The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	382902	447762	6723378	holin,plate,tail,tRNA	Pseudomonas_phage(40.0%)	66	NA	NA
WP_003129196.1|382902_383928_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|384006_384576_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|384659_385013_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|385003_385546_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|385518_386751_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|386794_387301_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|387395_388949_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|388945_390217_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|390317_392240_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|392518_392851_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|392894_393746_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|393745_394126_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|394162_394969_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003129197.1|395084_396071_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|396067_397360_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|397340_400142_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003129200.1|400268_401285_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|401281_401956_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|401957_402716_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003085099.1|402716_403778_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003129201.1|403929_406323_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|406368_407001_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|407129_408164_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|408397_409507_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003129202.1|409562_410609_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003129203.1|410723_411971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|412076_412907_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003129204.1|413030_413705_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003129205.1|413704_414523_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003129206.1|414595_416074_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003129207.1|416260_416575_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|416674_417445_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|417902_418103_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|418150_418510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129208.1|418872_419322_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|419343_419859_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003129209.1|419855_420413_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.9	1.7e-44
WP_003085143.1|420565_420892_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|420888_421776_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003129210.1|421768_422302_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	6.7e-62
WP_003129211.1|422303_424412_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|424420_424861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|424903_426064_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003129212.1|426076_426580_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|426594_426939_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003129213.1|427108_429346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|429355_430228_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|430202_430409_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003129214.1|430466_431456_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.5	6.3e-106
WP_003129215.1|431488_432118_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003129216.1|432114_432477_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.1	5.5e-15
WP_003118919.1|432473_432731_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|433046_433541_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|433552_433900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|433929_434184_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003129218.1|434230_436069_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|436061_436403_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|436410_437106_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|437108_437879_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_071574004.1|438593_442142_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.9	0.0e+00
WP_003129221.1|443231_444332_+	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.6e-116
WP_023094501.1|444331_444643_+	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	84.5	4.8e-44
WP_003129222.1|444639_444867_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
WP_003129224.1|445272_445878_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|445879_446929_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003129225.1|446925_447762_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	3.6e-70
>prophage 2
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	993858	1038740	6723378	holin,integrase,terminase,tRNA,lysis,portal	Pseudomonas_phage(87.27%)	64	987045:987061	1029924:1029940
987045:987061	attL	AGCGCGCGGTATGGATG	NA	NA	NA	NA
WP_078463411.1|993858_994860_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	84.0	1.9e-129
WP_031654972.1|994971_995877_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	42.0	1.2e-37
WP_023094533.1|995854_996502_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003129602.1|996574_996877_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	96.0	6.7e-51
WP_003129604.1|996873_997215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023099078.1|997219_997909_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	98.2	1.6e-124
WP_058163571.1|997905_998097_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	98.4	1.6e-29
WP_023132429.1|998215_999262_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	89.4	8.1e-35
WP_023132430.1|999264_999495_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	85.5	1.6e-28
WP_003119030.1|999569_1000367_-	Bro-N domain-containing protein	NA	A0A1W6JTB0	Pseudomonas_phage	99.6	1.1e-148
