The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	818057	879533	6155924	integrase,head,tRNA,capsid,plate,terminase,portal,tail	Enterobacteria_phage(52.94%)	68	836888:836904	874201:874217
WP_017146107.1|818057_819164_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004112222.1|819202_819679_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_023320724.1|819699_820350_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004101197.1|820586_821837_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_004101200.1|821933_822272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024274036.1|822468_824253_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	2.5e-20
WP_023320726.1|824333_825521_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_047719969.1|825799_826843_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004101215.1|827232_827604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719968.1|827684_830015_-	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_004101218.1|830112_831060_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004101219.1|831056_831578_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023320730.1|831835_832624_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004101221.1|833162_834077_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	1.0e-73
WP_023320731.1|834166_834805_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004112248.1|834933_835197_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_085955747.1|835245_835371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100248259.1|835511_835586_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004101234.1|835585_835687_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_023320733.1|835744_836758_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
836888:836904	attL	AAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_047719967.1|837020_838004_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	2.4e-150
WP_038423230.1|838119_838419_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.7	3.5e-36
WP_023300861.1|838541_838811_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
WP_023300862.1|838915_839131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021466843.1|839264_839483_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
WP_009486498.1|839498_839876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719966.1|839891_840164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|840232_840457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719965.1|840453_841020_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.5	4.7e-13
WP_047719963.1|841293_842310_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.1e-65
WP_047719961.1|844960_846649_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	53.1	1.3e-175
WP_047719959.1|846851_848216_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	22.3	1.8e-18
WP_047719958.1|848798_849860_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.1e-143
WP_047719957.1|849853_851581_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.4	8.2e-234
WP_047719956.1|851737_852577_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_047719954.1|852587_853622_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.3	6.2e-96
WP_047719953.1|853671_854538_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	2.6e-71
WP_032708341.1|854642_855158_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.7e-41
WP_004131559.1|855157_855358_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_032432781.1|855348_855633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719951.1|855629_856175_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	1.1e-30
WP_049070297.1|856186_856516_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_128316295.1|856505_856697_+	peptidase	NA	NA	NA	NA	NA
WP_032720044.1|856697_857165_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_047719950.1|857161_857797_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
WP_047719949.1|857793_858381_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.0	4.8e-53
WP_017898624.1|858377_858728_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_047719948.1|858729_859653_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	42.9	9.3e-51
WP_047719947.1|859642_862672_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_047719946.1|862668_862884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719945.1|862868_863966_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	8.8e-08
WP_047719944.1|864237_866697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721071.1|866861_867335_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.1	1.9e-52
WP_047719943.1|867350_870326_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	1.1e-217
WP_053086776.1|870312_870450_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047719942.1|870470_870782_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	52.2	1.5e-16
WP_047719941.1|870827_871343_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_047719940.1|871342_872515_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	2.9e-158
WP_047719938.1|872669_873809_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.7	1.4e-144
WP_004216467.1|873852_874104_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_023320734.1|874367_874607_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
874201:874217	attR	AAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_004101238.1|874610_874958_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004101240.1|874944_875454_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004101242.1|875616_876309_+	CTP synthase	NA	NA	NA	NA	NA
WP_004101244.1|876346_877531_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004101246.1|877631_878423_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004101248.1|878406_878853_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_023320736.1|879032_879533_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	1041995	1101847	6155924	protease,tRNA,holin,plate	Enterobacteria_phage(25.0%)	58	NA	NA
WP_024274068.1|1041995_1043756_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024274069.1|1043719_1044805_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004101511.1|1044782_1045322_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004101512.1|1045321_1045813_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004101515.1|1045961_1047641_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_163470950.1|1047696_1049136_-	MFS transporter	NA	NA	NA	NA	NA
WP_024274071.1|1050604_1051564_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_024274072.1|1051578_1052112_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_024274073.1|1052108_1053332_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004101529.1|1053328_1054051_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_017146024.1|1054052_1055312_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004101533.1|1055308_1056028_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004101535.1|1056024_1056459_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004101537.1|1056726_1057455_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
WP_023320839.1|1057555_1057900_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_023320840.1|1057998_1059186_-	MFS transporter	NA	NA	NA	NA	NA
WP_016807767.1|1059327_1060464_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004101545.1|1060635_1061520_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004101547.1|1061723_1062266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024274075.1|1062397_1063282_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023320841.1|1063438_1064419_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024274076.1|1064588_1065521_-	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_024274077.1|1065658_1066564_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004101558.1|1067230_1067419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017146020.1|1068297_1068612_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_004112572.1|1068789_1068981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004101565.1|1069135_1069330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|1069956_1071444_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_023320844.1|1071522_1071945_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.1	6.8e-33
WP_023320845.1|1071944_1073210_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	66.1	5.9e-157
WP_017146018.1|1073373_1074441_-	oxidoreductase	NA	NA	NA	NA	NA
WP_024274078.1|1074454_1075201_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	5.4e-17
WP_004101576.1|1075370_1076003_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032734669.1|1076086_1076716_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024274079.1|1077133_1077664_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_016807754.1|1077719_1078391_+	molecular chaperone	NA	NA	NA	NA	NA
WP_023329610.1|1078454_1080986_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_023329611.1|1081017_1081950_+	fimbrial protein	NA	NA	NA	NA	NA
WP_047719906.1|1081958_1082477_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_029779322.1|1082595_1083216_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016807751.1|1083557_1084541_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023320856.1|1085023_1086397_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.8e-50
WP_024274080.1|1086441_1087377_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
WP_023320857.1|1088327_1089266_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_017146008.1|1089472_1089763_-	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	64.9	1.1e-29
WP_004101601.1|1089948_1090383_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
WP_004112591.1|1090465_1090678_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004101605.1|1090827_1091934_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.7	1.7e-107
WP_047719904.1|1092288_1095816_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_047719902.1|1096294_1096996_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	5.1e-33
WP_004101611.1|1097456_1097819_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	57.5	5.1e-29
WP_004101612.1|1097895_1098288_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	53.7	2.2e-25
WP_004101614.1|1098277_1098550_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	56.6	1.2e-17
WP_017146003.1|1098557_1099100_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	64.6	4.9e-68
WP_017146002.1|1099329_1099695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029496829.1|1100022_1100295_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004101623.1|1100291_1100732_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004112629.1|1100857_1101847_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 3
