The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015191	Corynebacterium pseudotuberculosis strain 48, complete genome	2403301	134881	158075	2403301	portal,protease,head,integrase,capsid	Corynebacterium_phage(96.43%)	31	131064:131076	139001:139013
131064:131076	attL	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653254.1|134881_135913_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.5	2.3e-18
WP_048653255.1|136442_137057_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|137509_138736_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|138904_139744_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
139001:139013	attR	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653259.1|140661_140886_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
WP_155760557.1|140888_141035_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|141316_141724_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|141733_142225_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|142342_142579_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|142777_143047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653264.1|143337_143811_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	9.5e-84
WP_048653265.1|143837_144659_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|144679_144877_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|144873_145107_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|145130_145355_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|145338_145656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|145782_146529_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|146686_147733_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|147963_148581_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|148632_148950_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|149066_149459_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|151064_152306_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|152302_153349_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|153345_154596_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|154788_155271_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|155267_155630_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|155622_155889_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|155878_156256_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|156284_157232_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|157326_157704_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|157865_158075_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015191	Corynebacterium pseudotuberculosis strain 48, complete genome	2403301	163758	172778	2403301	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|163758_164550_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|164512_165373_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|165373_166453_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|166452_167829_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|168277_168865_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|168972_169710_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|169709_169949_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|169951_170416_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|170412_170751_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|171095_172778_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015191	Corynebacterium pseudotuberculosis strain 48, complete genome	2403301	1793305	1871010	2403301	protease,integrase,bacteriocin	Agrobacterium_phage(15.38%)	58	1840175:1840202	1846087:1846114
WP_048653450.1|1793305_1794592_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1794752_1797557_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797633_1798263_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798278_1798878_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799088_1800441_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801229_1801472_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801608_1802385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802471_1803482_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803599_1804073_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804139_1804760_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805093_1807709_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1808130_1808709_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1808827_1809220_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809231_1810128_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810131_1810740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1810745_1811174_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811381_1813052_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814328_1816083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816079_1817618_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817644_1819123_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819119_1821723_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821722_1822736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822732_1823713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1823751_1823928_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824001_1825453_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825474_1826233_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826229_1827153_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827243_1829289_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1829881_1832167_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832186_1832387_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832727_1834554_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1834829_1835825_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1835951_1836755_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1836820_1837480_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837659_1838487_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838540_1839731_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840175:1840202	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840349_1841483_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1841934_1842873_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1842935_1843745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1844825_1845383_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_014367502.1|1846426_1847425_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846087:1846114	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847624_1848179_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848187_1848532_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848653_1848929_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849017_1849497_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849534_1850188_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850200_1850590_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850720_1859819_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860043_1860349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860509_1861625_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1863502_1864261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866030_1866477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866564_1866924_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1866991_1867615_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867611_1868346_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868384_1869152_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869224_1870118_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870191_1871010_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015191	Corynebacterium pseudotuberculosis strain 48, complete genome	2403301	2019635	2028096	2403301	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|2019635_2021384_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|2021361_2022030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|2022037_2022424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|2022420_2022936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|2022946_2023393_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|2023389_2023845_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|2023846_2024188_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|2024174_2024957_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|2024958_2025522_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|2025514_2027518_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|2027514_2028096_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
