The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015192	Corynebacterium pseudotuberculosis strain 34, complete genome	2403454	145239	166875	2403454	portal,integrase,protease,head,capsid	Corynebacterium_phage(100.0%)	30	139056:139069	149223:149236
139056:139069	attL	ACAAGTGACGGCAA	NA	NA	NA	NA
WP_048653255.1|145239_145854_+	DUF433 domain-containing protein	NA	A0A1W6JRB2	Corynebacterium_phage	100.0	5.1e-114
WP_048653257.1|146307_147534_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	100.0	5.1e-238
WP_048653258.1|147702_148542_-	DUF3037 domain-containing protein	NA	A0A1W6JRH2	Corynebacterium_phage	100.0	1.5e-153
WP_048653259.1|149460_149685_-	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	100.0	2.3e-40
149223:149236	attR	TTGCCGTCACTTGT	NA	NA	NA	NA
WP_155760557.1|149687_149834_-	hypothetical protein	NA	A0A1W6JRC4	Corynebacterium_phage	100.0	4.3e-19
WP_048653260.1|150115_150523_-	hypothetical protein	NA	A0A1W6JRC2	Corynebacterium_phage	100.0	4.5e-74
WP_048653261.1|150532_151024_-	hypothetical protein	NA	A0A1W6JRB0	Corynebacterium_phage	100.0	2.6e-84
WP_048653262.1|151141_151378_+	helix-turn-helix domain-containing protein	NA	A0A1W6JRC7	Corynebacterium_phage	100.0	3.1e-35
WP_048653263.1|151576_151846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071417233.1|152389_152611_+	hypothetical protein	NA	A0A1W6JRE9	Corynebacterium_phage	100.0	2.4e-34
WP_048653265.1|152637_153459_+	antirepressor	NA	A0A1W6JRI1	Corynebacterium_phage	100.0	9.8e-153
WP_048653266.1|153479_153677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048653267.1|153673_153907_+	hypothetical protein	NA	A0A1W6JRC8	Corynebacterium_phage	100.0	2.7e-39
WP_048653268.1|153930_154155_+	hypothetical protein	NA	A0A1W6JRD0	Corynebacterium_phage	100.0	6.1e-33
WP_048653269.1|154138_154456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048653270.1|154582_155329_+	hypothetical protein	NA	A0A1W6JRD1	Corynebacterium_phage	100.0	1.9e-134
WP_048653271.1|155486_156533_+	HNH endonuclease	NA	A0A1W6JRD2	Corynebacterium_phage	100.0	7.0e-196
WP_048653272.1|156763_157381_+	hypothetical protein	NA	A0A1W6JRC6	Corynebacterium_phage	100.0	2.6e-113
WP_003850222.1|157432_157750_+	hypothetical protein	NA	A0A1W6JRD4	Corynebacterium_phage	100.0	1.4e-51
WP_148660556.1|157866_158259_+	hypothetical protein	NA	A0A1W6JRH9	Corynebacterium_phage	100.0	1.6e-65
WP_048653273.1|159864_161106_+|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	100.0	2.7e-239
WP_048653274.1|161102_162149_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1W6JRD9	Corynebacterium_phage	100.0	4.7e-200
WP_048653275.1|162145_163396_+|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	100.0	6.8e-230
WP_048653276.1|163588_164071_+	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	100.0	1.7e-88
WP_048653277.1|164067_164430_+	hypothetical protein	NA	A0A1W6JRD5	Corynebacterium_phage	100.0	2.2e-64
WP_048653278.1|164422_164689_+	hypothetical protein	NA	A0A1W6JRE6	Corynebacterium_phage	100.0	2.5e-41
WP_048653279.1|164678_165056_+	hypothetical protein	NA	A0A1W6JRI9	Corynebacterium_phage	100.0	1.9e-66
WP_048653280.1|165084_166032_+	hypothetical protein	NA	A0A1W6JRH0	Corynebacterium_phage	100.0	1.8e-179
WP_048653281.1|166126_166504_+	hypothetical protein	NA	A0A1W6JRK1	Corynebacterium_phage	100.0	3.6e-62
WP_048653282.1|166665_166875_+	hypothetical protein	NA	A0A1W6JRF2	Corynebacterium_phage	100.0	4.7e-35
>prophage 2
NZ_CP015192	Corynebacterium pseudotuberculosis strain 34, complete genome	2403454	172558	181578	2403454	holin	Corynebacterium_phage(100.0%)	10	NA	NA
WP_048653283.1|172558_173350_+	hypothetical protein	NA	A0A1W6JRF0	Corynebacterium_phage	100.0	3.6e-152
WP_048653284.1|173312_174173_+	hypothetical protein	NA	A0A1W6JRE8	Corynebacterium_phage	100.0	1.4e-149
WP_048653285.1|174173_175253_+	hypothetical protein	NA	A0A1W6JRE7	Corynebacterium_phage	100.0	5.2e-162
WP_053071070.1|175252_176629_+	hypothetical protein	NA	A0A1W6JRF8	Corynebacterium_phage	100.0	5.6e-193
WP_148660557.1|177077_177665_+	hypothetical protein	NA	A0A1W6JRH8	Corynebacterium_phage	100.0	8.3e-114
WP_048653287.1|177772_178510_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JRK9	Corynebacterium_phage	100.0	1.9e-147
WP_081277226.1|178509_178749_+|holin	holin	holin	A0A1W6JRG0	Corynebacterium_phage	100.0	4.5e-34
WP_048653289.1|178751_179216_+	hypothetical protein	NA	A0A1W6JRF4	Corynebacterium_phage	100.0	1.6e-80
WP_048653290.1|179212_179551_+	hypothetical protein	NA	A0A1W6JRH1	Corynebacterium_phage	100.0	2.5e-54
WP_014654963.1|179895_181578_+	diphtheria toxin	NA	A0A1W6JRG3	Corynebacterium_phage	100.0	0.0e+00
>prophage 3
NZ_CP015192	Corynebacterium pseudotuberculosis strain 34, complete genome	2403454	1793369	1871078	2403454	bacteriocin,integrase,protease	Agrobacterium_phage(15.38%)	60	1840241:1840268	1846153:1846180