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	1369769	1402580	6155924	integrase,head,plate,terminase,transposase	Erwinia_phage(21.43%)	40	1366279:1366297	1401096:1401114
1366279:1366297	attL	ATTTAACATAATATACATT	NA	NA	NA	NA
WP_016809009.1|1369769_1370648_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016809008.1|1370651_1370909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016809007.1|1371986_1372940_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	26.4	3.1e-09
WP_016809006.1|1372936_1373647_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_016809004.1|1373657_1374035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113032.1|1374249_1374597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016809000.1|1374583_1375993_+|plate	baseplate J/gp47 family protein	plate	A0A2I7QTL1	Vibrio_phage	21.9	3.0e-08
WP_047719837.1|1375992_1376748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808996.1|1376740_1376974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808994.1|1376970_1377207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808992.1|1377206_1377839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808991.1|1378224_1378497_-	hypothetical protein	NA	R9TRL1	Aeromonas_phage	64.1	5.7e-17
WP_139025210.1|1378496_1380473_-	hypothetical protein	NA	R9TMK5	Aeromonas_phage	55.9	3.0e-171
WP_016808988.1|1380585_1381101_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	46.4	2.1e-36
WP_026055955.1|1381118_1382717_-	ERF family protein	NA	NA	NA	NA	NA
WP_016808986.1|1382990_1383386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100290036.1|1383727_1383883_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_016808984.1|1384204_1384750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808983.1|1384736_1386146_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7RTP3	Vibrio_phage	33.7	1.0e-56
WP_016808982.1|1386142_1387516_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_016808981.1|1387502_1388864_+|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	28.6	1.7e-16
WP_026055954.1|1388835_1389849_+	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	35.0	2.6e-14
WP_016808979.1|1389848_1390640_+	Ig domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	55.3	5.6e-12
WP_047719836.1|1390657_1391596_+	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.8	6.6e-28
WP_004113060.1|1391599_1391854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808977.1|1391863_1392223_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_016808976.1|1392343_1392817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808975.1|1392912_1393167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808974.1|1393166_1393952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808973.1|1393952_1395311_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	27.8	2.8e-35
WP_047719835.1|1395313_1395736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113073.1|1395735_1396221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808970.1|1396348_1398280_+	tape measure protein	NA	NA	NA	NA	NA
WP_016808969.1|1398290_1398557_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	41.6	8.4e-05
WP_016808968.1|1398638_1399235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808967.1|1399235_1399574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016808966.1|1399574_1399853_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	52.5	3.4e-09
WP_032743587.1|1399872_1400373_+	lysozyme	NA	H9C184	Pectobacterium_phage	75.8	4.4e-71
WP_016808964.1|1400369_1400903_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_077257948.1|1401233_1402580_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
1401096:1401114	attR	ATTTAACATAATATACATT	NA	NA	NA	NA
>prophage 4
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	2072543	2099340	6155924	terminase,holin	Escherichia_phage(28.95%)	49	NA	NA
WP_077257953.1|2072543_2074115_-	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.8	2.8e-55
WP_014837912.1|2074156_2074378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721029.1|2074378_2075971_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	40.6	3.0e-97
WP_047720773.1|2075972_2076956_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	46.2	1.5e-38
WP_047721175.1|2077043_2077259_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	73.2	3.1e-26
WP_025108058.1|2077488_2077734_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	56.8	2.0e-16
WP_047721174.1|2077809_2078289_-	DUF2829 domain-containing protein	NA	A0A1Y0T2L3	Pseudomonas_phage	59.1	1.2e-54
WP_047721026.1|2078352_2078646_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	2.6e-31
WP_047721023.1|2078787_2079063_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	5.4e-15
WP_047721022.1|2079059_2079404_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	74.6	2.0e-35
WP_004136189.1|2079400_2079943_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	5.8e-77
WP_139153343.1|2079939_2080239_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	8.4e-46
WP_042934016.1|2080700_2081198_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.7	1.9e-87
WP_047721020.1|2081194_2081335_-	YlcG family protein	NA	NA	NA	NA	NA
WP_047721019.1|2081331_2081970_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.3	5.7e-76
WP_071532248.1|2081962_2082133_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	69.6	5.7e-15
WP_047721018.1|2082125_2082575_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.3	5.3e-36
WP_047721017.1|2082776_2083034_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	71.4	5.4e-25
WP_139153335.1|2083365_2083638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721015.1|2083827_2084025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721014.1|2084109_2084865_-	DUF551 domain-containing protein	NA	O64350	Escherichia_phage	63.6	4.5e-11
WP_052959187.1|2085037_2085517_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_047721013.1|2085513_2085783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071458385.1|2086060_2086573_-	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	51.6	3.7e-25
WP_047721012.1|2086569_2086875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721011.1|2086871_2087651_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.7	2.6e-94
WP_032435255.1|2087647_2088376_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_165473733.1|2088606_2088756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721010.1|2088755_2089076_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	8.5e-36
WP_047721009.1|2089116_2089344_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	53.7	2.2e-14
WP_176678789.1|2089412_2090135_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	63.2	2.5e-75
WP_047721007.1|2090277_2090559_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	82.8	3.9e-37
WP_052959190.1|2090796_2091078_+	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	61.7	1.0e-08
WP_047721006.1|2091373_2091562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071845055.1|2091554_2091761_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	95.6	8.1e-32
WP_047721005.1|2091840_2092842_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	6.8e-39
WP_047721004.1|2092849_2093134_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	71.3	5.4e-34
WP_047721003.1|2093149_2093995_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	2.6e-68
WP_047721002.1|2093991_2094672_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.3e-123
WP_046878446.1|2094668_2094827_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	69.2	2.2e-13
WP_043875719.1|2094823_2095051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721001.1|2095047_2095707_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.7	1.0e-115
WP_047721000.1|2095703_2095922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720999.1|2095918_2096455_+	hypothetical protein	NA	J9Q748	Salmonella_phage	70.9	1.8e-70
WP_047720998.1|2096451_2096643_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	66.1	6.0e-13
WP_047720997.1|2096639_2097509_+	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	41.5	5.1e-59
WP_047720996.1|2097505_2097730_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	5.9e-12
WP_047721168.1|2097771_2098023_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	44.4	6.0e-13
WP_047720995.1|2098056_2099340_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	56.3	7.1e-142
>prophage 5
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	2180974	2289492	6155924	integrase,head,protease,tRNA,capsid,plate,terminase,tail,portal,holin	Enterobacteria_phage(25.0%)	125	2211826:2211843	2290815:2290832
WP_004103400.1|2180974_2182762_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004103401.1|2183031_2183598_+	hydrolase	NA	NA	NA	NA	NA
WP_004103402.1|2183594_2184413_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	83.5	2.2e-59
WP_004103403.1|2184466_2184862_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_004103405.1|2184901_2185645_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	29.1	1.5e-22
WP_016808312.1|2185641_2186664_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_004103408.1|2186962_2187706_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_004103409.1|2187782_2188352_-	VOC family protein	NA	NA	NA	NA	NA
WP_004103410.1|2188581_2190315_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	5.7e-86
WP_004103411.1|2190391_2191531_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_004103413.1|2191535_2193119_-	MFS transporter	NA	NA	NA	NA	NA
WP_158414345.1|2193195_2193381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004103417.1|2193484_2193913_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_004103421.1|2193941_2195366_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_004103423.1|2195340_2196144_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004103425.1|2196302_2197283_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_004103427.1|2197297_2198812_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	2.6e-10
WP_004103429.1|2198873_2199854_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004103431.1|2200142_2200700_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_016808317.1|2201247_2201790_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_032704871.1|2202073_2203585_+	MFS transporter	NA	NA	NA	NA	NA
WP_004103438.1|2203631_2203883_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_014229869.1|2203962_2204046_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_032704701.1|2204254_2205676_+	MFS transporter	NA	NA	NA	NA	NA
WP_004103442.1|2205725_2206364_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_004103444.1|2206783_2207281_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_004103446.1|2207318_2207558_-	YecH family protein	NA	NA	NA	NA	NA
WP_004103448.1|2207752_2208964_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004103450.1|2208990_2209659_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	65.5	9.5e-05