WP_003119031.1|1000377_1000668_-	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	100.0	7.4e-47
WP_058163572.1|1000678_1001062_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	99.2	2.9e-59
WP_071535011.1|1001179_1001758_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052150941.1|1002129_1002639_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	49.0	5.3e-32
WP_023099083.1|1002729_1003041_+	hypothetical protein	NA	A0A0A0YUF6	Pseudomonas_phage	91.3	1.7e-44
WP_003119033.1|1003037_1003325_+	DUF3077 domain-containing protein	NA	A0A0A0YQ33	Pseudomonas_phage	100.0	7.6e-44
WP_058163573.1|1003321_1003630_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	87.3	6.0e-39
WP_023118917.1|1003626_1003905_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	80.4	1.9e-31
WP_003119035.1|1003897_1004131_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	94.8	8.3e-33
WP_058163574.1|1004127_1004898_+	phage antirepressor protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	45.2	3.7e-45
WP_015980941.1|1004894_1005125_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	97.4	5.9e-39
WP_010791986.1|1005121_1005316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123988.1|1005315_1006200_+	hypothetical protein	NA	A0A125RNK1	Pseudomonas_phage	64.5	1.2e-42
WP_003123987.1|1006196_1006985_+	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	98.5	1.2e-144
WP_031655153.1|1007017_1008412_+	replicative DNA helicase	NA	A0A0A0YUG7	Pseudomonas_phage	96.3	1.6e-251
WP_023124260.1|1008408_1008780_+	hypothetical protein	NA	A0A0A0YQ44	Pseudomonas_phage	99.0	2.7e-49
WP_015980945.1|1008995_1009553_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	98.6	3.8e-76
WP_124174759.1|1010450_1010675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123976.1|1010859_1011192_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	95.5	1.1e-43
WP_003123975.1|1011188_1011806_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	92.2	5.2e-106
WP_031690617.1|1011802_1012045_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	53.2	1.3e-20
WP_071534556.1|1012041_1012512_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	89.7	2.9e-69
WP_023094548.1|1012508_1013252_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	96.8	1.0e-132
WP_003128031.1|1013383_1013911_+	DNA packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	48.1	4.1e-19
WP_003128032.1|1013975_1015838_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	55.9	4.4e-209
WP_003128033.1|1015837_1016041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023094550.1|1016042_1017569_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	36.0	2.0e-74
WP_003136829.1|1017576_1019532_+	hypothetical protein	NA	A0A2I7QRU0	Vibrio_phage	32.8	5.8e-87
WP_003127354.1|1019603_1019966_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_003127352.1|1020012_1020291_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	50.7	1.9e-15
WP_024928440.1|1020287_1020758_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	91.7	3.7e-80
WP_003136827.1|1020761_1020956_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	95.3	1.6e-26
WP_003129705.1|1020957_1021710_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	98.4	9.9e-136
WP_071534551.1|1021854_1022382_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	94.9	1.9e-88
WP_003129708.1|1022439_1022742_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	86.0	5.3e-40
WP_015980912.1|1022844_1025328_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	97.7	0.0e+00
WP_003159076.1|1025367_1025889_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	96.5	3.1e-96
WP_003129730.1|1025888_1027586_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	98.1	0.0e+00
WP_003129732.1|1027588_1027999_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	93.4	6.1e-55
WP_003098498.1|1027998_1028544_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	96.7	2.3e-97
WP_003129734.1|1028554_1028959_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	97.8	5.8e-66
WP_003129737.1|1028955_1030614_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	97.1	0.0e+00
1029924:1029940	attR	CATCCATACCGCGCGCT	NA	NA	NA	NA
WP_012613717.1|1030643_1031231_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	95.4	1.5e-102
WP_023094553.1|1031223_1031415_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	96.8	7.8e-29
WP_003129766.1|1031419_1031980_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	3.2e-99
WP_003129767.1|1031979_1032261_+	hypothetical protein	NA	A0A0A0YR51	Pseudomonas_phage	96.8	2.5e-44
WP_003129768.1|1032855_1033158_+	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	89.0	2.3e-43
WP_003129769.1|1033154_1033385_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	78.4	8.2e-25
WP_003129771.1|1033463_1033688_+	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	100.0	9.4e-34
WP_023094554.1|1033862_1034195_+	hypothetical protein	NA	A0A127KNU7	Pseudomonas_phage	94.9	2.5e-38
WP_023094555.1|1034384_1035362_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	49.8	2.1e-77
WP_003126233.1|1035462_1036023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003129773.1|1036565_1037609_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003100607.1|1037621_1038740_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
>prophage 3
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	1257490	1266518	6723378		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1257490_1258126_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003129949.1|1258171_1259065_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1259169_1260174_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1260599_1260923_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1260989_1263557_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1263682_1264690_-	TolB family protein	NA	NA	NA	NA	NA
WP_003129950.1|1264837_1265344_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003092260.1|1265477_1266518_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 4
