The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	632427	741997	7018690	plate,tail,tRNA,portal,head,capsid,lysis,transposase,terminase	Pseudomonas_phage(57.69%)	116	NA	NA
WP_076611796.1|632427_633804_+|transposase	IS30-like element ISPa37 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.7	1.1e-42
WP_019725766.1|636193_636376_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	54.2	2.2e-09
WP_019725767.1|636408_636831_+	transcriptional regulator	NA	A0A2H4JFV9	uncultured_Caudovirales_phage	46.7	6.1e-26
WP_025982283.1|637076_638048_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	93.8	2.2e-172
WP_019725770.1|638032_638725_-	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	36.5	3.6e-39
WP_025982284.1|638721_639264_-	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	87.1	1.0e-81
WP_019725772.1|639260_640184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100199590.1|640180_640498_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	70.3	3.3e-32
WP_079386531.1|640653_643275_-	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	54.0	3.1e-160
WP_019725775.1|643284_643809_-	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	93.7	1.2e-90
WP_034018116.1|643801_644974_-	phage protein	NA	A0A0U4JJ14	Pseudomonas_phage	91.3	4.0e-208
WP_019725777.1|644970_645288_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	94.2	1.2e-45
WP_034008995.1|645284_647654_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	74.7	1.4e-239
WP_019725780.1|647831_648128_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	77.7	1.4e-32
WP_019725781.1|648124_648640_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	73.2	5.9e-47
WP_019725782.1|648636_649098_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	95.4	7.8e-75
WP_100199591.1|649094_649349_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	38.0	2.9e-07
WP_019725784.1|649396_649609_-	hypothetical protein	NA	A0A0U4IIN4	Pseudomonas_phage	81.2	1.8e-26
WP_023122750.1|649608_650058_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	85.2	4.0e-68
WP_019725786.1|650061_651177_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	83.0	1.1e-175
WP_023126976.1|651189_651858_-	hypothetical protein	NA	A0A0U4ISN1	Pseudomonas_phage	92.6	6.4e-110
WP_019725788.1|651850_652288_-|tail	tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	91.0	3.8e-71
WP_019725789.1|652287_652749_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	95.4	3.8e-77
WP_019725790.1|652846_653581_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	100.0	7.7e-133
WP_012074147.1|653577_654600_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
WP_019725791.1|654599_655553_-	hypothetical protein	NA	A0A0U4JVV6	Pseudomonas_phage	100.0	2.7e-146
WP_034084904.1|655710_657759_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	100.0	0.0e+00
WP_019725793.1|657598_658525_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	100.0	3.3e-133
WP_019725794.1|658569_658827_+	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	42.9	3.6e-13
WP_019725795.1|659392_659671_-	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	100.0	1.4e-47
WP_019725796.1|659667_659898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725797.1|659894_660140_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	100.0	1.0e-36
WP_019725798.1|660132_660399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725799.1|660469_660829_-	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	100.0	3.5e-62
WP_100199592.1|660858_661182_-	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	100.0	4.4e-56
WP_019725801.1|661221_661623_-	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	100.0	6.4e-73
WP_019725802.1|662064_664755_-	hypothetical protein	NA	A0A0U3TH43	Pseudomonas_phage	100.0	0.0e+00
WP_019725803.1|664764_664995_-	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	100.0	8.2e-33
WP_019725804.1|665092_665332_+	helix-turn-helix transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	100.0	2.6e-37
WP_019725805.1|666556_670294_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
WP_003085035.1|670400_672254_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_019725806.1|672333_674328_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085042.1|674410_674860_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003085057.1|674929_675145_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003129196.1|675345_676371_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|676449_677019_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|677102_677456_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|677446_677989_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_019725807.1|677961_679194_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	4.5e-77
WP_003085071.1|679237_679744_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|679837_681391_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|681387_682659_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|682759_684682_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|684960_685293_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|685336_686188_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|686187_686568_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_019725808.1|686604_687411_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|687526_688513_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|688509_689802_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003113209.1|689782_692557_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793494.1|692683_693700_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010793493.1|693696_694371_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_019725809.1|694372_695131_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_019725810.1|695131_696193_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_019725811.1|696344_698738_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|698783_699416_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|699544_700579_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|700812_701922_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|701977_703024_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|703138_704386_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|704491_705322_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|705445_706120_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003113205.1|706119_706938_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003113204.1|707010_708489_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|708807_709122_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|709221_709992_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_016263868.1|710076_710247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|710449_710650_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|710697_711057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|711420_711870_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003113200.1|711891_712407_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003118909.1|712403_712961_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|713113_713440_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003118910.1|713436_714324_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	1.2e-87
WP_003118911.1|714316_714850_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_003123931.1|714851_716927_+	bacteriophage protein	NA	Q9ZXK6	Pseudomonas_virus	50.5	1.3e-198
WP_003118913.1|716923_717382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118914.1|717424_718585_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.7	1.2e-188