WP_004103451.1|2209725_2210613_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_071845063.1|2210972_2211224_-	ogr/Delta-like zinc finger family protein	NA	Q858U4	Yersinia_virus	44.6	1.0e-07
WP_047720983.1|2211267_2212401_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	69.5	3.9e-144
2211826:2211843	attL	CCCGTTTTTTACGGTGGC	NA	NA	NA	NA
WP_047720981.1|2212552_2213722_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	5.1e-155
WP_047720980.1|2213721_2214237_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_047720979.1|2214282_2214594_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	53.3	8.5e-17
WP_053086776.1|2214614_2214752_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_047720977.1|2214738_2217744_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.4	7.8e-232
WP_047720975.1|2217759_2218251_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	1.3e-54
WP_047720973.1|2218500_2219373_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032445019.1|2220800_2221016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720971.1|2221012_2224042_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	3.7e-24
WP_047720970.1|2224031_2224955_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	8.4e-52
WP_047720969.1|2224956_2225307_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	1.8e-26
WP_047720968.1|2225303_2225891_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	5.9e-59
WP_047720967.1|2225887_2226523_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	5.0e-56
WP_032411298.1|2226519_2226987_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_158414347.1|2226987_2227323_-	peptidase	NA	NA	NA	NA	NA
WP_047720965.1|2227509_2228055_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	2.4e-30
WP_047724057.1|2228325_2228526_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	61.5	7.9e-16
WP_047720963.1|2228525_2229041_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_047720962.1|2229153_2230011_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.9	1.3e-70
WP_047720961.1|2230059_2231094_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.1e-95
WP_047720960.1|2231103_2231943_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	4.3e-95
WP_047720959.1|2232099_2233827_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	69.5	2.5e-238
WP_047720958.1|2233820_2234882_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	8.5e-141
WP_047720957.1|2235360_2236113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720956.1|2236314_2238912_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.6	4.0e-192
WP_071845053.1|2238904_2240047_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	50.4	8.1e-97
WP_158414348.1|2240022_2240178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176678787.1|2240187_2240361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720953.1|2240629_2241583_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	57.9	2.3e-89
WP_047720952.1|2241815_2242382_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	31.1	2.1e-13
WP_047720951.1|2242378_2242603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720950.1|2242671_2242950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720949.1|2242946_2243186_-	DUF4754 family protein	NA	NA	NA	NA	NA
WP_071845051.1|2243199_2243403_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.1	5.2e-15
WP_032437051.1|2243412_2243616_-	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	8.3e-05
WP_047720948.1|2243638_2243881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720947.1|2243883_2244096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257946.1|2244136_2244565_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	40.2	3.7e-10
WP_047720945.1|2244574_2245204_+	membrane protein	NA	NA	NA	NA	NA
WP_047720944.1|2245225_2245471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720942.1|2245849_2246257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720941.1|2246269_2247277_+|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	55.6	3.9e-103
WP_047720940.1|2247590_2247920_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.5e-22
WP_004178082.1|2248236_2249724_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_047720938.1|2250173_2251574_-	hypothetical protein	NA	W6E8G0	Rhizobium_phage	29.7	2.8e-14
WP_047720937.1|2251576_2253709_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A286S1P0	Klebsiella_phage	36.9	2.0e-11
WP_016809748.1|2256860_2257241_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.7	1.3e-59
WP_017145580.1|2257253_2257730_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.1	6.7e-53
WP_047720936.1|2257716_2258190_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.2e-54
WP_047720935.1|2258211_2261619_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	41.8	3.9e-187
WP_015370209.1|2261688_2262072_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	2.3e-32
WP_047720934.1|2262147_2262453_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_047720933.1|2262455_2262860_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	55.7	5.5e-32
WP_047720932.1|2262890_2263601_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	68.2	7.5e-85
WP_032750781.1|2263657_2264005_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	2.3e-31
WP_047720931.1|2264001_2264451_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	3.3e-62
WP_047720930.1|2264447_2264786_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.4e-41
WP_047720929.1|2264794_2265112_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	54.9	6.7e-25
WP_047720928.1|2265189_2266428_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	68.0	1.0e-153
WP_032439289.1|2266437_2267037_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	5.9e-91
WP_047720927.1|2267029_2268256_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	8.4e-209
WP_047720926.1|2268245_2268407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720925.1|2268403_2270155_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	72.0	8.8e-252
WP_047720924.1|2270158_2270656_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	2.5e-63
WP_032419453.1|2270814_2271165_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_047720923.1|2271225_2271471_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	59.3	3.6e-18
WP_047720921.1|2271877_2272243_-	hypothetical protein	NA	L7TH90	Pseudomonas_virus	53.6	5.5e-15
WP_047720920.1|2272524_2272800_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	4.4e-25
WP_047720919.1|2272807_2273437_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.0	1.3e-104
WP_017145564.1|2273436_2273718_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.3e-37
WP_004121584.1|2273704_2274100_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	93.9	3.2e-61
WP_047720918.1|2274369_2275296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720917.1|2275821_2276166_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	3.3e-54
WP_047720916.1|2276184_2277165_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.5	7.1e-134
WP_047720915.1|2277161_2277857_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	64.7	8.2e-76
WP_047720914.1|2277871_2278261_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	72.9	6.9e-48
WP_047720913.1|2278270_2279080_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	71.5	1.2e-115
WP_047720912.1|2279076_2279991_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	4.0e-30
WP_071845048.1|2279947_2280160_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	1.7e-16
WP_047720911.1|2280397_2280853_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	85.1	5.5e-65
WP_071845047.1|2281111_2281381_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	52.1	5.9e-14
WP_047720910.1|2281483_2281966_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.9	1.3e-11
WP_047720909.1|2282136_2283294_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.9	2.4e-35
WP_047720908.1|2283610_2284528_+	recombination-associated protein RdgC	NA	A0A1Y0SUG1	Pseudomonas_phage	34.1	1.1e-38
WP_047720907.1|2284616_2284916_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.2e-13
WP_047720906.1|2284915_2285704_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.1e-63
WP_162556077.1|2285700_2285862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720905.1|2285858_2286203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720904.1|2286195_2286513_+	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	51.4	1.3e-17
WP_047720903.1|2286513_2286852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720902.1|2287494_2287890_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	78.6	1.2e-52
WP_047720901.1|2288227_2288458_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047720900.1|2288457_2289492_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.7	9.8e-126
2290815:2290832	attR	CCCGTTTTTTACGGTGGC	NA	NA	NA	NA
>prophage 6
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	2589606	2706663	6155924	integrase,head,protease,capsid,terminase,tail,portal,holin,lysis	Enterobacteria_phage(32.73%)	109	2619929:2619945	2708681:2708697
WP_004103877.1|2589606_2590302_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_004103882.1|2590429_2591314_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_004103884.1|2591438_2592155_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_004114089.1|2592344_2593355_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_004103886.1|2593370_2594891_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.6	1.5e-10
WP_004103888.1|2595009_2596008_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_004103891.1|2596297_2597320_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_004103893.1|2597475_2598633_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_004103895.1|2598648_2599317_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_004103897.1|2599683_2600520_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004114107.1|2601098_2603072_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
WP_004103903.1|2603376_2604846_-	amino acid permease	NA	NA	NA	NA	NA
WP_047720863.1|2605051_2605534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016809573.1|2605533_2606022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004103910.1|2606000_2606873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047720862.1|2607045_2608095_+	YeiH family protein	NA	NA	NA	NA	NA
WP_004103914.1|2608191_2609049_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.1	6.9e-24
WP_004103916.1|2609050_2610139_+	sugar kinase	NA	NA	NA	NA	NA
WP_004103919.1|2610173_2611424_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_004103922.1|2611520_2612456_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_047721156.1|2612448_2613384_-	pseudouridine kinase	NA	NA	NA	NA	NA
