The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015183	Corynebacterium pseudotuberculosis strain 32, complete genome	2403533	134865	158059	2403533	portal,capsid,protease,head,integrase	Corynebacterium_phage(96.43%)	31	131048:131060	138985:138997
131048:131060	attL	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653254.1|134865_135897_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	24.5	2.3e-18
WP_048653255.1|136426_137041_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|137493_138720_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|138888_139728_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
138985:138997	attR	ACGGAATTGTTCT	NA	NA	NA	NA
WP_048653259.1|140645_140870_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
WP_155760557.1|140872_141019_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|141300_141708_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|141717_142209_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|142326_142563_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|142761_143031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048653264.1|143321_143795_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	9.5e-84
WP_048653265.1|143821_144643_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|144663_144861_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|144857_145091_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|145114_145339_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|145322_145640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|145766_146513_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|146670_147717_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|147947_148565_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|148616_148934_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|149050_149443_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|151048_152290_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|152286_153333_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|153329_154580_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|154772_155255_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|155251_155614_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|155606_155873_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|155862_156240_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|156268_157216_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|157310_157688_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|157849_158059_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015183	Corynebacterium pseudotuberculosis strain 32, complete genome	2403533	163742	172762	2403533	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|163742_164534_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|164496_165357_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|165357_166437_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|166436_167813_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|168261_168849_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|168956_169694_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|169693_169933_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|169935_170400_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|170396_170735_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|171079_172762_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015183	Corynebacterium pseudotuberculosis strain 32, complete genome	2403533	1793539	1871243	2403533	bacteriocin,integrase,protease	Agrobacterium_phage(15.38%)	59	1840408:1840435	1846319:1846346
WP_048653450.1|1793539_1794826_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1794986_1797791_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797867_1798497_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798512_1799112_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799322_1800675_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801463_1801706_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801842_1802619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802705_1803716_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803833_1804307_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804373_1804994_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805327_1807943_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417248.1|1808364_1808943_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1809061_1809454_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809465_1810362_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810365_1810974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1810979_1811408_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811615_1813286_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814562_1816317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816313_1817852_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817878_1819357_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819353_1821957_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821956_1822970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822966_1823947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1823985_1824162_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824235_1825687_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825708_1826467_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826463_1827387_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827477_1829523_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1830115_1832401_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832420_1832621_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832960_1834787_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1835062_1836058_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1836184_1836988_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1837053_1837713_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837892_1838720_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838773_1839964_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840408:1840435	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840582_1841716_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1842167_1843106_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_048653456.1|1843168_1843978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1845058_1845616_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_071437099.1|1845958_1846189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367502.1|1846658_1847657_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846319:1846346	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847856_1848411_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848419_1848764_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848885_1849161_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849249_1849729_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849766_1850420_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850432_1850822_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850952_1860051_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860275_1860581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860741_1861857_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014524035.1|1863734_1864493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866262_1866709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866796_1867156_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1867224_1867848_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867844_1868579_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868617_1869385_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869457_1870351_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870424_1871243_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