WP_003085175.1|718597_719101_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|719115_719460_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003118915.1|719629_721867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118916.1|721876_722749_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	1.1e-74
WP_003101635.1|722723_722930_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003109053.1|722987_723977_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.3e-106
WP_003118917.1|724009_724639_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003118918.1|724635_724998_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|724994_725252_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|725567_726062_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|726073_726421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|726450_726705_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113187.1|726751_728587_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
WP_003113186.1|728579_728921_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_010793484.1|728928_729624_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	7.4e-69
WP_003113184.1|729626_730397_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003113183.1|730451_731054_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.8	2.2e-53
WP_019725813.1|731112_734727_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	54.6	0.0e+00
WP_003118927.1|734962_735751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|735774_736866_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|736865_737201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010895513.1|737181_737412_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	62.7	3.3e-18
WP_003113178.1|737507_738560_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.2	4.6e-62
WP_003113177.1|738559_738862_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003113176.1|738858_739089_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	8.2e-25
WP_003113175.1|739507_740113_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	4.6e-75
WP_003085203.1|740114_741164_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|741160_741997_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	1486921	1495949	7018690		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1486921_1487557_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1487602_1488496_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1488600_1489605_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003119354.1|1490030_1490354_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003113873.1|1490420_1492988_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003117491.1|1493113_1494121_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1494268_1494775_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1494908_1495949_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	2341813	2392599	7018690	integrase,tRNA,protease,portal,head,terminase	uncultured_Caudovirales_phage(23.81%)	60	2330703:2330719	2386099:2386115
2330703:2330719	attL	TGGCATCGCCGAGCGCC	NA	NA	NA	NA
WP_003090915.1|2341813_2342689_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_003115276.1|2342822_2343275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003090913.1|2343326_2344538_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003090911.1|2344722_2345121_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003090910.1|2345232_2345718_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	8.1e-22
WP_003114767.1|2345714_2346206_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003158678.1|2346224_2348585_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.3	1.8e-45
WP_003143737.1|2348667_2349558_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003090905.1|2349554_2350037_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003114770.1|2350046_2350709_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003090903.1|2350770_2351544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003143739.1|2352499_2354077_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003090890.1|2354143_2354554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003119883.1|2354612_2354993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003108955.1|2355121_2357569_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003098789.1|2357721_2358393_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_003108953.1|2358507_2359128_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_003090885.1|2359203_2360136_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	2.4e-22
WP_003090884.1|2360132_2360912_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003090883.1|2360961_2362293_-	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-12
WP_003098784.1|2362289_2362970_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	1.4e-27
WP_003090881.1|2363095_2363287_+	repressor PtrA	NA	NA	NA	NA	NA
WP_003119888.1|2363458_2364076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098780.1|2364193_2365024_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.0	1.3e-32
WP_014602745.1|2365090_2365354_-	DUF4404 family protein	NA	NA	NA	NA	NA
WP_003090877.1|2365427_2366009_-	HD domain-containing protein	NA	A0A2K9L4U0	Tupanvirus	37.1	7.7e-19
WP_003114775.1|2366005_2366749_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003104061.1|2366882_2367602_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_004350269.1|2367603_2368008_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003114777.1|2368110_2368815_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_003104055.1|2368872_2369172_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_003119890.1|2369418_2370603_+	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	7.3e-08
WP_003104052.1|2370599_2371082_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003090868.1|2371169_2372093_-	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	30.0	6.5e-12
WP_019726496.1|2372172_2373153_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_031627948.1|2373335_2374451_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	60.3	2.1e-118
WP_003130859.1|2374424_2374700_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_019726493.1|2374803_2375016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130861.1|2375012_2376893_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	43.2	1.2e-132
WP_019726492.1|2376889_2377369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726491.1|2377378_2377618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726490.1|2377614_2378241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726489.1|2378291_2378609_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_019726488.1|2378605_2378836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727252.1|2378986_2379280_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_019726486.1|2379289_2379601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726485.1|2379883_2380597_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	35.8	1.4e-22
WP_019726484.1|2380703_2380958_+	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_019726483.1|2381275_2381830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003130865.1|2381822_2382032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726482.1|2382028_2384242_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	46.8	1.5e-187
WP_019396873.1|2384238_2384610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726481.1|2385182_2385533_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	48.6	2.8e-16
WP_019726480.1|2385529_2386267_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	8.8e-44