WP_004114117.1|2613709_2615398_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_004103928.1|2615414_2616353_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_047720861.1|2616353_2617484_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_032704880.1|2617814_2618996_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_004103933.1|2619021_2619273_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004103935.1|2619419_2619992_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
2619929:2619945	attL	CAGCGCGGGCGAGCGCA	NA	NA	NA	NA
WP_004103940.1|2620307_2621774_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.9	1.5e-42
WP_004103941.1|2621893_2622871_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_024274498.1|2622907_2623621_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004103943.1|2624047_2624617_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	3.1e-12
WP_004103944.1|2624801_2626364_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_032704881.1|2626434_2628240_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004103946.1|2628249_2629344_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_004103948.1|2629343_2630369_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004103950.1|2630370_2631960_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.4	1.4e-17
WP_004103951.1|2631963_2632308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004103952.1|2632638_2633835_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.4	2.1e-23
WP_004103953.1|2633831_2634551_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004103954.1|2634699_2636457_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.5	4.9e-101
WP_004114143.1|2636594_2636879_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004103956.1|2636940_2637534_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004103958.1|2637614_2638373_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004114145.1|2638422_2639430_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.2	9.1e-84
WP_004133900.1|2639608_2639836_+	YejL family protein	NA	NA	NA	NA	NA
WP_004114147.1|2639855_2641616_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_004122957.1|2641872_2642256_-	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	90.6	5.2e-64
WP_004178082.1|2642362_2643850_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_047720860.1|2644282_2645425_-|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	33.3	9.8e-18
WP_047720859.1|2645465_2654678_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.6	0.0e+00
WP_047720858.1|2654743_2655334_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.0	3.0e-79
WP_126488854.1|2655423_2655696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720857.1|2655701_2656439_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.6	8.2e-135
WP_047720856.1|2656440_2657196_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	84.5	3.7e-130
WP_047720855.1|2657192_2657540_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	62.6	2.0e-35
WP_047720854.1|2657590_2660737_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	75.9	0.0e+00
WP_071845045.1|2660720_2661035_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	76.0	2.3e-41
WP_077257945.1|2661055_2661484_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	59.3	8.7e-36
WP_047720853.1|2661494_2662238_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.4	2.8e-114
WP_047720852.1|2662244_2662643_-|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	76.5	4.1e-56
WP_077257944.1|2662639_2663224_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	77.8	2.5e-78
WP_047720851.1|2663232_2663586_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	66.7	1.8e-42
WP_047720850.1|2663596_2664016_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	51.5	4.1e-22
WP_047720849.1|2664066_2665092_-|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	92.7	2.6e-179
WP_047720848.1|2665159_2665492_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	80.0	5.1e-44
WP_047720847.1|2665501_2666833_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	73.2	2.6e-171
WP_047720846.1|2666813_2668406_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	86.6	6.3e-273
WP_015367380.1|2668402_2668609_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	88.1	6.7e-26
WP_047720845.1|2668608_2670531_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	89.7	0.0e+00
WP_047720844.1|2670505_2671051_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	87.2	1.1e-86
WP_047720843.1|2671344_2671764_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	53.6	5.2e-33
WP_047720842.1|2671763_2672096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720841.1|2672186_2672372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139153332.1|2672828_2673086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720840.1|2673869_2674100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720839.1|2674330_2674798_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	63.2	1.7e-45
WP_047720838.1|2674800_2675220_-	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	7.4e-40
WP_139153342.1|2675206_2675536_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	89.9	5.1e-52
WP_047043763.1|2675777_2675960_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_047720836.1|2675984_2676416_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	37.3	7.4e-19
WP_071845044.1|2676645_2677248_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	2.4e-76
WP_047720835.1|2677260_2678322_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.3e-100
WP_047720834.1|2678318_2680166_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.4	4.0e-202
WP_047720833.1|2680158_2681043_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	71.8	7.4e-122
WP_004122994.1|2681042_2681300_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	75.0	3.3e-22
WP_004122995.1|2681296_2682175_-	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	57.7	1.7e-33
WP_032423246.1|2682171_2682351_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_047721152.1|2682352_2682997_-	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	50.7	4.3e-47
WP_032741919.1|2683052_2683250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720832.1|2683246_2683804_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.2	1.4e-65
WP_004122998.1|2683831_2684029_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	1.6e-16
WP_176678784.1|2684120_2684777_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	58.1	1.8e-69
WP_047721149.1|2685565_2685937_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	8.3e-59
WP_004123003.1|2685993_2686821_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	85.8	3.0e-133
WP_047720831.1|2686953_2687481_+	hypothetical protein	NA	A0A0P0ZCH9	Stx2-converting_phage	65.3	5.1e-62
WP_047720830.1|2687480_2687678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720829.1|2688136_2688706_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	72.5	2.2e-79
WP_045419636.1|2688749_2688959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720828.1|2688961_2690140_+|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	28.8	4.8e-28
WP_047720827.1|2690393_2691674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720826.1|2692478_2695844_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004114150.1|2695850_2697284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024274502.1|2697283_2697544_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024274503.1|2697803_2699744_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.2	1.0e-54
WP_004114157.1|2699736_2700510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720825.1|2700864_2703354_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	6.6e-19
WP_127472320.1|2704410_2704713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004103976.1|2704735_2705842_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004114163.1|2706171_2706663_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
2708681:2708697	attR	TGCGCTCGCCCGCGCTG	NA	NA	NA	NA
>prophage 7
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	3633460	3686598	6155924	head,tRNA,plate,tail,transposase	Vibrio_phage(64.71%)	63	NA	NA
WP_004115399.1|3633460_3634180_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004105734.1|3634316_3635375_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004105744.1|3635402_3635678_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004105745.1|3635725_3636811_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	4.9e-11
WP_016807921.1|3637004_3638261_+	nucleoside permease	NA	NA	NA	NA	NA
WP_047720685.1|3638329_3640468_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_004115404.1|3640905_3641622_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_176678782.1|3641987_3642137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105750.1|3642512_3643424_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004105755.1|3643636_3644530_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_048258012.1|3644685_3645564_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_004105759.1|3645941_3646490_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_047720684.1|3646529_3647003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004105763.1|3646995_3647820_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004105765.1|3648457_3648862_+	VOC family protein	NA	NA	NA	NA	NA
WP_004105767.1|3649005_3649368_-	RidA family protein	NA	NA	NA	NA	NA
WP_004105769.1|3650161_3650680_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004105771.1|3650727_3651426_+	molecular chaperone	NA	NA	NA	NA	NA
WP_017145424.1|3651462_3653985_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_139153327.1|3654035_3654836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807484.1|3655080_3655650_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	54.1	7.2e-38
WP_016807483.1|3655813_3656062_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	84.0	1.0e-33
WP_176678781.1|3656064_3658158_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	50.6	5.5e-184
WP_016807481.1|3658194_3659142_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	78.5	4.2e-139
WP_016807480.1|3659146_3659386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807479.1|3659388_3659646_+	hypothetical protein	NA	A0A0U5KSG7	unidentified_phage	48.7	8.6e-15
WP_016807478.1|3659655_3659943_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	3.8e-19
WP_016807477.1|3659958_3660576_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	61.4	1.2e-65
WP_016807476.1|3660656_3661154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807475.1|3661146_3661734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807474.1|3661730_3662285_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	44.4	1.5e-35
WP_026055841.1|3662287_3662683_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	60.2	7.2e-37
WP_016807472.1|3662685_3663201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807471.1|3663298_3663880_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.7	3.9e-39
WP_016807469.1|3664093_3664498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807468.1|3664485_3665097_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	2.9e-24