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	2438779	2445673	6723378	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2438779_2440060_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003131135.1|2440061_2441459_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003108775.1|2441463_2442438_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2442525_2443509_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2443505_2443841_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2443837_2444143_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2444142_2444502_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2444498_2444894_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2445004_2445673_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 5
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	2472774	2526653	6723378	holin,terminase,integrase,head	Pseudomonas_phage(76.67%)	66	2476601:2476660	2526882:2526973
WP_023094666.1|2472774_2475660_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.9e-33
WP_003090076.1|2475750_2476284_+	hypothetical protein	NA	NA	NA	NA	NA
2476601:2476660	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_023094667.1|2476746_2477784_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	2.8e-112
WP_003158549.1|2477812_2478046_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_003130970.1|2478322_2478802_-	hypothetical protein	NA	I6NVL3	Burkholderia_virus	55.3	3.6e-22
WP_003131143.1|2480179_2480686_-	hypothetical protein	NA	L7TI83	Pseudomonas_virus	95.8	1.2e-87
WP_003126885.1|2480682_2481048_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	97.3	3.0e-61
WP_003131145.1|2481044_2481605_-	hypothetical protein	NA	H2BD41	Pseudomonas_phage	93.2	8.5e-100
WP_003126888.1|2481601_2482228_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	58.8	8.7e-61
WP_108116075.1|2482422_2482524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126889.1|2482614_2483109_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	95.1	5.4e-74
WP_003126891.1|2483105_2484791_-	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	98.2	4.0e-310
WP_153549535.1|2484906_2485233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003126892.1|2485403_2486117_-	DNA exonuclease	NA	A0A059VJT9	Pseudomonas_phage	47.3	7.2e-51
WP_003131149.1|2486166_2487909_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	92.7	2.3e-284
WP_023103950.1|2487908_2488496_-	hypothetical protein	NA	A0A2I7RT07	Vibrio_phage	39.9	6.8e-23
WP_003126905.1|2488499_2489264_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	67.8	6.0e-104
WP_003116739.1|2489276_2489477_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_003126907.1|2489483_2490374_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	9.1e-104
WP_023094674.1|2490386_2491295_-	hypothetical protein	NA	Q858E0	Salmonella_phage	71.6	2.1e-124
WP_010793152.1|2491305_2491515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2491511_2491733_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_003131166.1|2492386_2492758_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	80.5	8.3e-51
WP_003126916.1|2492793_2493006_-	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	95.7	2.0e-33
WP_071574019.1|2493234_2494665_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	93.2	1.0e-16
WP_071536250.1|2495268_2495757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023094678.1|2495803_2496469_-	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	41.5	3.5e-44
WP_023103954.1|2497014_2497527_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	97.1	9.0e-88
WP_003136886.1|2497609_2498182_+	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	98.9	4.6e-101
WP_023094680.1|2498172_2498424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016263332.1|2498461_2498644_+	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	100.0	4.5e-26
WP_031632346.1|2498636_2499158_+	HNH endonuclease	NA	Q7Y3U9	Yersinia_phage	39.7	3.9e-06
WP_023094681.1|2499157_2500006_+	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	97.8	1.1e-74
WP_016263334.1|2499998_2501414_+	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	99.4	2.6e-262
WP_023094682.1|2501406_2501850_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	1.4e-76
WP_023094683.1|2501878_2502748_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	99.0	4.8e-166
WP_004349441.1|2502862_2503252_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_016852757.1|2503244_2503529_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	97.9	5.9e-41
WP_003131202.1|2503537_2504080_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	98.3	5.0e-97
WP_023094684.1|2504063_2505317_+|terminase	PBSX family phage terminase large subunit	terminase	J7I4J3	Pseudomonas_phage	99.8	2.9e-249
WP_016852759.1|2505316_2505514_+	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	5.2e-28
WP_003127999.1|2505516_2506887_+	DUF1073 domain-containing protein	NA	J7I414	Pseudomonas_phage	99.3	4.0e-268
WP_031632796.1|2506843_2507773_+|head	SPP1 gp7 family phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	99.0	3.4e-170
WP_023094686.1|2507776_2509054_+	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.3	2.4e-214
WP_023094687.1|2509057_2509507_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.6e-77
WP_003127996.1|2509522_2510617_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	98.9	7.0e-207
WP_003127995.1|2510627_2511092_+	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	77.0	2.7e-51
WP_003131204.1|2511165_2511567_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.0	2.3e-70
WP_023094688.1|2511563_2511902_+	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	8.0e-61
WP_023124723.1|2511903_2512308_+	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	99.3	2.1e-68
WP_003127992.1|2512304_2512679_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_023094689.1|2512693_2513689_+	hypothetical protein	NA	J7HX84	Pseudomonas_phage	93.1	1.8e-156
WP_023094690.1|2513685_2514303_+	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.5	1.3e-112
WP_058168397.1|2514302_2516804_+	tape measure protein	NA	A0A127KNB7	Pseudomonas_phage	98.4	0.0e+00
WP_023094692.1|2516800_2517268_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.1	9.3e-92
WP_023094693.1|2517251_2517743_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	96.3	1.1e-87