2386099:2386115	attR	TGGCATCGCCGAGCGCC	NA	NA	NA	NA
WP_019726479.1|2386521_2387097_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	56.4	1.2e-45
WP_019726478.1|2387099_2389109_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	71.4	7.7e-268
WP_004353026.1|2389120_2389345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726477.1|2389344_2390811_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	66.0	1.1e-175
WP_019726476.1|2390794_2391967_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	6.6e-86
WP_019726475.1|2391963_2392599_+|head	head decoration protein	head	NA	NA	NA	NA
>prophage 4
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	2643804	2702662	7018690	protease,transposase,integrase,tRNA	uncultured_Caudovirales_phage(31.25%)	56	2694288:2694309	2711074:2711095
WP_003097649.1|2643804_2644173_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.6	4.9e-11
WP_071501032.1|2644200_2646477_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.7	1.3e-162
WP_002553999.1|2646558_2646777_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003097644.1|2646881_2647589_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003160442.1|2647643_2648324_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_003090421.1|2648361_2649312_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.0	9.2e-62
WP_003119977.1|2649539_2651975_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	52.8	1.9e-87
WP_003090414.1|2652000_2652627_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003097632.1|2652636_2653962_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.2	1.2e-80
WP_003097631.1|2654083_2655364_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|2655365_2656763_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2656767_2657742_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2657829_2658813_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003090393.1|2658809_2659145_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2659141_2659447_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2659446_2659806_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003097619.1|2659802_2660198_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	71.3	4.5e-47
WP_003090386.1|2660308_2660977_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_017001968.1|2661330_2662914_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_017149109.1|2662910_2663516_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_019726383.1|2663628_2664525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003130938.1|2664864_2665932_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003097609.1|2665941_2666886_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097607.1|2666895_2667978_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003162150.1|2667982_2669134_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_019726382.1|2669241_2670228_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019726381.1|2670239_2671196_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097598.1|2671331_2672291_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003090369.1|2672357_2672930_-	quorum threshold expression protein QteE	NA	NA	NA	NA	NA
WP_003090368.1|2673136_2674240_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003097562.1|2674392_2675199_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017001947.1|2675318_2677973_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.4	6.4e-12
WP_019726380.1|2677983_2679198_+	MFS transporter	NA	NA	NA	NA	NA
WP_003097554.1|2679213_2680242_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016562005.1|2680859_2682008_+	2-heptyl-3-hydroxy-4(1H)-quinolone synthase	NA	NA	NA	NA	NA
WP_003090351.1|2682349_2682994_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_003097551.1|2682994_2684821_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003090349.1|2684854_2685415_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_019726379.1|2685785_2687729_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	48.0	4.7e-97
WP_009459580.1|2687766_2688735_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_019726377.1|2688853_2689507_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009459591.1|2689626_2689920_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019726376.1|2689942_2690833_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009459598.1|2691336_2692551_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_124136468.1|2692959_2693796_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	3.4e-28
WP_071535812.1|2693876_2694164_-|transposase	transposase	transposase	NA	NA	NA	NA
2694288:2694309	attL	AACAACGTCCCTGGACATCACA	NA	NA	NA	NA
WP_019726375.1|2694501_2694783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726374.1|2694779_2695508_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_019726373.1|2695504_2695846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726372.1|2695955_2696378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726371.1|2696358_2697177_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_019726370.1|2697179_2697764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726369.1|2697770_2698688_-	XamI family restriction endonuclease	NA	NA	NA	NA	NA
WP_019726368.1|2698684_2700313_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_133422412.1|2700344_2700929_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	56.7	2.5e-49
WP_019726366.1|2701753_2702662_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.6e-47
2711074:2711095	attR	TGTGATGTCCAGGGACGTTGTT	NA	NA	NA	NA
>prophage 5
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	2786173	2839664	7018690	holin,integrase,tail,head,terminase	Pseudomonas_phage(61.54%)	62	2789999:2790058	2839892:2839983
WP_023123608.1|2786173_2789059_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.4e-33
WP_019726330.1|2789149_2789683_+	hypothetical protein	NA	NA	NA	NA	NA
2789999:2790058	attL	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCC	NA	NA	NA	NA
WP_003099003.1|2790144_2791182_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	1.1e-111
WP_003158549.1|2791210_2791444_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	50.7	5.6e-13
WP_031639984.1|2791500_2791887_-	hypothetical protein	NA	L7TJJ9	Pseudomonas_virus	98.4	4.0e-64
WP_019727237.1|2791998_2792841_-	hypothetical protein	NA	L7TKP8	Pseudomonas_virus	49.1	6.4e-75
WP_019727236.1|2793039_2793801_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	96.8	3.1e-145
WP_019727235.1|2793797_2794439_-	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	95.3	1.7e-120
WP_019727234.1|2794435_2795080_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	82.2	2.3e-93
WP_031639982.1|2795205_2795901_+	DUF4145 domain-containing protein	NA	A0A1S5S8Y9	Streptococcus_phage	50.6	1.3e-41
WP_019727232.1|2795897_2797595_-	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	95.9	1.4e-302
WP_019727231.1|2797976_2798843_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	97.5	4.6e-161
WP_019727230.1|2798986_2799700_-	DNA exonuclease	NA	A0A059VJT9	Pseudomonas_phage	48.1	1.1e-51
WP_019727229.1|2799749_2801495_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	75.9	1.4e-233
WP_019727228.1|2801498_2802479_-	cell division protein FtsK	NA	H2BD47	Pseudomonas_phage	63.8	5.3e-97
WP_009314053.1|2802491_2802692_-	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_019727227.1|2802698_2803598_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.2	2.0e-103
WP_019727226.1|2803610_2804519_-	endonuclease	NA	Q858E0	Salmonella_phage	72.0	9.5e-125