WP_016807467.1|3665093_3665324_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807466.1|3665304_3665607_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_016807465.1|3665616_3665904_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_004114569.1|3665906_3666182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807464.1|3666171_3666750_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.0	7.6e-51
WP_016807463.1|3666749_3668336_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.7	4.6e-199
WP_047720489.1|3668335_3669907_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_139153325.1|3669890_3670334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807460.1|3670337_3671180_+|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_016807459.1|3671412_3672384_+	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807458.1|3672386_3673289_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807456.1|3673993_3674434_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_047720682.1|3674433_3674976_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	4.9e-60
WP_047720681.1|3674972_3675584_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.0e-37
WP_047720680.1|3675586_3675817_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_047720679.1|3675818_3677297_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	59.2	2.5e-162
WP_047720678.1|3677306_3677660_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_016807450.1|3677663_3678047_+|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_016807449.1|3678145_3679957_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	32.6	1.8e-69
WP_047720677.1|3679956_3681213_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	2.9e-87
WP_047720676.1|3681205_3682297_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	48.8	3.2e-90
WP_047720675.1|3682287_3682827_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.3	3.0e-33
WP_019704449.1|3682823_3683276_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_047720674.1|3683262_3684339_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.6	6.0e-102
WP_047720673.1|3684323_3684908_+	YmfQ family protein	NA	A0A2I7S9L6	Vibrio_phage	47.2	2.8e-45
WP_016807442.1|3684910_3685723_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_016807441.1|3685722_3686598_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
>prophage 8
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	3753911	3793174	6155924	integrase,head,tRNA,capsid,plate,terminase,tail,portal,holin,lysis	Erwinia_phage(35.71%)	48	3762015:3762060	3794802:3794847
WP_032729227.1|3753911_3754925_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.4e-108
WP_001144069.1|3755162_3755378_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016808010.1|3755611_3757354_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	3.4e-70
WP_004105908.1|3757503_3759348_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_047720667.1|3759588_3760233_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047720666.1|3760229_3761357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105914.1|3761353_3761860_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3762015:3762060	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
WP_071845060.1|3762217_3762436_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	1.2e-38
WP_047720665.1|3762502_3763672_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.4	3.7e-206
WP_047720664.1|3763668_3764154_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	96.9	1.7e-83
WP_047720663.1|3764168_3766610_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	87.6	0.0e+00
WP_000763323.1|3766602_3766722_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_047720662.1|3766754_3767090_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
WP_047720661.1|3767153_3767672_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	5.0e-94
WP_047720660.1|3767687_3768875_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.4	3.0e-211
WP_047720659.1|3768985_3770146_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	48.3	7.8e-47
WP_047720658.1|3770236_3770491_-	hypothetical protein	NA	L0ARW5	Klebsiella_phage	53.0	1.0e-15
WP_052959183.1|3770493_3772599_-	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.3	1.2e-109
WP_047720657.1|3772604_3773186_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	50.8	3.5e-48
WP_047720656.1|3773193_3774102_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	69.5	7.8e-111
WP_047720655.1|3774106_3774454_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	75.7	1.4e-44
WP_047720654.1|3774450_3775092_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	90.6	4.5e-105
WP_047720653.1|3775222_3775948_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_047720652.1|3776014_3776464_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	93.3	2.0e-67
WP_047045389.1|3776456_3776924_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_077257940.1|3776886_3777060_-|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	96.5	6.8e-24
WP_047720651.1|3777031_3777445_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	93.4	2.8e-63
WP_032413164.1|3777441_3777939_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	3.9e-88
WP_032413163.1|3777925_3778222_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	96.9	2.9e-46
WP_015370176.1|3778224_3778428_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_047720648.1|3778427_3778937_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	95.9	6.2e-89
WP_047720645.1|3779030_3779780_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	91.2	2.6e-112
WP_047720643.1|3779784_3780852_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	93.2	6.0e-187
WP_047720642.1|3780927_3781782_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	94.7	1.9e-151
WP_047720640.1|3781947_3783717_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
WP_047720639.1|3783716_3784763_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	92.8	7.7e-187
WP_047720637.1|3785141_3785939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720635.1|3786052_3786784_-	hypothetical protein	NA	Q37850	Escherichia_phage	87.2	7.9e-122
WP_176678780.1|3787092_3787278_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	78.7	9.2e-19
WP_176678794.1|3787420_3789493_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	91.8	0.0e+00
WP_047720629.1|3789641_3789863_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	6.0e-33
WP_047720628.1|3789862_3790090_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	94.7	2.4e-29
WP_047720626.1|3790157_3790496_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	8.0e-53
WP_032433679.1|3790459_3790660_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_015959030.1|3790667_3791177_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	4.4e-87
WP_001630878.1|3791207_3791471_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_047720623.1|3791600_3792176_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_047720621.1|3792175_3793174_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.4e-192
3794802:3794847	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
>prophage 9
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	4563778	4657830	6155924	head,protease,tRNA,plate,tail,transposase	Vibrio_phage(62.16%)	101	NA	NA
WP_004107369.1|4563778_4564216_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_004107372.1|4564260_4565202_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_004107374.1|4565219_4566137_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.1	6.7e-17
WP_004107377.1|4566451_4567381_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004107380.1|4567709_4568345_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004107383.1|4568341_4569244_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_123830053.1|4569256_4572307_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004107391.1|4572463_4573300_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_004107394.1|4573428_4573641_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004107397.1|4573805_4574504_-	porin	NA	NA	NA	NA	NA
WP_004107400.1|4574726_4575569_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_047720505.1|4575870_4576509_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_023301751.1|4576680_4576905_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_047720504.1|4576907_4578986_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.1	4.2e-168
WP_047720503.1|4579022_4579970_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	77.8	3.0e-137
WP_004114539.1|4579974_4580214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720501.1|4580216_4580504_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	4.9e-19
WP_044348544.1|4580519_4581137_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.9	3.4e-65
WP_016807476.1|4581217_4581715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959182.1|4581707_4582307_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	45.5	1.1e-12
WP_047720500.1|4582303_4582858_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	45.1	1.1e-35
WP_047720499.1|4582854_4583247_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	63.3	3.8e-38
WP_047720498.1|4583252_4583576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720497.1|4583679_4584258_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	3.3e-38
WP_047720495.1|4584471_4584876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720494.1|4584863_4585475_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	3.7e-24
WP_047720492.1|4585471_4585702_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807466.1|4585682_4585985_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_016807465.1|4585997_4586285_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_044348586.1|4586287_4586572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044348588.1|4586561_4587137_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	56.8	6.4e-50
WP_044348590.1|4587133_4588723_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	69.8	1.2e-199
WP_047720489.1|4588722_4590294_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	9.6e-157
WP_139153325.1|4590277_4590721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807460.1|4590724_4591567_+|head	phage head morphogenesis protein	head	M1PVV7	Vibrio_phage	55.4	2.5e-87
WP_016807459.1|4591799_4592771_+	I protein	NA	M1Q578	Vibrio_phage	48.7	1.8e-73
WP_016807458.1|4592773_4593676_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	60.9	2.3e-102
WP_016807456.1|4594380_4594821_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	3.2e-33
WP_016807455.1|4594820_4595363_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	3.4e-61
WP_016807454.1|4595359_4595971_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.6	4.6e-38
WP_016807453.1|4595973_4596204_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_016807452.1|4596205_4597687_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	58.9	1.6e-161