WP_003131216.1|2517747_2518155_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	95.6	7.1e-72
WP_023094694.1|2518126_2520850_+	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	83.8	0.0e+00
WP_071564142.1|2520910_2522968_+	structural protein	NA	A0A127KNR5	Pseudomonas_phage	91.5	0.0e+00
WP_003127220.1|2523033_2523663_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	95.7	5.4e-111
WP_034014787.1|2523659_2524028_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	78.7	4.8e-43
WP_033869319.1|2524024_2524351_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	92.6	1.3e-47
WP_033869321.1|2524631_2525045_-	hypothetical protein	NA	A0A0R6PCF0	Moraxella_phage	35.4	3.8e-12
WP_003131224.1|2525165_2525429_+	hypothetical protein	NA	J7I447	Pseudomonas_phage	93.1	6.5e-42
WP_034004425.1|2525410_2526100_-	SOS response-associated peptidase	NA	A0A2K8I970	Pseudomonas_phage	94.3	2.0e-127
WP_003127962.1|2526140_2526653_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	92.3	9.2e-93
2526882:2526973	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAGTGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 6
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	3000901	3061764	6723378	integrase,transposase	Salmonella_phage(33.33%)	60	3011573:3011604	3062368:3062399
WP_003111050.1|3000901_3001873_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003111049.1|3001902_3002646_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
WP_003131866.1|3002667_3003984_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003111047.1|3004395_3005805_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
WP_003111046.1|3005820_3006549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120172.1|3006545_3007451_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003111043.1|3008091_3008454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071574024.1|3008450_3011465_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.9	9.7e-73
3011573:3011604	attL	TGAATTTTCCCCTTATCTCGGCATGACCCCTA	NA	NA	NA	NA
WP_031684005.1|3011601_3011907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023093814.1|3012201_3012759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071564125.1|3012885_3013191_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023094727.1|3013187_3013958_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
WP_003131892.1|3013957_3014659_-	PRTRC system protein B	NA	NA	NA	NA	NA
WP_023094728.1|3014648_3016016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023093819.1|3016118_3016331_-	PRTRC system protein C	NA	NA	NA	NA	NA
WP_023093820.1|3016342_3016798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023094729.1|3018903_3019239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023094730.1|3019649_3021317_+	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	70.9	7.3e-62
WP_134611741.1|3021375_3021762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153549536.1|3022308_3022470_+	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	76.2	8.9e-10
WP_031690650.1|3022537_3023308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071574026.1|3023331_3024576_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_023093834.1|3024937_3025198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033869454.1|3026546_3027137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003131908.1|3027129_3028047_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_042933573.1|3028162_3031177_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.6	8.5e-69
WP_023911045.1|3031173_3031536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003131918.1|3031862_3034319_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.1	3.3e-71
WP_079866723.1|3034315_3034561_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071574017.1|3034691_3035672_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.0	5.0e-95
WP_003131921.1|3035922_3036165_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_033869463.1|3036229_3036568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003131922.1|3036669_3037926_+	TolC family protein	NA	NA	NA	NA	NA
WP_003131923.1|3037922_3039404_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003131924.1|3039400_3042562_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003131925.1|3042558_3042915_+	copper-binding protein	NA	NA	NA	NA	NA
WP_021702869.1|3043121_3044027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033869466.1|3044121_3044784_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_021702871.1|3044940_3045216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003131929.1|3045208_3045493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021702872.1|3045528_3045858_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_125896094.1|3046019_3046349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031275454.1|3046856_3047072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003131931.1|3047261_3048581_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_003131934.1|3048603_3049347_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	44.2	6.7e-60
WP_003131935.1|3049376_3050348_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003131937.1|3050527_3051526_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003131939.1|3051564_3052209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124105.1|3052189_3052669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124104.1|3052854_3053175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058199783.1|3053219_3053558_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003131969.1|3053600_3054035_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|3054106_3054457_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|3054469_3054745_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003156770.1|3054816_3056502_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	5.5e-41
WP_000995360.1|3056519_3056885_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|3056881_3057118_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003132006.1|3057114_3058104_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|3058234_3058795_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|3058797_3061764_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