WP_019727225.1|2804529_2804739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003099037.1|2804735_2804957_-	hypothetical protein	NA	H2BD53	Pseudomonas_phage	100.0	1.2e-33
WP_019727224.1|2805481_2805730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019727223.1|2805743_2806112_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	98.4	1.2e-62
WP_019727222.1|2806144_2806408_-	hypothetical protein	NA	H2BD57	Pseudomonas_phage	97.7	8.2e-45
WP_019727221.1|2806967_2807219_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	44.6	5.8e-08
WP_100199349.1|2807352_2808048_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	60.8	4.1e-51
WP_019727219.1|2808115_2808346_+	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	70.6	7.4e-18
WP_009314063.1|2808386_2808983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025981548.1|2808986_2809871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727218.1|2809920_2810529_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	51.3	1.0e-42
WP_019727217.1|2810521_2810965_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	98.0	6.1e-77
WP_003116756.1|2810993_2811680_+	hypothetical protein	NA	H2BD72	Pseudomonas_phage	100.0	9.7e-130
WP_004349441.1|2811794_2812184_+	hypothetical protein	NA	H2BD73	Pseudomonas_phage	100.0	9.9e-63
WP_019727216.1|2812176_2812461_+|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	98.9	2.7e-41
WP_019727215.1|2812469_2813066_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	59.9	1.3e-45
WP_019727214.1|2813052_2814354_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.3	1.1e-145
WP_019727213.1|2814362_2815787_+	DUF4055 domain-containing protein	NA	A0A2H4J5M6	uncultured_Caudovirales_phage	36.0	3.0e-72
WP_019727212.1|2815776_2816820_+|head	head morphogenesis protein	head	A0A1B0VMF3	Pseudomonas_phage	34.1	2.5e-44
WP_019727211.1|2816885_2817134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727210.1|2817217_2817928_+	hypothetical protein	NA	A0A2H4J0Y0	uncultured_Caudovirales_phage	62.4	6.3e-39
WP_019727209.1|2817940_2818909_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	66.0	2.1e-114
WP_019727208.1|2818957_2819176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727207.1|2819215_2819608_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	34.6	7.7e-07
WP_019727206.1|2819610_2819991_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	54.4	4.0e-32
WP_019727205.1|2819993_2820554_+	hypothetical protein	NA	A0A1B0VMI1	Pseudomonas_phage	37.7	7.6e-24
WP_019727204.1|2820550_2820958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727203.1|2821019_2822189_+	Ig-like domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.1	2.2e-57
WP_019727202.1|2822247_2822736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535787.1|2822855_2823131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019727201.1|2823081_2826363_+|tail	tail length tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.5	1.2e-95
WP_019727200.1|2826362_2826833_+	hypothetical protein	NA	A0A125RNN3	Pseudomonas_phage	41.1	3.9e-29
WP_019727199.1|2826834_2827320_+	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	47.8	3.2e-34
WP_019727198.1|2827323_2827737_+	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.4	4.3e-40
WP_025981546.1|2827702_2830450_+	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	47.7	3.9e-238
WP_019727196.1|2830516_2832769_+	hypothetical protein	NA	H2BDD0	Pseudomonas_virus	94.6	0.0e+00
WP_025981544.1|2833171_2835235_+	acyltransferase	NA	Q9MC93	Pseudomonas_phage	96.8	0.0e+00
WP_019727195.1|2835308_2836469_-	polymerase	NA	H2BD97	Pseudomonas_phage	96.9	8.0e-201
WP_019727194.1|2836553_2837183_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	96.2	3.8e-112
WP_019727193.1|2837179_2837548_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	66.4	7.7e-33
WP_025981543.1|2837616_2837883_+	hypothetical protein	NA	J7I0U5	Pseudomonas_phage	93.2	2.6e-38
WP_019727191.1|2837918_2838185_+	hypothetical protein	NA	L7TP56	Pseudomonas_virus	97.7	1.8e-44
WP_019727190.1|2838166_2838853_-	DUF159 family protein	NA	A0A2K8I970	Pseudomonas_phage	89.9	9.7e-122
WP_019727188.1|2839148_2839664_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	94.2	3.8e-94
2839892:2839983	attR	CGGATTGCAAATCCGTGAACGCCGGTTCGATTCCGACCTCAGCCTCCAACAGGAAAGCCCCGTAGCTCAGTGAGTTACGGGGCTTTTTTCTT	NA	NA	NA	NA
>prophage 6
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	3285158	3339864	7018690	plate,integrase,tail,protease,head,transposase	Pseudomonas_phage(36.17%)	72	3296443:3296459	3322400:3322416
WP_019726198.1|3285158_3286703_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003089328.1|3286703_3287366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726197.1|3287362_3288034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726196.1|3288030_3289488_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003089323.1|3289494_3289923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122741.1|3290210_3291065_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003117819.1|3291077_3291770_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	78.5	1.0e-102
WP_003112098.1|3291781_3292252_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	69.2	1.3e-53
WP_003124660.1|3293566_3293917_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	62.5	5.1e-34
WP_003113750.1|3293995_3294886_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003160271.1|3295094_3296156_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	44.7	1.8e-82
WP_003089304.1|3296180_3296558_-	hypothetical protein	NA	NA	NA	NA	NA
3296443:3296459	attL	GACAACTGGCTGGCGGG	NA	NA	NA	NA
WP_003089301.1|3296635_3297106_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003110751.1|3297113_3298811_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003089295.1|3298932_3299448_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003113746.1|3299455_3300046_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003158930.1|3300192_3301398_+	MFS transporter	NA	NA	NA	NA	NA
WP_003089287.1|3301361_3302432_-	C26 family cysteine hydrolase domain-containing family	NA	NA	NA	NA	NA
WP_003117815.1|3302518_3303415_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019726690.1|3303573_3303954_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_019396420.1|3303938_3304361_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	52.6	7.8e-29
WP_019726691.1|3304360_3304804_-	hypothetical protein	NA	A0A076FX15	Pseudomonas_phage	72.4	4.3e-62
WP_025981565.1|3304806_3305202_-	hypothetical protein	NA	J9SNQ5	Pseudomonas_phage	92.3	2.0e-63
WP_019726693.1|3305203_3305827_-	DUF3164 family protein	NA	A0A0S4L2U9	Pseudomonas_phage	97.6	8.0e-107
WP_019726694.1|3305819_3306464_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	84.0	8.8e-16
WP_023434357.1|3306463_3306769_-	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	99.0	2.4e-48
WP_019726696.1|3306765_3307104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726697.1|3307105_3308338_-	AAA family ATPase	NA	J9SNL1	Pseudomonas_phage	47.2	5.9e-85
WP_019726698.1|3308347_3310123_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	32.8	1.4e-74
WP_019726699.1|3310146_3311109_-	hypothetical protein	NA	J9RW58	Pseudomonas_phage	74.6	7.3e-75
WP_019726700.1|3311154_3311469_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	80.8	2.8e-39
WP_019726701.1|3311465_3311726_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	88.4	9.0e-36
WP_019726702.1|3311718_3312204_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	54.1	1.2e-44
WP_019396407.1|3312538_3312763_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	87.3	2.0e-28
WP_019726703.1|3312882_3313296_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	58.6	1.4e-27