WP_016807451.1|4597696_4598050_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_016807450.1|4598053_4598437_+|tail	phage tail assembly protein	tail	A0A2P9JZJ9	Alteromonadaceae_phage	41.3	4.4e-15
WP_047720486.1|4598535_4600329_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	30.3	1.4e-63
WP_016807448.1|4600328_4601585_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	41.7	3.8e-87
WP_016807447.1|4601577_4602669_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.1	5.2e-93
WP_016807446.1|4602659_4603199_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	45.8	1.0e-33
WP_016807445.1|4603195_4603648_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	8.6e-26
WP_047720484.1|4603634_4604711_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	53.7	2.0e-105
WP_016807443.1|4604695_4605280_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_016807442.1|4605282_4606095_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	56.1	6.5e-32
WP_016807441.1|4606094_4606970_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	38.0	9.8e-26
WP_016807439.1|4608961_4609231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720482.1|4609293_4610085_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_047720481.1|4610096_4610594_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004107407.1|4610607_4611786_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_004107410.1|4611782_4612265_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_047720480.1|4612439_4615040_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_157776753.1|4615172_4615403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004116804.1|4615576_4616557_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004107427.1|4616568_4616883_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004107430.1|4616875_4618243_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004107433.1|4618229_4619072_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_024274856.1|4619128_4619398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004107437.1|4619407_4619845_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_024274857.1|4619841_4620393_+	ATPase AAA	NA	NA	NA	NA	NA
WP_004116813.1|4620524_4621559_+	YiiG family protein	NA	NA	NA	NA	NA
WP_004107443.1|4621596_4621920_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_016809579.1|4621919_4622579_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_004107447.1|4622679_4623228_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004107449.1|4623303_4624299_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004107452.1|4624413_4626537_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_024274858.1|4626578_4627844_+	MFS transporter	NA	NA	NA	NA	NA
WP_004107456.1|4627883_4628477_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_047720479.1|4628579_4629959_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_004107460.1|4630369_4631380_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004107462.1|4631451_4632840_+	MFS transporter	NA	NA	NA	NA	NA
WP_004116819.1|4632943_4634308_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004107466.1|4634362_4634677_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_047720477.1|4634673_4635822_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_047720476.1|4635982_4636987_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032729189.1|4636983_4637988_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004107475.1|4639636_4640623_-	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004107477.1|4640704_4641535_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_004107479.1|4641670_4642930_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_047720475.1|4642926_4644393_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_004107487.1|4644704_4645541_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_073971822.1|4645506_4646463_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_004107493.1|4646468_4647503_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_004107495.1|4647794_4648415_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	3.2e-63
WP_047721119.1|4648486_4649161_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|4649253_4650627_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004107514.1|4650623_4651322_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004107516.1|4651471_4651975_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_004107519.1|4652124_4653021_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_004107521.1|4653223_4654186_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004107523.1|4654246_4654732_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_047720474.1|4654824_4655751_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004107529.1|4655955_4657290_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
WP_004107530.1|4657299_4657830_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 10
NZ_CP017928	Klebsiella oxytoca strain CAV1015 chromosome, complete genome	6155924	6043356	6087034	6155924	tRNA,capsid,plate,terminase,holin	Enterobacteria_phage(21.57%)	66	NA	NA
WP_047720298.1|6043356_6044742_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	7.9e-46
WP_004099787.1|6045036_6045249_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004099791.1|6045250_6046117_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
WP_004151317.1|6047591_6047927_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_047720296.1|6047939_6048179_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	6.3e-12
WP_047720295.1|6048331_6048550_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	46.2	1.2e-06
WP_025269983.1|6048546_6048738_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_047720292.1|6048734_6049313_-	morphogenetic protein	NA	M1F3E2	Salmonella_phage	50.5	9.9e-43
WP_017898877.1|6049309_6049531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720291.1|6049527_6050184_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	6.0e-113
WP_047671926.1|6050180_6050609_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.7	2.6e-64
WP_023283324.1|6050605_6051229_-	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.1	7.9e-46
WP_014342891.1|6051225_6051561_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_032431540.1|6051740_6052025_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.5e-39
WP_019725103.1|6052114_6052309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176678792.1|6052953_6053160_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	65.7	6.2e-16
WP_047720289.1|6053182_6053650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720286.1|6053646_6053970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047721102.1|6054018_6054717_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.2	1.2e-106
WP_004201115.1|6054828_6055056_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004139615.1|6055096_6055318_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_047720283.1|6055403_6056258_+	replication protein	NA	K7PGT1	Enterobacteria_phage	55.7	3.4e-63
WP_047720282.1|6056242_6057112_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.2	4.0e-96
WP_047720280.1|6057108_6057402_+	protein ren	NA	M1FPD5	Enterobacteria_phage	62.4	2.3e-24
WP_047720277.1|6057955_6058381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959179.1|6058377_6059001_+	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	41.1	2.6e-12
WP_047720276.1|6059000_6059519_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	92.1	6.7e-91
WP_052959178.1|6059515_6059797_+	hypothetical protein	NA	O64352	Escherichia_phage	72.7	9.1e-10
WP_125961865.1|6060282_6060855_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	45.2	2.1e-13
WP_158414337.1|6060847_6061003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720274.1|6061088_6061346_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.7	4.1e-25
WP_040239931.1|6061546_6062002_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.9	2.3e-55
WP_047720271.1|6062001_6062172_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	73.2	4.3e-15
WP_047720270.1|6062164_6062746_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	47.3	1.3e-39
WP_047720268.1|6062742_6062967_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	61.6	7.5e-23
WP_047720267.1|6062963_6063104_+	YlcG family protein	NA	NA	NA	NA	NA
WP_012542610.1|6063100_6063601_+	late gene antiterminator protein	NA	G8C7V7	Escherichia_phage	92.1	8.7e-88
WP_031280382.1|6064082_6064382_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_047720262.1|6064378_6064921_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	1.1e-78
WP_167879619.1|6064917_6065094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720260.1|6065523_6066159_+	hypothetical protein	NA	I6S676	Salmonella_phage	80.7	1.6e-102
WP_047720257.1|6066190_6066676_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	80.1	9.7e-68
WP_047720256.1|6066677_6068354_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.1	3.3e-248
WP_047720253.1|6068354_6069875_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.8	4.0e-99
WP_047720252.1|6069927_6070617_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	51.3	9.6e-61
WP_077257936.1|6070679_6072497_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.3	1.2e-57
WP_047720249.1|6072498_6072981_+	hypothetical protein	NA	A0A2R3UAX9	Myoviridae_environmental_samples	57.7	1.3e-32
WP_047720248.1|6072980_6074018_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	1.4e-84
WP_047720246.1|6074019_6074346_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	3.6e-10
WP_047720245.1|6074345_6074789_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	5.7e-14
WP_047720244.1|6074791_6075355_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	5.7e-19
WP_047720243.1|6075351_6075720_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	2.1e-06
WP_047720241.1|6075701_6076253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720240.1|6076256_6077738_+	DUF3383 domain-containing protein	NA	I2GUE7	Acinetobacter_phage	33.0	1.6e-57
WP_023304864.1|6077737_6078181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720237.1|6078357_6078888_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	67.2	1.8e-62
WP_047720234.1|6078966_6079443_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	31.1	1.6e-06
WP_047720233.1|6079644_6081543_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	62.6	1.7e-38
WP_047720232.1|6081546_6082386_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.1	2.0e-28
WP_019725008.1|6082387_6082693_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_047720230.1|6082689_6083559_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.8	3.0e-27
WP_047720228.1|6083548_6084136_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	2.9e-05
