83.6	8.2e-27
WP_099156432.1|1895641_1896768_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|1896858_1896972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|1898805_1899066_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|1899107_1899668_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|1899707_1900136_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|1900853_1902047_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|1902182_1903907_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|1903907_1904855_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|1904854_1906597_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|1906593_1907871_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|1907952_1910154_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|1911097_1914985_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|1915581_1916733_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
1916130:1916147	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 11
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	1953696	1959260	5289898	transposase	Stx2-converting_phage(28.57%)	9	NA	NA
WP_000422741.1|1953696_1954122_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1954118_1954469_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1954499_1956113_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_104021945.1|1956152_1956362_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_023909039.1|1956462_1957281_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.0e-44
WP_000849596.1|1957335_1957821_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186774.1|1957836_1958313_+	RadC family protein	NA	NA	NA	NA	NA
WP_016231182.1|1958375_1958597_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.9	8.5e-11
WP_015674870.1|1958816_1959260_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.2	1.2e-19
>prophage 12
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	3171126	3213361	5289898	lysis,terminase,tRNA,portal,tail,integrase,protease	Enterobacteria_phage(55.56%)	49	3192814:3192829	3220360:3220375
WP_001093916.1|3171126_3171408_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_047654657.1|3171444_3172227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081311.1|3172415_3173240_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.0e-149
WP_000135680.1|3173305_3173668_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000848749.1|3174336_3175011_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000649477.1|3175101_3175302_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|3175345_3175897_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_029593989.1|3175893_3176730_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	97.5	6.7e-149
WP_029593990.1|3176734_3176959_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.3	1.6e-36
WP_000061506.1|3176955_3177774_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_075210561.1|3177770_3178265_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.5	7.6e-84
WP_001442792.1|3178264_3178918_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|3178914_3179241_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|3179237_3179627_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061379.1|3179646_3180456_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001420253.1|3180463_3181453_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_001047110.1|3181466_3182219_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000917724.1|3182472_3182676_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|3182826_3183879_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|3183946_3184162_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|3184161_3184659_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|3184655_3185123_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|3185110_3185263_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000373425.1|3185938_3186433_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934132.1|3186432_3188535_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.7	0.0e+00
WP_001072973.1|3188531_3188744_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985938.1|3188743_3190252_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
WP_077788595.1|3190196_3192224_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001097045.1|3192310_3192634_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283152.1|3192626_3192902_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
3192814:3192829	attL	GCGGGGATCGCGTTGT	NA	NA	NA	NA
WP_000677112.1|3192913_3193492_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|3193488_3193890_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211104.1|3193900_3194644_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	7.8e-133
WP_001372042.1|3194704_3195091_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|3195099_3195429_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_048266334.1|3195400_3198466_+|tail	phage tail tape measure protein	tail	K7PKI9	Enterobacteria_phage	98.6	0.0e+00
WP_000447248.1|3198465_3198795_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_048266335.1|3198804_3199503_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	2.3e-134
WP_032228194.1|3199508_3200252_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	6.3e-151
WP_000741576.1|3200149_3200797_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_048266336.1|3200857_3204256_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_104021948.1|3204322_3204922_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	2.8e-109
WP_072060412.1|3204986_3208010_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	6.1e-67
WP_048266338.1|3208009_3208594_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	9.2e-105
WP_039268535.1|3208706_3210077_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000543834.1|3210054_3210606_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001217553.1|3210828_3211077_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332259.1|3211137_3212235_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_000543841.1|3212323_3213361_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3220360:3220375	attR	GCGGGGATCGCGTTGT	NA	NA	NA	NA
>prophage 13
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	3537322	3611293	5289898	transposase,tRNA,protease	Enterobacteria_phage(15.79%)	58	NA	NA
WP_001162171.1|3537322_3538675_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|3538857_3539244_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106238.1|3539288_3539753_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187791.1|3539911_3542050_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001296690.1|3542443_3544099_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001296691.1|3544148_3545570_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|3545688_3546636_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3546820_3546874_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3547014_3549711_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3549916_3550303_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3550375_3550837_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3550849_3551785_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|3551788_3551923_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|3552203_3552599_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500696.1|3552729_3553443_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256667.1|3553513_3554107_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296694.1|3554251_3554704_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000012944.1|3556479_3557484_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3557645_3558062_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|3558107_3558611_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079649.1|3558803_3560000_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416407.1|3560053_3562909_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3562908_3563352_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3563707_3565219_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|3565485_3566586_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001296697.1|3566585_3567668_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001296698.1|3567828_3569331_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	4.6e-84
WP_001296699.1|3569460_3570480_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001064798.1|3573773_3574538_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001545174.1|3574777_3575677_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_085949154.1|3576850_3577997_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000440185.1|3578541_3579555_+	4-hydroxythreonine-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000939276.1|3579815_3581060_+	MFS transporter	NA	NA	NA	NA	NA
WP_000239754.1|3582751_3582988_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000422741.1|3583325_3583751_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3583747_3584098_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3584128_3585742_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000107487.1|3586012_3587026_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998348.1|3587037_3588354_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3588381_3589302_-	ribokinase	NA	NA	NA	NA	NA