WP_124089521.1|3313308_3313908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726704.1|3314058_3314526_+	structural protein	NA	J9Q7Y7	Salmonella_phage	53.4	1.7e-37
WP_019726705.1|3314522_3314744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726706.1|3314918_3315530_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	52.7	4.5e-46
WP_019726707.1|3315536_3315764_+	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	43.7	3.1e-08
WP_019683422.1|3315769_3316048_+	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	43.6	5.3e-10
WP_019726708.1|3316044_3316338_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	67.7	7.8e-28
WP_025981567.1|3316339_3316891_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	45.3	3.9e-28
WP_019396461.1|3316887_3318507_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	45.3	4.3e-112
WP_019726710.1|3318503_3320000_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	59.2	8.0e-161
WP_019726711.1|3320020_3320815_+|head	phage head morphogenesis protein	head	A0A1C6ZDL9	Pseudomonas_phage	61.8	5.8e-86
WP_019726712.1|3320811_3321294_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	36.6	6.0e-17
WP_019726713.1|3321528_3322632_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	47.2	8.7e-88
3322400:3322416	attR	CCCGCCAGCCAGTTGTC	NA	NA	NA	NA
WP_019396458.1|3322647_3323571_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	50.8	3.2e-83
WP_019726714.1|3323578_3323908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726715.1|3323911_3324244_+	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	58.2	9.1e-25
WP_019681673.1|3324246_3324678_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	56.2	1.4e-38
WP_019396454.1|3324677_3325157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396453.1|3325153_3325390_+	hypothetical protein	NA	A4JWK4	Burkholderia_virus	44.6	3.3e-05
WP_019396452.1|3325386_3326814_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	65.3	1.5e-180
WP_019396451.1|3326814_3327339_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	56.6	4.2e-48
WP_019726716.1|3327339_3327783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726717.1|3327829_3328009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726718.1|3328176_3328491_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_019726719.1|3328550_3328808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726720.1|3328827_3331515_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	35.8	1.3e-97
WP_019726721.1|3331514_3332384_+|tail	phage tail protein	tail	A0A067ZI88	Vibrio_phage	32.5	7.7e-07
WP_019396445.1|3332383_3332599_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	54.4	1.0e-16
WP_019727261.1|3332598_3333693_+	regulatory protein	NA	Q6QIA2	Burkholderia_phage	40.7	2.3e-64
WP_019726723.1|3333689_3334220_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	33.2	5.5e-16
WP_019726724.1|3334283_3334667_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.2	7.3e-34
WP_019726725.1|3334644_3335766_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	49.5	2.7e-89
WP_019726726.1|3335758_3336313_+|tail	tail fiber protein	tail	Q6QI98	Burkholderia_phage	52.6	7.8e-45
WP_033940591.1|3336312_3338316_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	39.7	4.9e-105
WP_019726728.1|3338468_3338771_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	68.8	6.5e-30
WP_071535791.1|3338905_3339100_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	58.7	2.3e-12
WP_019726729.1|3339069_3339864_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	87.5	1.1e-137
>prophage 7
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	4786684	4837186	7018690	integrase,terminase	Pseudomonas_phage(84.48%)	65	4831310:4831324	4838352:4838366
WP_003120644.1|4786684_4787677_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.0	1.1e-09
WP_070410971.1|4788204_4788468_-	hypothetical protein	NA	A0A0S2SYE1	Pseudomonas_phage	95.4	4.1e-44
WP_023087410.1|4788503_4788767_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	89.5	1.2e-35
WP_070410972.1|4788763_4789132_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.8	1.8e-45
WP_070410973.1|4789128_4789563_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	94.4	7.6e-72
WP_019395862.1|4789893_4790226_-	hypothetical protein	NA	A0A127KNU7	Pseudomonas_phage	97.5	1.0e-39
WP_033982014.1|4790921_4791782_+	Bro-N domain-containing protein	NA	B5WZU1	Pseudomonas_phage	93.0	3.5e-153
WP_033982031.1|4791867_4792179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033982017.1|4792171_4792453_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_070410974.1|4794762_4797504_-	hypothetical protein	NA	H2BD95	Pseudomonas_phage	96.7	0.0e+00
WP_031634252.1|4797475_4797883_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	96.3	3.2e-72
WP_058147238.1|4797887_4798379_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	95.7	1.9e-87
WP_049268508.1|4798362_4798830_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.7	1.9e-92
WP_079864580.1|4798826_4801316_-	tape measure protein	NA	J7HXG0	Pseudomonas_phage	91.0	0.0e+00
WP_034074110.1|4801315_4801933_-	hypothetical protein	NA	H2BD90	Pseudomonas_phage	99.5	1.5e-113
WP_070410975.1|4801929_4802925_-	Ig domain-containing protein	NA	J7HX84	Pseudomonas_phage	99.4	1.0e-167
WP_070410976.1|4802939_4803314_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	99.2	7.5e-68
WP_070410977.1|4803310_4803715_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	97.8	5.3e-67
WP_070410978.1|4803716_4804037_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	93.4	2.4e-54
WP_079384193.1|4804036_4804660_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_034049385.1|4804663_4805065_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	98.5	5.6e-69
WP_023434426.1|4805577_4806672_-	hypothetical protein	NA	H2BD82	Pseudomonas_phage	99.7	1.3e-208
WP_033979153.1|4806687_4807137_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	99.3	1.3e-77
WP_070410980.1|4807140_4808418_-	hypothetical protein	NA	H2BD80	Pseudomonas_phage	99.3	2.4e-214
WP_070410981.1|4810114_4811485_-	DUF1073 domain-containing protein	NA	H2BD78	Pseudomonas_phage	98.0	1.3e-263
WP_014603761.1|4811487_4811685_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
WP_070410982.1|4811684_4813148_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	83.5	9.0e-242
WP_044719990.1|4813137_4813722_-|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
WP_014603758.1|4813712_4813985_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
WP_023434898.1|4813987_4814320_-	peptidase M48	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
WP_044264636.1|4815527_4816214_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	92.5	3.0e-123
WP_044264639.1|4816210_4816792_-	recombination protein NinG	NA	A0A125RNK9	Pseudomonas_phage	86.1	6.8e-92
WP_070410983.1|4816898_4817207_-	hypothetical protein	NA	Q9MC48	Pseudomonas_phage	97.0	4.8e-52
WP_033992168.1|4817203_4817791_-	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.0	2.1e-109
WP_146770467.1|4817783_4818053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012614007.1|4818168_4819998_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	94.7	0.0e+00
WP_070410984.1|4819994_4820912_-	YdaU family protein	NA	Q8W642	Enterobacteria_phage	55.6	7.9e-18
WP_023120645.1|4820908_4821097_-	hypothetical protein	NA	A0A0U4IIX2	Pseudomonas_phage	90.3	3.0e-25
WP_023106498.1|4821290_4821602_-	hypothetical protein	NA	H6WRX6	Salmonella_phage	50.6	1.8e-14
WP_023093583.1|4821603_4821825_-	helix-turn-helix domain-containing protein	NA	A0A125RNS7	Pseudomonas_phage	97.3	6.4e-35
WP_023093584.1|4821912_4822587_+	helix-turn-helix transcriptional regulator	NA	A0A125RNS6	Pseudomonas_phage	99.1	9.2e-125
