The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017920	Mycobacterium tuberculosis strain TB282 chromosome, complete genome	4425860	393120	405867	4425860	protease,head,terminase,capsid,integrase	Mycobacterium_phage(57.14%)	21	396777:396804	406402:406429
WP_003413845.1|393120_393879_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A249XSS8	Mycobacterium_phage	40.8	4.7e-16
WP_003899423.1|394794_395076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085334930.1|395253_395427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413719.1|395423_395678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413717.1|395688_395922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900544.1|396020_396293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899422.1|396198_396588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899421.1|396584_396812_+	hypothetical protein	NA	NA	NA	NA	NA
396777:396804	attL	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
WP_003899420.1|396956_398084_+|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
WP_003900543.1|398086_398449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899418.1|398465_398726_+	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003899417.1|398722_399115_+	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899416.1|399116_400544_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899415.1|400540_400786_+	antitoxin	NA	NA	NA	NA	NA
WP_003899414.1|400865_401189_+	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899413.1|401221_401848_+|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899412.1|402000_402534_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003901443.1|402541_403981_+|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003908028.1|404151_404403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900539.1|404390_404855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|404868_405867_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
406402:406429	attR	TGGTGCGCGATACTGGGATTGAACCAGT	NA	NA	NA	NA
>prophage 3
NZ_CP017920	Mycobacterium tuberculosis strain TB282 chromosome, complete genome	4425860	3984470	4077389	4425860	tRNA,transposase	Burkholderia_virus(28.57%)	56	NA	NA
WP_087902221.1|3984470_3985732_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003417912.1|3986173_3987163_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_003918607.1|3987159_3988998_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003417908.1|3989006_3989897_+	diterpene synthase	NA	NA	NA	NA	NA
WP_003417905.1|3989901_3991407_+	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417903.1|3991445_3992099_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417900.1|3992206_3993634_-	amidase	NA	NA	NA	NA	NA
WP_003417897.1|3993638_3993887_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003900037.1|3993887_3994529_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417895.1|3994607_3994712_-	PE family protein	NA	NA	NA	NA	NA
WP_003417892.1|3994765_3995941_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003900036.1|3995982_3997323_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003908228.1|3997514_4000754_+	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_003417882.1|4000842_4001277_-	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003417881.1|4001275_4001920_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003901617.1|4004062_4004527_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003901616.1|4004762_4007393_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|4007389_4007782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003417772.1|4007759_4008128_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417769.1|4008108_4008690_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417767.1|4008696_4009248_+	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417765.1|4009244_4009613_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003900033.1|4009729_4010920_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417760.1|4010961_4011219_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003417757.1|4011215_4011491_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417751.1|4011614_4012460_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417749.1|4012456_4012750_+	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417745.1|4012763_4013153_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417741.1|4013267_4013528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071854233.1|4013362_4013773_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417739.1|4013670_4014042_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_003417738.1|4014123_4014918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938650.1|4026647_4026935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016810328.1|4027151_4027970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_049961743.1|4028006_4028453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003901612.1|4029078_4038552_+	PPE family protein	NA	NA	NA	NA	NA
WP_003417619.1|4038807_4039065_+	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_153302052.1|4039494_4045374_+	PE domain-containing protein	NA	NA	NA	NA	NA
WP_079157397.1|4045422_4058220_+	PPE family protein	NA	NA	NA	NA	NA
WP_003417461.1|4058228_4058960_-	methyltransferase	NA	NA	NA	NA	NA
WP_003417458.1|4058956_4060096_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003900028.1|4060107_4061457_-	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417452.1|4061739_4062969_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_009940431.1|4063035_4063668_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417440.1|4063952_4064963_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003417435.1|4064983_4065853_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003900026.1|4065886_4066327_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417421.1|4066801_4067647_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417418.1|4067837_4068989_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417416.1|4068985_4070494_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417415.1|4070589_4071807_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003902446.1|4071875_4073243_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417413.1|4073251_4074190_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902445.1|4074122_4075652_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009937401.1|4075673_4075835_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087902221.1|4076128_4077389_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