WP_001295538.1|3589607_3590390_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387298.1|3590391_3590490_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_000527665.1|3591615_3591723_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000145475.1|3591903_3592560_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296707.1|3592807_3594085_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001545177.1|3594147_3596145_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
WP_000336726.1|3596299_3597118_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|3597153_3597456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|3598389_3598647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3599203_3599971_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3599971_3600928_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|3600924_3601923_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|3601919_3602822_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|3602866_3605191_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068908.1|3605277_3606231_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|3606227_3606749_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000823243.1|3608310_3609669_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|3609907_3611293_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
>prophage 15
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	4659840	4838845	5289898	holin,terminase,lysis,transposase,tRNA,plate,head,capsid,portal,tail,integrase,protease	Enterobacteria_phage(27.7%)	211	4659741:4659766	4843764:4843779
4659741:4659766	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290937.1|4659840_4660893_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
4659741:4659766	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000900883.1|4661081_4661273_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_024220196.1|4661288_4661858_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	4.2e-38
WP_000188450.1|4662003_4662207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4662271_4662781_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956192.1|4662788_4663085_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|4663202_4663544_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_104021953.1|4663611_4663845_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	2.7e-31
WP_032258242.1|4663844_4664072_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.9e-35
WP_104021954.1|4664068_4664926_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	7.8e-161
WP_104021955.1|4664922_4667337_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_001154434.1|4667490_4667679_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4667689_4667923_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_024199287.1|4668825_4669278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049685.1|4669527_4670181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001726290.1|4670610_4672263_+	KAP family P-loop domain protein	NA	X2KLG0	Campylobacter_phage	23.3	4.6e-16
WP_104021957.1|4672297_4673326_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.5e-169
WP_001098411.1|4673325_4675092_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_104021958.1|4675234_4676068_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	4.2e-119
WP_000742510.1|4676084_4677143_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_025790323.1|4677146_4677797_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_000673524.1|4677892_4678357_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4678356_4678560_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4678563_4678779_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_071701827.1|4678759_4679272_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
WP_000727853.1|4679273_4679651_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080935.1|4679647_4680076_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_001039935.1|4680171_4680603_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_042017582.1|4680595_4681042_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	2.3e-63
WP_000993759.1|4681110_4681689_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	82.8	9.1e-89
WP_000177579.1|4681685_4682045_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_001240755.1|4682031_4682940_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_001086833.1|4682932_4683538_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_104021959.1|4683534_4685091_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.6	1.1e-194
WP_097510967.1|4685090_4685693_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.9	8.6e-98
WP_054622936.1|4685664_4686105_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	65.5	1.5e-46
WP_071701730.1|4686107_4686479_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	45.1	6.6e-16
WP_000905032.1|4686509_4687076_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046120.1|4687218_4688391_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|4688400_4688916_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|4688970_4689273_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|4689287_4689407_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_104021960.1|4689399_4692477_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980413.1|4692473_4692959_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_104021961.1|4692955_4694056_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	3.8e-176
WP_000972391.1|4694146_4694365_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|4694601_4696287_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
4694431:4694456	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|4696555_4696933_+	membrane protein	NA	NA	NA	NA	NA
4694431:4694456	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_001195231.1|4696962_4697220_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201575.1|4697379_4697667_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|4697650_4698373_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4698433_4699336_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4699423_4699900_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_001295904.1|4700249_4701362_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|4701456_4702590_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105413.1|4702599_4703544_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061639.1|4703540_4704386_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4704445_4704934_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|4704974_4706102_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|4706130_4706862_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|4707087_4707756_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|4707755_4708472_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756574.1|4708478_4709210_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|4709227_4709956_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001295906.1|4710173_4710689_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4710814_4711138_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|4711134_4711965_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|4711961_4712975_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136505.1|4713073_4714504_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566382.1|4714514_4715516_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|4715552_4717271_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178692.1|4717403_4718372_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458841.1|4718383_4720036_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491137.1|4720179_4721079_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|4721493_4722189_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599803.1|4722613_4724272_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|4724268_4725225_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|4725375_4726491_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188152.1|4726487_4728434_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