WP_070410985.1|4823198_4823483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070410986.1|4823528_4823711_+	hypothetical protein	NA	W6MYA9	Pseudomonas_phage	96.7	2.7e-31
WP_079382711.1|4824005_4824224_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	38.0	8.9e-05
WP_101151849.1|4824240_4824468_+	hypothetical protein	NA	Q9MBK6	Pseudomonas_phage	98.7	3.0e-35
WP_135804762.1|4824501_4824690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096306487.1|4824999_4825419_+	hypothetical protein	NA	A0A0S2SY96	Pseudomonas_phage	97.8	1.5e-72
WP_070410987.1|4825415_4825952_+	hypothetical protein	NA	Q9MC57	Pseudomonas_phage	71.0	4.2e-72
WP_070410988.1|4825948_4826236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070410989.1|4826342_4826702_+	hypothetical protein	NA	B5WZW7	Pseudomonas_phage	95.8	1.3e-64
WP_070410990.1|4827006_4828071_+	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	96.6	1.2e-86
WP_079864584.1|4828211_4828832_+	ERF family protein	NA	Q9MC70	Pseudomonas_phage	100.0	2.3e-106
WP_070410991.1|4828835_4829456_+	exonuclease	NA	A0A125RNR2	Pseudomonas_phage	95.1	2.0e-113
WP_034057829.1|4829452_4829899_+	single-stranded DNA-binding protein	NA	V5YTC4	Pseudomonas_phage	49.5	9.7e-22
WP_070410992.1|4829962_4830562_+	hypothetical protein	NA	W6MVF6	Pseudomonas_phage	97.0	4.5e-107
WP_023980861.1|4830754_4830937_+	hypothetical protein	NA	W6MVM0	Pseudomonas_phage	100.0	2.6e-26
WP_070410993.1|4830933_4831677_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	84.4	1.5e-19
4831310:4831324	attL	CGAAGGTGCCGGGCG	NA	NA	NA	NA
WP_070410994.1|4832144_4832327_+	hypothetical protein	NA	A0A0S2SY76	Pseudomonas_phage	89.4	1.1e-27
WP_034066157.1|4832319_4832619_+	hypothetical protein	NA	A0A0S2SY28	Pseudomonas_phage	100.0	5.6e-58
WP_070410995.1|4832926_4833412_+	hypothetical protein	NA	A0A127KNP4	Pseudomonas_phage	98.8	5.0e-88
WP_070411006.1|4833423_4833702_+	hypothetical protein	NA	V5JXG1	Pseudomonas_phage	96.6	1.3e-27
WP_079864582.1|4833640_4834195_+	HNH endonuclease	NA	A8HNZ9	Thalassomonas_phage	42.2	1.2e-26
WP_070410997.1|4834562_4834901_+	hypothetical protein	NA	Q9MC83	Pseudomonas_phage	63.4	1.4e-25
WP_070410998.1|4835208_4836183_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	90.7	3.8e-164
WP_003108622.1|4836475_4837186_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	1.5e-40
4838352:4838366	attR	CGAAGGTGCCGGGCG	NA	NA	NA	NA
>prophage 8
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	5136224	5146407	7018690		Pseudomonas_phage(42.86%)	10	NA	NA
WP_031632187.1|5136224_5136491_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	88.6	3.0e-39
WP_031632188.1|5136559_5137363_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	64.7	1.6e-99
WP_033964234.1|5137507_5137768_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	76.7	6.2e-29
WP_079866817.1|5137764_5138133_-	hypothetical protein	NA	A0A125RNP2	Pseudomonas_phage	91.5	5.0e-16
WP_071501038.1|5138129_5138759_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	89.0	2.7e-102
WP_003096116.1|5139004_5139241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325096.1|5139240_5141001_-	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.4	7.5e-25
WP_071501048.1|5140997_5141858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016561962.1|5141854_5142856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034052276.1|5142855_5146407_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	34.9	2.9e-177
>prophage 9
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	5152791	5174954	7018690	holin,integrase,protease,portal,head,capsid,terminase	uncultured_Caudovirales_phage(56.25%)	28	5143330:5143344	5176238:5176252
5143330:5143344	attL	CGCCAGCGCTTCGCC	NA	NA	NA	NA
WP_071501040.1|5152791_5153790_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	64.7	1.1e-121
WP_023096402.1|5153857_5154493_-|head	head decoration protein	head	NA	NA	NA	NA
WP_019726635.1|5154489_5155662_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	5.1e-86
WP_019726636.1|5155645_5157112_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	65.8	2.5e-175
WP_004353026.1|5157111_5157336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726637.1|5157347_5159363_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	67.8	6.1e-257
WP_019726638.1|5159366_5159957_-	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	55.3	1.2e-46
WP_019726639.1|5160212_5160950_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.6	1.1e-43
WP_025325111.1|5160952_5161231_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004353017.1|5161235_5161601_-	hypothetical protein	NA	E5E3W4	Burkholderia_phage	48.2	1.0e-13
WP_128568836.1|5161799_5162357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071501041.1|5162696_5165435_-	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	63.9	0.0e+00
WP_019726642.1|5165431_5165674_-	repressor, PtrB	NA	Q9ZXI6	Pseudomonas_virus	53.0	2.7e-10
WP_033980361.1|5165666_5166167_-	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.0	8.0e-33
WP_019726644.1|5166373_5166577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680740.1|5166766_5166997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451259.1|5167228_5167786_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	44.0	2.9e-23
WP_028680742.1|5168078_5168387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680743.1|5168383_5168953_+	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	49.5	8.0e-45
WP_028680744.1|5168964_5169249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680745.1|5169245_5169614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726652.1|5169610_5169847_+	hypothetical protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	40.3	6.1e-07
WP_031632202.1|5170064_5170412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680747.1|5170457_5171267_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	42.0	6.9e-50
WP_033971084.1|5171333_5172068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031632204.1|5172076_5172622_+	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	48.3	4.8e-31
WP_071534345.1|5173539_5173746_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_033964186.1|5173751_5174954_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	31.4	9.9e-37
5176238:5176252	attR	CGCCAGCGCTTCGCC	NA	NA	NA	NA
>prophage 10
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	5215571	5275087	7018690	integrase,transposase	Pseudomonas_phage(57.14%)	51	5209676:5209690	5270821:5270835
5209676:5209690	attL	CCAGCAGCAGGCGGC	NA	NA	NA	NA
WP_012248435.1|5215571_5216582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.0	2.8e-24
WP_012248434.1|5216578_5217571_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012248433.1|5217567_5218827_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008266034.1|5219292_5219739_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_012205991.1|5219735_5220683_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_008266424.1|5220693_5222100_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_008264618.1|5222096_5222468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266205.1|5222483_5224007_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_008264713.1|5224013_5224373_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_008267277.1|5224400_5224859_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
WP_008265574.1|5224858_5225176_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008264901.1|5225473_5227330_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008267353.1|5227360_5230696_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_008265595.1|5230692_5233329_-	chromosome segregation ATPase	NA	NA	NA	NA	NA
