The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015190	Corynebacterium pseudotuberculosis strain 46, complete genome	2366565	1756545	1834250	2366565	protease,integrase,bacteriocin	Agrobacterium_phage(15.38%)	58	1803415:1803442	1809326:1809353
WP_048653450.1|1756545_1757832_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1757992_1760797_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1760873_1761503_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1761518_1762118_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1762328_1763681_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1764469_1764712_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1764848_1765625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1765711_1766722_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1766839_1767313_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1767379_1768000_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1768333_1770949_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1771370_1771949_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1772067_1772460_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1772471_1773368_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1773371_1773980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1773985_1774414_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1774621_1776292_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1777568_1779323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1779319_1780858_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1780884_1782363_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1782359_1784963_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1784962_1785976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1785972_1786953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1786991_1787168_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1787241_1788693_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1788714_1789473_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1789469_1790393_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1790483_1792529_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1793121_1795407_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1795426_1795627_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1795967_1797794_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1798069_1799065_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1799191_1799995_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1800060_1800720_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1800899_1801727_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1801780_1802971_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1803415:1803442	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1803589_1804723_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_048653455.1|1805173_1806178_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1806174_1806984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1808064_1808622_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_014367502.1|1809665_1810664_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1809326:1809353	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1810863_1811418_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1811426_1811771_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1811892_1812168_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1812256_1812736_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1812773_1813427_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1813439_1813829_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1813959_1823058_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1823282_1823588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1823748_1824864_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1826742_1827501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1829270_1829717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1829804_1830164_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1830231_1830855_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1830851_1831586_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1831624_1832392_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1832464_1833358_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1833431_1834250_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015190	Corynebacterium pseudotuberculosis strain 46, complete genome	2366565	1982875	1991336	2366565	holin	Pandoravirus(33.33%)	11	NA	NA
WP_048653473.1|1982875_1984624_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.7	1.5e-62
WP_014367622.1|1984601_1985270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655796.1|1985277_1985664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1985660_1986176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1986186_1986633_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014655798.1|1986629_1987085_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1987086_1987428_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1987414_1988197_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1988198_1988762_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014523609.1|1988754_1990758_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|1990754_1991336_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