WP_000410785.1|4728506_4728731_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4729053_4729374_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4729404_4731681_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4732365_4732584_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|4732868_4733573_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048266355.1|4733614_4735336_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001043561.1|4735336_4737103_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|4737225_4738191_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|4738734_4739229_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|4739363_4743470_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4743628_4744240_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|4744250_4745594_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|4745684_4746977_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|4747282_4747423_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|4747614_4747875_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|4747915_4749025_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|4749182_4750367_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|4750366_4750879_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|4750934_4751309_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|4751317_4751473_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|4751459_4754267_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|4754279_4754768_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|4754796_4755396_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|4755614_4756172_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|4756174_4756708_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|4756736_4757264_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|4757265_4759488_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|4759490_4760021_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|4760013_4760910_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|4760913_4761264_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|4761260_4761842_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|4761838_4762474_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|4762466_4762934_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|4762957_4764835_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|4764973_4765369_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|4765365_4765758_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|4765754_4766078_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|4766080_4766281_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|4766280_4766775_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|4766876_4767677_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|4767722_4768775_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|4768798_4769635_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|4769789_4771541_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|4771540_4772587_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|4772601_4773126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|4773849_4774347_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|4774386_4775229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|4775312_4775627_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|4775631_4776591_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|4776667_4779490_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|4779496_4779862_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|4779858_4780476_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|4780487_4780787_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|4780783_4781050_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|4781046_4781250_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|4781273_4781684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|4781777_4781891_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|4781887_4782130_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|4782141_4782420_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|4782430_4782781_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|4782918_4783110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|4783116_4783539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|4783543_4784065_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|4784169_4784511_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|4784580_4785573_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|4785872_4788317_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|4788327_4788945_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|4788946_4789810_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|4789845_4790472_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|4790785_4791934_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|4792030_4792771_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4792962_4795245_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|4795299_4796157_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|4796562_4798323_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|4798452_4799145_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|4799343_4800432_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|4800502_4801786_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|4802041_4802614_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|4802673_4803198_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|4803197_4803812_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|4803818_4804280_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|4804290_4805538_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|4805540_4806119_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_048266404.1|4806111_4807215_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.0	4.1e-106
WP_000859111.1|4807205_4807553_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|4807607_4808204_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|4808200_4809355_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|4809342_4809558_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|4809554_4810439_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|4810438_4813390_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|4813465_4813624_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|4813547_4813883_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|4813980_4814262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|4814264_4814786_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|4814785_4816213_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|4816202_4816457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|4816453_4816918_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|4816917_4817364_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|4817365_4817704_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|4817713_4818667_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|4818681_4819797_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|4820011_4820470_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|4820472_4821294_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|4821274_4822771_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|4822770_4824303_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|4824362_4824908_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227701.1|4824907_4825219_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|4825218_4825545_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|4825541_4826192_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|4826175_4826916_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|4826918_4827269_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|4827399_4828128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|4828103_4828508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|4828506_4828722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|4828912_4829677_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|4829793_4830150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|4830243_4830432_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|4830484_4830793_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|4830803_4831724_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|4831723_4832041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|4832056_4833826_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|4833836_4835003_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|4835005_4835275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|4835302_4835833_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|4836121_4836394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|4836403_4836700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|4836714_4836930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|4836926_4837610_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|4837606_4837837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|4837826_4838033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|4838034_4838484_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|4838455_4838845_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
4843764:4843779	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 16
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	5050171	5098420	5289898	holin,transposase,lysis,terminase,tRNA,head,capsid,portal,tail,integrase	Enterobacteria_phage(54.72%)	60	5048489:5048503	5079623:5079637