WP_008266911.1|5233331_5235299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008266894.1|5235265_5238622_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_014603592.1|5238618_5239962_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_023124773.1|5239954_5240671_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_023124774.1|5240667_5241156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008266170.1|5241152_5242949_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_008268248.1|5242912_5245588_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_031757235.1|5245584_5245815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033940875.1|5245807_5246152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206005.1|5246148_5247459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206006.1|5247475_5247745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012206007.1|5247744_5248479_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_008266576.1|5248559_5251565_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	41.3	2.5e-193
WP_033940889.1|5251576_5253562_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	46.0	3.9e-123
WP_014603588.1|5253588_5254383_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_008266060.1|5254379_5256167_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_014603587.1|5256181_5259415_-	helicase	NA	A0A2K5B253	Erysipelothrix_phage	42.8	3.3e-236
WP_008267281.1|5259427_5260336_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_033940876.1|5260614_5260977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033940877.1|5261040_5262561_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.7	4.6e-47
WP_033940878.1|5262635_5263433_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.6	2.4e-31
WP_033940880.1|5263422_5264949_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_033940882.1|5265633_5265939_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033940883.1|5266060_5266702_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016263850.1|5266989_5267337_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003114155.1|5267346_5267598_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_019725833.1|5267811_5268795_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.3	1.8e-92
WP_003115206.1|5268794_5270087_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_019725831.1|5270345_5271608_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	57.0	2.2e-119
5270821:5270835	attR	CCAGCAGCAGGCGGC	NA	NA	NA	NA
WP_019725830.1|5271609_5271960_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	42.0	2.4e-20
WP_019725829.1|5271969_5272926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725828.1|5273242_5273461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|5273474_5273726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115130.1|5273737_5273830_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_019725827.1|5273846_5274281_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	97.2	6.5e-63
WP_033072802.1|5274415_5274793_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	94.4	2.4e-58
WP_023123415.1|5274796_5275087_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	96.9	5.6e-55
>prophage 11
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	5690291	5729223	7018690	integrase,transposase,terminase	Pseudomonas_phage(96.23%)	55	5692233:5692248	5716037:5716052
WP_015975359.1|5690291_5690654_-	transcriptional regulator	NA	Q5ZR15	Pseudomonas_phage	100.0	2.3e-61
WP_023089283.1|5690656_5691220_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.4	2.8e-98
WP_015975360.1|5691206_5691674_-	hypothetical protein	NA	Q5ZR13	Pseudomonas_phage	100.0	8.2e-80
WP_003148480.1|5691675_5691894_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|5691895_5692585_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
5692233:5692248	attL	CGCTCCAGCACCTGGT	NA	NA	NA	NA
WP_023089286.1|5692586_5693204_-	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	45.9	9.2e-47
WP_015975362.1|5693196_5693397_-	hypothetical protein	NA	Q5ZR09	Pseudomonas_phage	100.0	1.3e-31
WP_052155851.1|5693389_5693764_-	hypothetical protein	NA	Q5ZR08	Pseudomonas_phage	98.4	8.3e-67
WP_015975364.1|5693763_5694045_-	hypothetical protein	NA	Q5ZR07	Pseudomonas_phage	100.0	8.7e-45
WP_033940199.1|5694041_5694383_-	hypothetical protein	NA	Q5ZR06	Pseudomonas_phage	99.1	6.4e-58
WP_023089289.1|5694384_5695557_-	AAA family ATPase	NA	Q5ZR05	Pseudomonas_phage	85.9	1.8e-184
WP_079382934.1|5695556_5697338_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	99.7	0.0e+00
WP_033938114.1|5697340_5698267_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	91.2	1.1e-149
WP_015649409.1|5698277_5698586_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	100.0	5.4e-48
WP_003127832.1|5698578_5699064_-	hypothetical protein	NA	Q5ZR01	Pseudomonas_phage	100.0	7.4e-92
WP_021204956.1|5699187_5699412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025921029.1|5699696_5699927_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	90.8	1.4e-32
WP_033940200.1|5700040_5700400_+	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	49.5	5.8e-17
WP_031630694.1|5700416_5700920_+	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	92.8	5.2e-80
WP_124084312.1|5700924_5701368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003138152.1|5701703_5701961_+	membrane protein	NA	J9STQ9	Pseudomonas_phage	100.0	5.6e-38
WP_033940198.1|5702118_5702748_+	transglycosylase SLT domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	1.4e-119
WP_033940196.1|5702943_5703555_+	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	98.0	3.8e-101
WP_015975380.1|5703558_5703948_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	100.0	7.6e-63
WP_015975381.1|5703937_5704246_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	100.0	2.3e-54
WP_033940215.1|5704251_5704824_+	DUF3486 family protein	NA	Q5ZQY6	Pseudomonas_phage	98.9	3.0e-92
WP_015975383.1|5704823_5706284_+|terminase	large terminase subunit	terminase	Q5ZQY5	Pseudomonas_phage	100.0	1.8e-290
WP_033940194.1|5706283_5707762_+	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	99.0	3.7e-283
WP_023089300.1|5707761_5709018_+	hypothetical protein	NA	Q5ZQY3	Pseudomonas_phage	99.0	7.2e-240
WP_015975387.1|5709141_5709714_+	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	100.0	4.8e-106
WP_079382933.1|5710003_5711182_+	peptidase	NA	Q5ZQY0	Pseudomonas_phage	97.2	1.8e-168
WP_023089303.1|5711185_5711563_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	6.0e-57
WP_021204947.1|5711574_5712504_+	hypothetical protein	NA	Q5ZQX7	Pseudomonas_phage	98.4	4.2e-176
WP_021204946.1|5712516_5713152_+	hypothetical protein	NA	Q5ZQX6	Pseudomonas_phage	90.0	2.2e-96
WP_021204945.1|5713151_5713439_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	64.8	1.2e-25
WP_021204944.1|5713440_5713959_+	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	98.8	6.5e-94
WP_021204943.1|5713960_5714425_+	hypothetical protein	NA	Q5ZQX4	Pseudomonas_phage	89.6	4.5e-78
WP_021204942.1|5714421_5714616_+	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	54.4	1.1e-06
WP_021204941.1|5714620_5715361_+	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	68.3	4.6e-93
WP_021204940.1|5715363_5715879_+	hypothetical protein	NA	Q5ZQX1	Pseudomonas_phage	72.4	7.9e-60
WP_021204939.1|5715875_5716028_+	hypothetical protein	NA	Q5ZQX0	Pseudomonas_phage	90.7	9.6e-14
WP_015975400.1|5716163_5716349_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	100.0	2.6e-29
5716037:5716052	attR	ACCAGGTGCTGGAGCG	NA	NA	NA	NA
WP_033940189.1|5716318_5717113_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	99.2	3.8e-154