WP_048653450.1|1793369_1794656_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.1	6.7e-132
WP_014655697.1|1794816_1797621_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1797697_1798327_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1798342_1798942_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1799152_1800505_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1801293_1801536_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1801672_1802449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1802535_1803546_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1803663_1804137_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1804203_1804824_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014655699.1|1805157_1807773_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_071417247.1|1807909_1808185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071417248.1|1808195_1808774_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1808892_1809285_+	globin	NA	NA	NA	NA	NA
WP_014655700.1|1809296_1810193_+	DMT family transporter	NA	NA	NA	NA	NA
WP_014655701.1|1810196_1810805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1810810_1811239_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1811446_1813117_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014523540.1|1814393_1816148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1816144_1817683_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014655705.1|1817709_1819188_+	nitroreductase	NA	NA	NA	NA	NA
WP_014655706.1|1819184_1821788_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1821787_1822801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1822797_1823778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014300888.1|1823816_1823993_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014655708.1|1824066_1825518_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1825539_1826298_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1826294_1827218_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_048653452.1|1827308_1829354_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014655710.1|1829946_1832232_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014401336.1|1832251_1832452_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014655711.1|1832792_1834619_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	5.2e-29
WP_048653453.1|1834894_1835890_+	oxidoreductase	NA	NA	NA	NA	NA
WP_048653454.1|1836016_1836820_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1836885_1837545_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014655714.1|1837724_1838552_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1838605_1839796_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1840241:1840268	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1840415_1841549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_148660561.1|1842000_1842939_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081353085.1|1843001_1843811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014733042.1|1844891_1845449_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.7	3.1e-33
WP_014367502.1|1846492_1847491_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1846153:1846180	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1847690_1848245_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1848253_1848598_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_014655719.1|1848719_1848995_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1849083_1849563_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1849600_1850254_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048653457.1|1850266_1850656_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014655721.1|1850786_1859885_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1860109_1860415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1860575_1861691_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_048653458.1|1862356_1863388_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1863569_1864328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367512.1|1866097_1866544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013242510.1|1866631_1866991_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_014367514.1|1867059_1867683_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_032802570.1|1867679_1868414_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_014523555.1|1868452_1869220_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_048653459.1|1869292_1870186_-	glutamate racemase	NA	NA	NA	NA	NA
WP_048653460.1|1870259_1871078_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