5048489:5048503	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|5050171_5051278_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|5051331_5051793_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|5051802_5052456_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|5052627_5053878_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|5053991_5055134_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|5055123_5055360_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|5055499_5055739_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|5055722_5056049_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|5056048_5056270_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|5056368_5056650_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|5056660_5056852_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|5056824_5057007_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|5057003_5057684_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|5057680_5058466_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|5058471_5058768_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|5058843_5059050_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|5059645_5060401_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|5060439_5060670_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|5060739_5061279_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|5061365_5062295_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|5062291_5062993_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|5063242_5067508_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000080195.1|5067852_5069466_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|5069496_5069847_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|5069843_5070269_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_072147164.1|5071477_5071579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|5071575_5072031_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|5072030_5072201_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|5072193_5072484_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|5072480_5072843_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|5072839_5072980_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|5072976_5073666_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|5073987_5074293_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|5074279_5074756_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|5074972_5075155_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|5075245_5075539_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|5076019_5076346_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|5076552_5076735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|5077298_5077844_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_104021962.1|5077818_5079744_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
5079623:5079637	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|5079740_5079947_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|5079943_5081545_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|5081525_5082845_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|5082854_5083187_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|5083242_5084268_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|5084309_5084708_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|5084719_5085073_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|5085084_5085663_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|5085659_5086055_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|5086062_5086803_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|5086818_5087241_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|5087222_5087657_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|5087649_5090211_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|5090207_5090537_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|5090536_5091235_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|5091239_5091983_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|5091919_5092522_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|5092582_5096065_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|5096123_5098145_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|5098141_5098420_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 17
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	5236382	5269707	5289898	holin,terminase,head,capsid,portal,tail,integrase	Stx2-converting_phage(31.43%)	45	5232556:5232570	5238466:5238480
5232556:5232570	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|5236382_5237513_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5237490_5237739_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|5237803_5240275_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
5238466:5238480	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|5240367_5240559_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|5240555_5240744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|5241309_5241528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|5241687_5241843_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|5242115_5242832_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|5242881_5243097_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|5243093_5243519_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|5243541_5244504_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|5244510_5245257_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|5245278_5246049_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|5246064_5246490_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|5246664_5247330_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|5247510_5247723_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|5247890_5248163_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|5248164_5249220_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|5249220_5249601_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_000917751.1|5250644_5250842_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|5250993_5252043_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|5252844_5252976_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|5253256_5253592_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|5253852_5255706_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|5255856_5256072_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|5256076_5256421_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|5256386_5256659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|5256764_5257298_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|5257852_5257939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|5258160_5258346_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|5258431_5258647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|5258845_5259046_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|5259087_5259453_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|5259743_5260307_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|5260303_5261965_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|5262028_5263966_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|5264010_5264232_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|5264177_5266763_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|5266759_5267086_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|5267095_5267446_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5267442_5267889_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5267885_5268230_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|5268296_5269013_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|5269027_5269402_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|5269497_5269707_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
>prophage 18
NZ_CP015085	Escherichia coli O25b:H4 chromosome, complete genome	5289898	5272997	5282129	5289898	tail	Enterobacteria_phage(66.67%)	6	NA	NA
WP_000807937.1|5272997_5273339_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|5273338_5274037_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|5274047_5274791_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|5274736_5275369_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|5275712_5279186_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001016257.1|5281382_5282129_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 1
NZ_CP015086	Escherichia coli O25b:H4 plasmid unnamed, complete sequence	130920	3619	53396	130920	transposase,integrase	Macacine_betaherpesvirus(29.41%)	46	38691:38705	58242:58256