WP_033940187.1|5717193_5720502_+	tape measure protein	NA	Q5ZQW6	Pseudomonas_phage	95.5	0.0e+00
WP_019395761.1|5720501_5721458_+	hypothetical protein	NA	J9RWA0	Pseudomonas_phage	95.6	1.1e-182
WP_033940186.1|5721459_5722383_+	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	96.1	8.4e-177
WP_033940183.1|5722385_5724092_+	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.2	0.0e+00
WP_033940181.1|5724078_5724897_+	DUF2163 domain-containing protein	NA	J9SP65	Pseudomonas_phage	99.6	1.0e-165
WP_003094285.1|5724906_5725137_+	hypothetical protein	NA	Q5ZQW1	Pseudomonas_phage	100.0	1.2e-36
WP_031674674.1|5725133_5725364_+	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	96.1	4.6e-36
WP_033940179.1|5725350_5727561_+	bacteriophage protein	NA	Q5ZQV9	Pseudomonas_phage	97.7	0.0e+00
WP_023126637.1|5727557_5728403_+	DUF2793 domain-containing protein	NA	I6P8E4	Pseudomonas_phage	99.6	9.4e-159
WP_016050138.1|5728402_5728705_+	hypothetical protein	NA	I6PBW9	Pseudomonas_phage	100.0	2.3e-51
WP_016050139.1|5728701_5728920_+	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	100.0	4.6e-33
WP_019395757.1|5728998_5729223_+	hypothetical protein	NA	H1ZZG9	Pseudomonas_virus	98.6	1.6e-33
>prophage 12
NZ_CP014999	Pseudomonas aeruginosa strain PA7790, complete genome	7018690	6823821	6892272	7018690	holin,integrase,tRNA,protease,portal,head,capsid,terminase	uncultured_Caudovirales_phage(29.03%)	68	6815845:6815860	6894217:6894232
6815845:6815860	attL	GCAGGGTCGCCAGCAG	NA	NA	NA	NA
WP_003105560.1|6823821_6825216_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	72.8	2.2e-157
WP_003096864.1|6825209_6825935_-	DUF3142 domain-containing protein	NA	NA	NA	NA	NA
WP_019727065.1|6825931_6828133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649860.1|6828191_6831047_-	GGDEF and EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.9	1.1e-09
WP_003096872.1|6831223_6833410_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.8	1.3e-119
WP_003114104.1|6833447_6833876_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003096875.1|6833973_6835467_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_003096877.1|6835844_6836048_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_004364722.1|6836103_6837249_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003102573.1|6837249_6838377_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003096882.1|6838360_6839743_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003102571.1|6839739_6841005_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.7e-15
WP_019727066.1|6841004_6841802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003114106.1|6841801_6843241_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	3.8e-51
WP_003096890.1|6843244_6844216_-	GDP-mannose 4,6-dehydratase	NA	E5EQW4	Bathycoccus_sp._RCC1105_virus	53.2	1.5e-91
WP_019727067.1|6844212_6845127_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A222YY99	Synechococcus_phage	27.7	7.1e-27
WP_019727068.1|6845534_6847151_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_019727069.1|6847144_6848446_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003114110.1|6848442_6849306_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015649866.1|6849302_6850445_+	acyltransferase	NA	NA	NA	NA	NA
WP_003142118.1|6850438_6851275_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_124182787.1|6851822_6852437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031632186.1|6852870_6853218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031632187.1|6853444_6853711_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	88.6	3.0e-39
WP_031632188.1|6853779_6854583_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	64.7	1.6e-99
WP_033964234.1|6854727_6854988_-	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	76.7	6.2e-29
WP_079866817.1|6854984_6855353_-	hypothetical protein	NA	A0A125RNP2	Pseudomonas_phage	91.5	5.0e-16
WP_071501038.1|6855349_6855979_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	89.0	2.7e-102
WP_003096116.1|6856224_6856461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025325096.1|6856460_6858221_-	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.4	7.5e-25
WP_071501048.1|6858217_6859078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016561962.1|6859074_6860076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034052276.1|6860075_6863627_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	34.9	2.9e-177
WP_019396973.1|6863675_6864086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071501039.1|6864082_6867343_-	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	45.3	4.0e-48
WP_014602839.1|6867571_6868012_-	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_019682368.1|6868244_6868991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125699.1|6869018_6869213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015648938.1|6869263_6869701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125698.1|6869697_6869979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071501040.1|6870011_6871010_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	64.7	1.1e-121
WP_023096402.1|6871077_6871713_-|head	head decoration protein	head	NA	NA	NA	NA
WP_019726635.1|6871709_6872882_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.6	5.1e-86
WP_019726636.1|6872865_6874332_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	65.8	2.5e-175
WP_004353026.1|6874331_6874556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726637.1|6874567_6876583_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	67.8	6.1e-257
WP_019726638.1|6876586_6877177_-	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	55.3	1.2e-46
WP_071501045.1|6877433_6878171_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.6	1.1e-43
WP_025325111.1|6878173_6878452_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004353017.1|6878456_6878822_-	hypothetical protein	NA	E5E3W4	Burkholderia_phage	48.2	1.0e-13
WP_124182786.1|6879020_6879578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071501046.1|6879917_6882656_-	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.3	0.0e+00
WP_019726642.1|6882652_6882895_-	repressor, PtrB	NA	Q9ZXI6	Pseudomonas_virus	53.0	2.7e-10
WP_019726643.1|6882887_6883388_-	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.3	1.6e-33
WP_019726644.1|6883594_6883798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726645.1|6884021_6884231_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_019726646.1|6884349_6885051_+	helix-turn-helix domain-containing protein	NA	B5WZX5	Pseudomonas_phage	35.2	1.2e-21
WP_028680742.1|6885396_6885705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680743.1|6885701_6886271_+	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	49.5	8.0e-45
WP_028680744.1|6886282_6886567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680745.1|6886563_6886932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019726652.1|6886928_6887165_+	hypothetical protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	40.3	6.1e-07
WP_031632202.1|6887382_6887730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028680747.1|6887775_6888585_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	42.0	6.9e-50
WP_033971084.1|6888651_6889386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031632204.1|6889394_6889940_+	phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	48.3	4.8e-31
WP_071534345.1|6890857_6891064_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_033964186.1|6891069_6892272_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	31.4	9.9e-37
6894217:6894232	attR	CTGCTGGCGACCCTGC	NA	NA	NA	NA