WP_047720225.1|6084138_6084792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047721096.1|6084857_6085214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720222.1|6085221_6086454_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	4.6e-106
WP_047720220.1|6086446_6087034_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	42.9	1.1e-33
>prophage 1
NZ_CP017931	Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-111, complete sequence	111395	0	100927	111395	capsid,integrase,tail,portal,terminase	Salmonella_phage(86.25%)	120	12703:12723	35116:35136
WP_047719668.1|2016_3561_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	40.1	2.8e-44
WP_009484919.1|3643_3958_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	69.8	2.3e-33
WP_047719669.1|3968_4661_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	77.6	1.4e-99
WP_047719670.1|4657_4909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719672.1|5099_6287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719673.1|6435_7101_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	75.2	4.1e-93
WP_047719674.1|7105_7480_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	54.3	9.9e-20
WP_047719675.1|7808_8555_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	55.2	4.4e-75
WP_047719676.1|8593_9955_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	69.8	1.6e-179
WP_047719677.1|10090_11206_+	DNA primase catalytic core, N-terminal domain protein	NA	J9Q720	Salmonella_phage	66.6	8.9e-149
WP_047719678.1|11271_12180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719679.1|12266_12722_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	42.4	4.6e-27
12703:12723	attL	AAACAAAGGAAAACACATGAA	NA	NA	NA	NA
WP_047719680.1|12718_13183_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_047719681.1|13182_14511_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	71.5	4.4e-187
WP_047719682.1|14507_14723_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	57.1	2.2e-16
WP_047719683.1|14877_15129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719685.1|16276_16888_+	hypothetical protein	NA	S4TP42	Salmonella_phage	35.1	6.6e-21
WP_047719686.1|17097_17568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077257924.1|17746_18184_+	DUF2829 domain-containing protein	NA	K4N0H8	Escherichia_phage	43.0	1.2e-21
WP_047719687.1|18180_18426_+	hypothetical protein	NA	A0A1S6UB66	Serratia_phage	56.8	2.3e-17
WP_047719688.1|18437_18683_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	42.3	2.2e-12
WP_047719689.1|18896_19232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719690.1|19228_19744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678772.1|19947_20091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719692.1|20833_21325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052959163.1|21553_22633_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	27.2	1.5e-20
WP_047719694.1|22622_22928_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047719695.1|23532_25503_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	44.2	5.5e-125
WP_047719696.1|25599_26838_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	61.0	2.8e-143
WP_052959164.1|27015_29388_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	67.0	7.3e-310
WP_052959165.1|29458_30619_+	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	61.1	1.5e-138
WP_047719697.1|30615_31038_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	38.5	1.2e-13
WP_047719698.1|31475_32186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719699.1|32346_32787_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	46.9	7.8e-32
WP_047719700.1|32853_33834_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	45.6	9.5e-62
WP_047719701.1|33894_34857_+	exonuclease	NA	J9Q7S6	Salmonella_phage	64.1	4.5e-117
WP_047719702.1|34853_35114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719703.1|35131_36169_+	recombinase	NA	J9Q736	Salmonella_phage	74.8	6.1e-152
35116:35136	attR	AAACAAAGGAAAACACATGAA	NA	NA	NA	NA
WP_047719737.1|36155_36875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719704.1|36959_37163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719705.1|37159_37987_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	78.2	5.7e-100
WP_052959167.1|38125_38863_+	hypothetical protein	NA	G4KK93	Yersinia_phage	33.0	6.3e-26
WP_047719706.1|39145_39400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052959174.1|39540_39747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153316.1|39930_40278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719710.1|40753_41878_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	48.3	2.7e-76
WP_047719711.1|42196_42844_+	hypothetical protein	NA	J9Q739	Salmonella_phage	55.2	6.0e-65
WP_047719712.1|43080_44166_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	71.8	1.5e-148
WP_047719713.1|44162_46079_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	61.8	2.7e-214
WP_047719714.1|46068_46767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719715.1|46783_47356_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	58.7	9.8e-59
WP_047719739.1|47438_49769_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	70.7	0.0e+00
WP_052959168.1|49864_50269_+	DUF2591 family protein	NA	NA	NA	NA	NA
WP_047719716.1|50282_51425_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	80.0	1.3e-179
WP_052959175.1|51618_52365_+	hypothetical protein	NA	J9Q742	Salmonella_phage	51.0	1.6e-61
WP_047719718.1|52561_53653_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	59.2	3.1e-130
WP_047719719.1|53654_54068_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	38.4	3.1e-14
WP_176678773.1|54076_54541_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	53.9	5.2e-42
WP_052959171.1|54537_55188_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	37.7	8.6e-27
WP_047719721.1|55241_55649_+	hypothetical protein	NA	J9Q743	Salmonella_phage	37.6	9.8e-13
WP_047719722.1|55645_56188_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	58.7	3.6e-55
WP_139153317.1|56271_57135_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	42.1	4.3e-26
WP_139153318.1|57408_57825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719724.1|57866_58952_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_047719725.1|59149_59761_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	71.2	3.4e-78
WP_047719726.1|59943_60168_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	51.4	1.5e-15
WP_052959161.1|60738_61302_+	ribonuclease H	NA	J9Q745	Salmonella_phage	39.1	1.1e-30
WP_047719727.1|61955_62381_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	77.3	4.1e-54
WP_047719728.1|62380_62536_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_076752079.1|62599_63349_+	Rha family transcriptional regulator	NA	J9Q7T3	Salmonella_phage	64.3	5.9e-80
WP_047719619.1|63435_63870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719620.1|63925_64243_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_047719621.1|64394_64688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719622.1|64869_65520_-	hypothetical protein	NA	G8C7R6	Escherichia_phage	48.1	5.2e-56
WP_047719623.1|65529_65829_-	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	34.3	3.1e-08
WP_047719624.1|65964_66225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719625.1|66221_66872_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	54.2	2.4e-53
WP_047719626.1|66975_68643_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	64.6	1.2e-210
WP_047719627.1|68651_68831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719628.1|68872_69484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719629.1|69557_69785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719630.1|69856_70177_+	hypothetical protein	NA	J9Q750	Salmonella_phage	69.8	1.3e-41
WP_139153311.1|70199_70580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719632.1|70631_70901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139153312.1|72059_72254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719633.1|72403_72613_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	72.9	2.5e-20
WP_047719634.1|72609_72978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719635.1|73138_73468_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	53.3	3.2e-14
WP_047719636.1|73594_74035_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	43.7	8.7e-23
WP_047719637.1|74138_74378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719638.1|74597_75080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719639.1|75669_76314_-	hypothetical protein	NA	J9Q754	Salmonella_phage	49.8	1.3e-51
WP_139153313.1|76945_77479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139153314.1|77543_77897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719642.1|77942_79520_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	70.9	1.6e-212
WP_047719643.1|79585_80299_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	65.7	1.7e-84
WP_047719644.1|80282_80957_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	64.8	3.4e-71
WP_047719645.1|80949_81591_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	85.3	2.9e-96
WP_047719646.1|81580_82138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719647.1|82134_83025_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	78.1	2.1e-137
WP_047719648.1|83034_83301_+	hypothetical protein	NA	J9Q757	Salmonella_phage	76.1	1.0e-31
WP_047719649.1|83470_84061_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	61.3	6.5e-58
WP_047719650.1|84060_85317_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	88.5	1.5e-229
WP_047719651.1|85348_86923_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	73.0	5.2e-227
WP_047719652.1|86935_87802_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	56.1	2.1e-76
WP_047719653.1|87831_88704_+|capsid	phage capsid protein	capsid	J9Q710	Salmonella_phage	81.4	1.0e-131
WP_047719654.1|88777_89221_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	44.6	2.8e-21
WP_047719655.1|89262_89688_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	63.6	1.2e-42
WP_047719656.1|89687_90521_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	48.9	7.0e-74
WP_047719657.1|90531_90876_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	57.0	5.5e-33
WP_047719658.1|90866_91361_+	hypothetical protein	NA	J9Q711	Salmonella_phage	51.2	1.4e-34
WP_077257922.1|91357_91741_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	44.4	1.7e-30
WP_047719660.1|91833_92274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047719662.1|93222_93540_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	66.7	4.8e-31
WP_047719731.1|93665_93893_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	76.7	4.0e-24
WP_047719663.1|93897_98400_+	tape measure protein	NA	J9Q712	Salmonella_phage	36.8	2.7e-188
WP_047719664.1|98446_98782_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	70.0	1.3e-42
WP_047719665.1|98836_99535_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	75.2	2.5e-101
WP_047719666.1|99524_100328_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	74.8	7.9e-115