WP_001067858.1|3619_4324_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_065897011.1|4840_5752_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|5783_6983_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_031606906.1|7088_7715_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_042005022.1|7746_7983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480972.1|8036_8873_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|8872_9676_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|9736_10552_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067855.1|11096_11801_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|11922_12828_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|12824_14063_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|14062_14647_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|15139_15904_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|16130_16436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|16446_17652_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|17807_18011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|18138_18978_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|18971_19319_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|19524_20313_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|20443_20917_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067858.1|21684_22389_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001298664.1|22846_24817_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|26059_26332_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|27178_28348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|28714_28903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033550837.1|29023_29764_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_033550836.1|30048_31026_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	1.0e-100
WP_033550835.1|31865_32507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|34622_34913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|35753_37367_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|37397_37748_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|37744_38170_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000698737.1|38391_40617_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
38691:38705	attL	GCAGGAGAAGCTGTT	NA	NA	NA	NA
WP_000952217.1|40618_41707_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|42286_42505_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|42506_42812_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|42812_43619_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|44392_45148_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|45735_46902_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|46901_47873_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_077727434.1|48739_49642_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|50026_50710_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|50710_50932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|50945_51380_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001753849.1|51430_52207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|52283_53396_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
58242:58256	attR	GCAGGAGAAGCTGTT	NA	NA	NA	NA
>prophage 2
NZ_CP015086	Escherichia coli O25b:H4 plasmid unnamed, complete sequence	130920	66115	123801	130920	transposase,protease	Escherichia_phage(33.33%)	56	NA	NA
WP_085947770.1|66115_67484_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001312861.1|67682_67841_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032143370.1|68341_68530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107535.1|68762_69050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|69168_69990_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000243712.1|70286_70889_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151566.1|71218_71602_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001348626.1|71735_72413_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001254388.1|72500_72728_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_024210418.1|72761_73121_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012107.1|73135_73447_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399791.1|73468_74035_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_148725207.1|74045_74750_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146687.1|74749_76201_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_104021966.1|76169_76706_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001348757.1|77484_77805_+	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
WP_001617873.1|77931_78216_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_000059829.1|78202_78748_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_071571857.1|78677_79025_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001348758.1|78972_79398_+	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_000944328.1|79384_80758_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001007062.1|80754_83574_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000605862.1|83592_84090_+	entry exclusion protein	NA	NA	NA	NA	NA
WP_000850429.1|84121_84853_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000199914.1|85055_85835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024623315.1|85831_88030_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_042045338.1|88029_93300_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205718.1|93319_94066_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_000139341.1|94120_94681_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023861.1|94811_95024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023144756.1|95894_96029_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_108401337.1|96325_96400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|96457_97204_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
WP_001067855.1|98561_99266_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|99867_100473_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001553819.1|100567_103465_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001398199.1|103601_104003_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|103935_104193_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|104285_104939_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000130640.1|105878_106736_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|106728_106803_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001067855.1|107767_108472_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|108615_109170_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|109300_110131_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_012783949.1|110268_110817_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A1V0SJ47	Klosneuvirus	38.0	2.0e-08
WP_001067855.1|110762_111467_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|114614_114947_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|114993_115869_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|116124_117387_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_042045396.1|117950_118295_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.1	1.1e-52
WP_001067858.1|118328_119033_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000951934.1|120024_120216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|120239_120467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|120517_121654_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|121620_121770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|123096_123801_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP015087	Escherichia coli O25b:H4 extrachromosomal	32764	11923	20506	32764	tail	Escherichia_phage(28.57%)	8	NA	NA
WP_001348267.1|11923_12481_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|12892_13162_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|13218_13887_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|14085_14268_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|14393_15362_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_000972097.1|15936_16470_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|16471_19297_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|19759_20506_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
>prophage 1
NZ_CP015088	Escherichia coli O25b:H4 extrachromosomal	29509	13704	25221	29509	plate,lysis,head,tail	Salmonella_phage(73.68%)	19	NA	NA
WP_000673524.1|13704_14169_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|14168_14372_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|14375_14591_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_071701827.1|14571_15084_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
WP_000727853.1|15085_15463_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080935.1|15459_15888_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_001039935.1|15983_16415_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_042017582.1|16407_16854_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	2.3e-63
WP_000993759.1|16922_17501_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	82.8	9.1e-89
WP_000177579.1|17497_17857_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_001240755.1|17843_18752_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_001086833.1|18744_19350_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_104021973.1|19346_20729_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.3	7.4e-153
WP_054622936.1|20731_21172_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	65.5	1.5e-46
WP_097510967.1|21143_21746_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.9	8.6e-98
WP_104021974.1|21745_22291_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.4	4.3e-48
WP_000905032.1|22321_22888_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001207660.1|24213_24729_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000763311.1|25101_25221_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