3062368:3062399	attR	TGAATTTTCCCCTTATCTCGGCATGACCCCTA	NA	NA	NA	NA
>prophage 7
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	4249129	4260102	6723378	integrase,tRNA	Pseudomonas_phage(75.0%)	16	4241554:4241570	4261620:4261636
4241554:4241570	attL	GCCGCTGTTCATCGCCG	NA	NA	NA	NA
WP_003082462.1|4249129_4249954_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_003133721.1|4250059_4251076_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	99.4	1.1e-190
WP_003133723.1|4251075_4252374_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	99.5	1.5e-259
WP_003133724.1|4252631_4253894_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	54.6	3.2e-118
WP_003133726.1|4253895_4254246_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	40.2	1.6e-19
WP_003124953.1|4255587_4255806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|4255819_4256071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4256082_4256175_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_023127730.1|4256191_4256620_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.1	2.7e-61
WP_034032825.1|4256754_4257132_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	97.6	5.3e-61
WP_071543054.1|4257135_4257423_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	93.6	5.8e-52
WP_031690662.1|4257421_4257640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023094825.1|4257645_4257861_-	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	67.6	1.4e-23
WP_033869600.1|4257957_4258380_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	31.7	1.6e-05
WP_003133804.1|4258429_4259050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023094826.1|4259052_4260102_+	DUF262 domain-containing protein	NA	K4JUV4	Caulobacter_phage	31.6	7.9e-06
4261620:4261636	attR	GCCGCTGTTCATCGCCG	NA	NA	NA	NA
>prophage 8
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	4905129	4913681	6723378	coat	Pseudomonas_phage(77.78%)	11	NA	NA
WP_003134394.1|4905129_4906422_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.7	1.0e-244
WP_023127773.1|4906651_4907935_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	96.5	1.1e-227
WP_003114150.1|4907938_4908295_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_031757282.1|4908299_4909613_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	54.8	3.7e-45
WP_003125072.1|4909764_4910013_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|4910025_4910277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|4910289_4910382_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003140508.1|4910398_4910833_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003133746.1|4911347_4911992_-	DNA cytosine methyltransferase	NA	E3SMD8	Cyanophage	64.4	4.3e-63
WP_003125079.1|4912988_4913258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809168.1|4913387_4913681_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	38.5	2.3e-11
>prophage 9
NZ_CP017969	Pseudomonas aeruginosa isolate B10W, complete genome	6723378	5402955	5438021	6723378	coat,integrase,tRNA	Pseudomonas_phage(64.29%)	37	5408245:5408265	5433300:5433320
WP_003135087.1|5402955_5403504_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|5403534_5404068_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003125348.1|5404067_5404610_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099335.1|5404628_5405417_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023124830.1|5405433_5407806_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003135106.1|5407802_5408750_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
5408245:5408265	attL	TGACCCTGCCGGCCGGCACCT	NA	NA	NA	NA
WP_003135108.1|5408751_5410125_-	MFS transporter	NA	NA	NA	NA	NA
WP_003094982.1|5410404_5411427_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003135111.1|5411423_5412341_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003094987.1|5412754_5413738_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023094965.1|5413890_5414847_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003135124.1|5414856_5415756_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_003135126.1|5415752_5417198_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.4e-45
WP_003099307.1|5417323_5417845_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|5417978_5418776_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003135128.1|5418765_5419524_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003114694.1|5419517_5420348_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003094997.1|5420349_5421432_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	4.3e-07
WP_003095001.1|5421449_5422718_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003135130.1|5422861_5424634_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|5424638_5425256_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003135132.1|5425257_5426106_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|5426272_5427214_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003095013.1|5427330_5427945_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|5427986_5428571_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|5428611_5429712_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_023094967.1|5430030_5430468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003135135.1|5430514_5431522_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	6.3e-77
WP_004352686.1|5431518_5432811_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.3	1.8e-241
WP_023127811.1|5433040_5434324_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.3	2.7e-234
5433300:5433320	attR	AGGTGCCGGCCGGCAGGGTCA	NA	NA	NA	NA
WP_003114150.1|5434327_5434684_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_031759488.1|5434688_5435996_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	55.5	5.9e-51
WP_003125072.1|5436147_5436396_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|5436408_5436660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5436672_5436765_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003133730.1|5436781_5437216_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	86.1	8.7e-60
WP_031757220.1|5437730_5438021_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	5.6e-55