WP_047719667.1|100315_100927_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	57.1	3.6e-59
>prophage 1
NZ_CP017930	Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114	114139	1442	54331	114139	transposase,integrase	uncultured_Caudovirales_phage(28.57%)	54	2116:2130	43420:43434
WP_000050481.1|1442_2984_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2116:2130	attL	ACACCCTCAGCCATC	NA	NA	NA	NA
WP_003833285.1|4290_4743_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|4784_5429_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|5919_6759_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|7163_8705_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|8970_9471_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|9470_10040_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_000845039.1|10642_11656_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001082319.1|11813_12617_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|12616_13453_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_004248792.1|13633_14425_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000057569.1|14439_14781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|15236_15941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001572372.1|16106_16583_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572373.1|16659_18279_-	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_072196614.1|18467_19436_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_004248839.1|19474_20821_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_000723070.1|21038_21473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|21730_22846_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|22968_23241_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000193207.1|23706_24525_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001371952.1|24521_25727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121164.1|25790_25994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078513.1|26006_27326_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|27348_27516_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833380.1|27576_29004_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000464825.1|29218_29734_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975181.1|29736_30633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|30680_30995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|31068_31326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|32312_32510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864986.1|32650_32926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927306.1|33417_34896_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|34914_35742_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|35801_36227_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|36239_37529_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|37574_37895_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|37981_38686_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000125668.1|38718_40122_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_022652343.1|40341_41310_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_012695467.1|41331_41916_-	MFS transporter	NA	NA	NA	NA	NA
WP_021243026.1|41993_43151_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695469.1|43344_44238_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
43420:43434	attR	ACACCCTCAGCCATC	NA	NA	NA	NA
WP_012695470.1|44374_45190_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_013815099.1|45350_46319_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_001567369.1|46796_47429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|47457_48861_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|49061_49544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|49531_49798_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004206660.1|50242_50473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|50486_50690_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004206662.1|50750_51242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176678774.1|51663_52632_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.1e-184
WP_077257929.1|53362_54331_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	6.3e-183
>prophage 1
NZ_CP017932	Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-76, complete sequence	76186	22910	48308	76186	transposase,protease,integrase	Escherichia_phage(40.0%)	25	21558:21572	33937:33951
21558:21572	attL	GGGGTCGTCTCAGAA	NA	NA	NA	NA
WP_000845048.1|22910_23924_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|24218_24773_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|24903_25734_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|25871_26504_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|26588_27041_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|27263_27611_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|27604_28444_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_047715689.1|28571_29072_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|29578_30343_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|30497_31202_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000522996.1|32281_32707_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|32734_33010_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|33025_33391_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|33462_33918_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000654805.1|35304_36273_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
33937:33951	attR	TTCTGAGACGACCCC	NA	NA	NA	NA
WP_032491180.1|36393_37254_+	class A extended-spectrum beta-lactamase SHV-30	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|37274_38036_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004206881.1|38143_41041_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	2.5e-182
WP_000509966.1|41135_41741_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004206885.1|42323_44411_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_004206886.1|44423_45374_-	DsbC family protein	NA	NA	NA	NA	NA
WP_004206887.1|45384_46647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257921.1|46691_46967_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206889.1|47191_47575_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004206890.1|47654_48308_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP017929	Klebsiella oxytoca strain CAV1015 plasmid pKPC_UVA02, complete sequence	113105	40502	100115	113105	transposase	uncultured_Caudovirales_phage(15.38%)	54	NA	NA
WP_139153319.1|40502_41667_+|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_003830760.1|42569_43349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274510.1|43402_43822_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104877.1|43832_44054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085947.1|44053_44731_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.9e-29
WP_000334635.1|45082_45754_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_000600201.1|45933_46356_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_000457553.1|46355_47627_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	2.7e-157
WP_000756331.1|47772_48744_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	9.6e-115
WP_000817638.1|48740_49946_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_003830762.1|50553_52380_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_000695683.1|52551_52902_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	2.4e-20
WP_000725002.1|53050_53482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059177.1|53718_55188_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	1.8e-27
WP_000697973.1|55189_55870_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	1.9e-32
WP_000475508.1|56059_57445_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001246157.1|57473_57827_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000168542.1|57918_59211_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000574019.1|59221_62368_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	2.3e-61
WP_000758233.1|62454_62895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003830763.1|63013_65467_+	Ag(+)-translocating P-type ATPase SilP	NA	E4ZFI9	Streptococcus_phage	34.9	1.3e-80
WP_000843500.1|65497_65695_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001667049.1|65725_66466_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	33.3	8.0e-13
WP_000688485.1|66749_67196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047719746.1|67430_69248_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001667050.1|69253_70141_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_000906228.1|70180_70561_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_001667051.1|70565_71495_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_001188929.1|71548_72229_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	35.4	2.1e-31
WP_000671200.1|72225_73626_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	8.3e-19
WP_000753365.1|73834_74269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091963.1|74681_75278_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.4	1.4e-20
WP_000728912.1|75401_76331_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.8	1.9e-75
WP_000176304.1|76327_76939_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000429587.1|76935_77331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003830765.1|77383_78247_-	3'-5' exoribonuclease	NA	K7RFY5	Vibrio_phage	35.4	1.1e-26
WP_001247114.1|78239_79355_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152391.1|79590_81306_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|81415_84445_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|84551_85577_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|85573_86353_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|86739_87621_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|87870_89190_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_047719748.1|89521_90004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110156.1|90077_91055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114211.1|91345_91699_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	49.6	1.7e-24
WP_000855178.1|91746_92109_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001010162.1|92126_93878_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000922626.1|93922_95212_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	8.7e-172
WP_000065805.1|95224_95650_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_162862902.1|95681_97433_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000034288.1|97459_97822_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_001000741.1|97897_98443_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022542389.1|99110_100115_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
